Previous Article | Next Article ![]()
Journal of Bacteriology, February 2001, p. 1175-1183, Vol. 183, No. 4
Department of Microbiology and Biotechnology,
University of Ulm, Ulm,1 and Department
of Microbiology, National Research Center for Biotechnology,
Braunschweig,2 Germany
Received 14 August 2000/Accepted 16 November 2000
Group B streptococcus (GBS) is the leading cause of bacterial
sepsis and meningitis in neonates. N-terminal sequencing of major
proteins in the culture supernatant of a clinical isolate of GBS
identified a protein of about 50 kDa which could be detected in all of
27 clinical isolates tested. The corresponding gene, designated
pcsB, was isolated from a GBS cosmid library and
subsequently sequenced. The deduced PcsB polypeptide consists of 447 amino acid residues (Mr, 46,754),
carries a potential N-terminal signal peptide sequence of 25 amino
acids, and shows significant similarity to open reading frames of
unknown function from different organisms and to the murein hydrolase
P45 from Listeria monocytogenes. Northern blot analysis
revealed a monocistronic transcriptional organization for
pcsB in GBS. Insertional inactivation of pcsB
in the genome of GBS resulted in mutant strain Sep1 exhibiting a
drastically reduced growth rate compared to the parental GBS strain and
showing an increased susceptibility to osmotic pressure and to various antibiotics. Electron microscopic analysis of GBS mutant Sep1 revealed
growth in clumps, cell separation in several planes, and multiple
division septa within single cells. These data suggest a pivotal role
of PcsB for cell division and antibiotic tolerance of GBS.
Group B streptococcus (GBS), also
known as Streptococcus agalactiae, is part of the normal
human flora colonizing the respiratory, gastrointestinal, and
urogenital tracts. It is also the leading cause of bacterial sepsis and
meningitis in neonates in the United States and western Europe, and it
is a major cause of endocarditis and fever in parturient women
(2). In the last decade, the incidence of GBS infections
has increased especially in the elderly and in immunocompromised
persons (58), but despite its clinical importance, GBS is
only poorly understood on the molecular level.
Bacterial cell division is a complex interplay of topological
processes, biosynthetic reactions, and cleavage mechanisms. Septum
formation is initiated by the cooperative action of division inhibitors, topological specificity factors, and proteins constituting the cell division apparatus both found in gram-negative and
gram-positive bacteria (reviewed in reference 5, 31, and
42). In globular cells, like streptococci, the division septum
can be arranged in several orientations, resulting in the generation of
two daughter cells of the same size and shape. The choice of the
division plane determines the three-dimensional organization of the
multicellular arrays of progeny cells that are formed. In GBS, the
plane of division is approximately the same in each division cycle,
resulting in the formation of frequently long chains (20).
The division septum that is formed between the daughter cells is
composed of newly synthesized membrane and peptidoglycan components.
Peptidoglycan biosynthesis is accomplished by the insertion of
peptide-carrying disaccharide units into the existing murein sacculus
by transglycosylation and transpeptidation (34).
Cell division is terminated by the action of murein hydrolases that
split the peptidoglycan septum, thereby resulting in the release
of the daughter cells (reviewed in references 23, 45, and
46). Murein hydrolases have been shown to participate in a
number of important biological processes during cell growth and
division, including daughter cell separation, cell wall growth,
peptidoglycan recycling, and turnover (1, 24, 45). In
addition, these enzymes have been shown to contribute to the
pathogenicity of bacteria and are required for the bacterial susceptibility to antibiotics (24). Those murein
hydrolases that lead to the destruction of the cell wall and cause cell
lysis are known as autolysins.
This study describes the characterization of a protein, termed PcsB,
which is required for ordered cell wall separation of GBS. Insertional
inactivation of the pcsB gene exhibited a significant influence on cell septum formation and on the susceptibility of GBS to
different antibiotics.
Bacterial strains and culture conditions.
GBS strain 6313 is
a serotype III clinical isolate obtained from an infected neonate and
has been described previously (55). GBS mutant Sep1 is a
pcsB::pG+host6 derivative of GBS 6313 carrying a disrupted pcsB gene. The GBS strains belonging to
different serotypes are clinical isolates and have been described
elsewhere (6). Strains from Enterococcus faecium,
Lactococcus lactis, Staphylococcus aureus, and Bacillus subtilis were kindly provided by A. Podbielski (University of Rostock). Escherichia coli DH5
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1175-1183.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Identification and Molecular Analysis of PcsB, a Protein Required
for Cell Wall Separation of Group B Streptococcus
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
(19) was used
for the construction of a GBS pTEX5236 cosmid gene library and served
as host for the recombinant pG+host6 plasmid. E. coli BL21(DE3) (9) harbored the recombinant plasmid
pET28 and was used for the production of PcsB fusion protein.
Plasmids and cosmids used for cloning purposes.
A pTEX5236
(51) cosmid gene library from GBS 6313 was constructed
essentially as described by Xu et al. (60). Briefly, 500 µg of chromosomal DNA was digested with 0.1 U of Sau3A for 30 min at 37°C. Fragments were size separated in a sodium chloride salt gradient by ultracentrifugation. A fraction containing fragments of
20 kb was ligated with the BamHI-digested cosmid
pTEX5236, packaged by using the Gigapack III Gold packaging extract kit (Stratagene), and used to infect E. coli DH5
. Recombinant
clones were screened on LB medium containing 1 mM
isopropyl-
-D-thiogalactopyranoside (IPTG) and
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside
(X-Gal; 50 µg/ml); 1,160 individual white colonies from the primary
selection plate were picked and stored in 96-well microtiter dishes in
LB-tetracycline-glycerol solution.
Construction of the GBS pcsB mutant Sep1.
The
thermosensitive plasmid pG+host6 (Appligene) was used for
targeted disruption of pcsB in GBS 6313 to construct mutant
Sep1. An internal pcsB fragment was amplified by PCR using
the primers 5'CGCGGATCCGATGACTTTGACTCGAA and
5'TGGCACAAGCTTTCCAATCGTCTGAGACAC) (the
BamHI and HindIII restriction sites used for
cloning are underlined). The resulting PCR product and plasmid
pG+host6 were digested with BamHI and
HindIII, ligated, and transformed into E. coli
DH5
. Transformation of the plasmid into GBS was performed as
described by Ricci et al. (40). Integration of the plasmid
into the chromosome of GBS 6313 was performed by a temperature shift to
37°C essentially as described by Maguin et al. (32),
with the modification that all growth media contained D-sorbitol (500 mM). Successful disruption of
pcsB was confirmed by Southern blotting with
PstI-digested chromosomal DNA of GBS 6313 and of GBS Sep1 by
using a digoxigenin-labeled pcsB fragment obtained with the
primers 5'TCTTCAACACCTAGAGCG and
5'TCCAATCGTCTGAGACAC.
RNA preparation and Northern blot analysis. Total RNA from GBS 6313 was prepared after growth to an optical density of 0.4. Cells were disrupted mechanically using glass beads in a Ribolyser (Hybaid), and RNA was purified with a RNeasy kit (Qiagen). Northern blot analysis using a digoxigenin-labeled PCR product of pcsB obtained with the primers 5'GATGACTTTGACTCGAA and 5'GCTTGCTTGTTAGCTGC was performed using a Dig labeling and detection kit (Roche Molecular Biochemicals) as instructed by the manufacturer, with subsequent detection by enhanced chemiluminescence (ECL).
General DNA techniques. Chromosomal GBS DNA was isolated as described by Pospiech and Neumann (39). Conventional techniques for DNA manipulation such as restriction enzyme digests, PCR, ligation, transformation by electroporation, and Southern blotting were performed as described by Sambrook et al. (43).
Electron microscopy and antibiotic testing. Transmission electron microscopy and scanning electron microscopy were performed as described by Valentin-Weigand et al. (54, 55). MICs of penicillin G, cefotaxime, imipenem, meropenem, ceftazidime, vancomycin, ofloxacin, ciprofloxacin, gentamicin, netilmicin, and co-trimoxazole were determined on sheep blood agar plates using antibiotic-containing E-test strips (AB Biodisk) as instructed by the manufacturer.
N-terminal sequencing of proteins and peptides. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), subsequently transfered onto a polyvinylidene difluoride membrane (Amersham/Pharmacia), and visualized with amido black. N-terminal amino acid sequencing was performed on excised bands using an Applied Biosystems 447A pulsed-liquid protein sequencer. Generation of internal PcsB peptides using endoproteinase Lys-C (Promega) and separation of the peptides were performed as described by Maiorino et al. (33).
Preparation of PcsB fusion protein and generation of anti-PcsB antibodies. PcsB fusion protein was synthesized in recombinant E. coli BL21 by the addition of 1 mM IPTG after the culture had reached an optical density of 1.0. The cells were disrupted using a French press cell, and the PcsB fusion protein was solubilized with 6 M guanidine hydrochloride because it formed inclusion bodies in E. coli. The fusion protein was purified by cobalt affinity chromatography in the presence of 8 M urea as instructed by Clontech. The purified PcsB fusion protein was dialyzed against 100 mM phosphate buffer (pH 7.4), resulting in the precipitation of high amounts of PcsB. After centrifugation of the precipitate, the PcsB protein in the supernatant was used for the enzymatic digestion of GBS cell walls. For the generation of anti-PcsB antibodies, affinity-purified PcsB fusion protein was size separated by SDS-PAGE and blotted onto nitrocellulose; after staining with Ponceau S, the PcsB-containing band was cut out. After the nitrocellulose membrane was dissolved in dimethyl sulfoxide, the solution was used for the immunization of mice. Immunization consisted of two intramuscular applications of the purified protein within 2 weeks. Serum was collected 4 weeks after immunization.
Western blot analysis for detection of PcsB. Western blotting was performed essentially as described by Talay et al. (50), using a 1:500 dilution of the anti-PcsB antiserum, a 1:15,000 dilution of goat anti-mouse Fab fragments (Dianova), and subsequent detection using an Amersham/Pharmacia ECL kit. A 1:500 dilution of mouse preimmune serum was used for testing nonimmune binding of antibodies to proteins in culture supernatants of the different bacterial species.
Determination of lytic activity by SDS-PAGE. Peptidoglycan lytic activity was analyzed in a zymogram assay essentially as described by Foster (11). Culture supernatant of GBS was concentrated by precipitation with saturated (NH4)2SO4 and subsequent dialysis with 10 mM Tris-HCl (pH 7.6). The concentration of total proteins present in each preparation was determined by the Bradford assay (Bio-Rad) according to the manufacturer's directions. A 15-µg aliquot of each preparation was loaded onto an SDS-10% polyacrylamide gel containing 0.4% lyophilized GBS cells. Following electrophoretic separation of the loaded proteins, the murein hydrolases were allowed to hydrolyze the embedded bacterial cells by incubation of the gel in 1% Triton X-100-25 mM Tris-HCl (pH 7.6) buffer overnight at 37°C. After this incubation, the gel was stained using a 1% methylene blue-0.01 M KOH solution and destained in distilled water. Following destaining, the gel was photographed over a light box.
Enzymatic digestion of GBS cell walls. Cell walls were prepared essentially as described by Thumm and Götz (52). GBS was grown in 500 ml of THY medium to exponential phase, centrifuged, and washed two times with distilled water. The pellet was resuspended in 5 ml of distilled water and boiled for 30 min to inactivate autolysins. After cooling to 4°C, the cells were centrifuged and washed two times with distilled water. The pellet was resuspended in 2 volumes of distilled water, and 700-µl portions were transferred to new microcentrifuge tubes, each containing 250 µg of glass beads (150 to 212 µm). The cells were mechanically disrupted in a Ribolyzer (Hybaid), and the glass beads were removed by centrifugation at 2,000 × g with subsequent decanting of the supernatant. The pellet was washed two times with distilled water and lyophilized. Then 0.5-mg aliquots of lyophilized GBS cell walls were resuspended in 1 ml of 100 mM phosphate buffer, pH 7.4, followed by the addition of 100 µl of phosphate buffer containing no protein (negative control), 5 µg of mutanolysin (positive control), or 50 µg of purified PcsB fusion protein. The samples were incubated at 37°C, and the turbidity was measured at 30-min intervals at 600 nm. Protein concentrations were determined by the Bradford assay (Bio-Rad) according to the manufacturer's directions.
Nucleotide sequence accession number. The nucleotide sequence of the pcsB region from S. agalactiae was submitted to the EMBL nucleotide sequence database and assigned accession no. AJ277292.
| |
RESULTS |
|---|
|
|
|---|
N-terminal sequencing of major proteins in the culture supernatant
of GBS.
Concentrated culture supernatant of the GBS serotype III
strain 6313 was subjected to SDS-PAGE and subsequently stained with Coomassie brilliant blue (Fig. 1A). Three
major protein bands with sizes of 70, 55, and 50 kDa were identified in
the culture supernatant of GBS 6313. The N terminus of the 70-kDa
polypeptide (ETINPETSLTMATA) showed significant similarity to the N
terminus of a protein of unknown function from group A streptococcus,
named immunogenic secreted protein (35). The N termini of
the 55-kDa protein (PPDAIVPSNDDFA) and the 50-kDa protein
(DDFDSKIAATDSVINTLSGQQ), however, showed no
similarity to any protein in the database.
|
Isolation and characterization of the p50 gene.
After proteolytic digestion of P50 with endoproteinase Lys-C, the N
termini of the two peptides Pep2 (GQVGALESQQSELEAQNAQ) and
Pep3 (GNLTNYINTILNSK) were obtained. The structural data
were used to synthesize three degenerate primers for the amplification of p50 internal sequences by PCR. Primer 1 (GATGATTTYGAYWSNAARATH) was derived from the N terminus of
P50, while primers 2 (YTGNGCRTTYTGNGCYTC) and 3 (NATDGTRTTDATRTARTTNGT) correspond to the N-terminal peptide sequences of Pep2 and -3, respectively. PCR using primers 1 and 2 and
primers 1 and 3 amplified two different fragments of 180 and 280 bp,
respectively, from the chromosome of GBS 6313. Sequencing of both
fragments revealed sequence identity between the 180- and 280-bp
fragments, showing that the two primer sets had amplified the same
chromosomal region of GBS. The 280-bp fragment was subsequently used as
a digoxigenin-labeled probe to isolate the p50 gene from a
GBS cosmid library in E. coli. Three of 378 cosmid clones
hybridized to the 280-bp fragment. One of the cosmids was partially
digested, and fragments ranging in size between 2 to 4 kb were ligated
in the E. coli plasmid pUC18. The insert of one clone
carrying the putative p50 gene on a 2,437-bp fragment was
subsequently sequenced. Computer analysis of the obtained sequence
revealed one complete open reading frame (ORF1) extending from bp 627 to 1967 and one incomplete ORF (ORF2) extending from bp 2094 to the end
of the sequenced 2,437-bp fragment (Fig.
2A). Downstream of ORF1, at positions
1991 to 2002, a region of dyad symmetry followed by several T residues
similar to rho-independent transcription terminators (41)
could be identified, indicating transcriptional termination immediately
downstream of ORF1. The deduced polypeptide of ORF1 has a size of
447 amino acids with a molecular mass of 46,754 Da, corresponding in
average to the size of the P50 protein. Further inspection of the
deduced amino acid sequence of ORF1 revealed at the N terminus a
typical signal sequence of 25 amino acids with a putative cleavage site
between Ala-25 and Asp-26. However, no C-terminal cell wall anchor
motif (LPXTG) could be detected, indicating that this protein is
translocated across the cytoplasmic membrane but not covalently bound
to the cell wall. Immediately downstream of the predicted signal
cleavage site, a stretch of amino acids matched exactly the previously
sequenced N terminus of the P50 protein. In addition, the two internal
peptide sequences of P50 were identical to portions of the deduced
amino acid sequence of the p50 gene. ORF1, therefore,
represents the p50 gene. Since subsequent functional
analysis revealed that P50 is a protein for cell separation of GBS, the
p50 gene was termed pcsB. Analysis of the deduced
amino acid sequence of ORF2 showed that it encodes a polypeptide with
high similarity to phosphoribosyl pyrosphosphate synthetases which are
involved in the synthesis of ribonucleoside monophosphates. ORF2 was
therefore designated prs.
|
The pcsB gene is transcribed monocistronically. To test if pcsB forms a transcriptional unit with the proximal prs gene, the transcriptional organization of pcsB was characterized by Northern blot analysis. Total RNA from GBS strain 6313 isolated at mid-logarithmic growth phase was probed with a 450-bp digoxigenin-labeled pcsB DNA fragment, giving a single band at 1.5 kb (Fig. 2B). Since the pcsB structural gene has a size of 1.3 kb, this result indicates that pcsB is transcribed monocistronically in GBS.
PcsB is similar to proteins from different gram-positive bacteria. Database analysis of the PcsB protein revealed 41.8% similarity to Usp45 from L. lactis (56), 34% similarity to P54 from E. faecium (13), 28.3% similarity to P45 from Listeria monocytogenes (44), and 27.9% similarity to the deduced amino acid sequence of an ORF, named YvcE, in the genome of B. subtilis (29). Among the proteins that exhibit homology to PcsB, a biological function is only known for the L. monocytogenes protein P45, which has been shown to exhibit murein hydrolase activity (44). The C-terminal portion of P45 reveals significant similarity to the C terminus of the Iap protein from L. monocytogenes, also representing a murein hydrolase (59). Iap and P45 both have at their C termini a stretch of amino acids (FDCSG) carrying a conserved cysteine residue which is discussed to be required for catalytic activity (59). Interestingly, this stretch of amino acids can also be found in P54 from E. faecium (44) and YcvE from B. subtilis. Although PcsB from GBS and Usp45 from L. lactis do not possess this conserved region, they share a conserved cysteine residue at a location similar to that of the cysteine-carrying motif in P45 from L. monocytogenes.
PcsB and PcsB-related proteins are widely distributed in GBS and
other gram-positive bacteria.
The pcsB gene was cloned,
in frame, without its signal peptide-encoding sequence into the pET28
expression system, placing a hexahistidine affinity tag at the N
terminus of the resultant fusion protein. The recombinant
plasmid was subsequently transformed into E. coli BL21(DE3).
By Co2+ affinity chromatography, an apparently pure
preparation of the PcsB fusion protein was obtained as shown by
SDS-PAGE and subsequent Coomassie blue staining (Fig. 1A, lane 3).
Polyclonal antibodies against PcsB were obtained after immunization of
mice with the purified PcsB fusion protein. To test for the
distribution of the PcsB protein in different GBS serotypes and in
other bacterial species, culture supernatants of E. faecium,
L. lactis, S. aureus, B. subtilis, and
E. coli, and of 21 GBS strains belonging to six different
serotypes, were tested for the presence of the PcsB protein (Fig.
3). Bands reacting with the anti-PcsB
serum could be detected in the culture supernatant of every GBS strain
tested, indicating that PcsB is common to GBS. However, the detected
proteins ranged in size between 50 and 55 kDa, suggesting size
variation of PcsB among different GBS strains. Interestingly, the
culture supernatant of E. faecium and B. subtilis contained proteins of 50 and 62 kDa, respectively, that
interacted strongly with the anti-PcsB antibodies. In addition,
the culture supernatant of L. lactis showed weak
cross-reactivity of the antibodies with a 50-kDa protein.
Although the culture supernatant of S. aureus contained a
protein of 53 kDa that interacted with the anti-PcsB antibodies,
experiments with preimmune serum showed a nonimmune interaction of this
protein with immunoglobulins (not shown), suggesting that this protein
is the immunoglubulin-binding protein A from S. aureus. In
the culture supernatant of E. coli, no protein could be
identified that interacted with the anti-PcsB antibodies. These data
suggest a wide distribution of PcsB-related proteins in different
gram-positive bacteria and support the results of the database analysis
that identified PcsB-homologous polypeptides in E. faecium,
L. lactis, and B. subtilis.
|
Construction of the GBS pcsB mutant strain Sep1. To analyze the function of PcsB for GBS, we attempted to disrupt the pcsB in the genome of GBS 6313 by insertional inactivation using a 458-bp internal pcsB fragment cloned into the thermosensitive shuttle vector pG+host6. However, despite the isolation of several putative pcsB mutants, subsequent Southern blot experiments revealed an unaltered organization of the pcsB gene in these strains. We therefore speculated on an essential function of PcsB for GBS under the chosen experimental conditions. Since PcsB is located extracellularly and shows limited similarity to the autolysin P45 from L. monocytogenes (44), we assumed that the disruption of pcsB might result in destabilization of the GBS cell wall with subsequent osmotic lysis. Therefore, insertional inactivation was performed in the presence of 500 mM D-sorbitol, which is not fermented by GBS but increases the osmotic strength of the medium (20). This approach resulted in the isolation of a pcsB mutant strain, which was termed Sep1. The successful inactivation of pcsB in strain Sep1 was confirmed by Southern blot analysis (not shown). Western blotting using polyclonal anti-PcsB antiserum showed a strong band in the culture supernatant of GBS 6313 but no band in the culture supernatant of its isogenic mutant Sep1 (Fig. 1B). These data confirm the successful inactivation of the pcsB gene in GBS strain Sep1. Interestingly, a dramatically higher amount of a 55-kDa protein was detected in the culture supernatant of GBS Sep1 than in that of GBS 6313 (Fig. 1A). This indicates the attempt of strain Sep1 to compensate for the pcsB deficiency by overproduction of the 55-kDa protein, which might serve similar functions as PcsB.
Growth characteristics and antibiotic susceptibility of GBS mutant Sep1. While the GBS parent grew well on THY agar and blood agar plates as well as in THY broth, the Sep1 mutant exhibited poor growth both on THY agar and blood agar plates and no growth in THY broth. The two strains grew to about the same optical density in sorbitol-supplemented THY broth; however, mutant Sep1 showed a doubling time of 150 min, compared to 30 min for the GBS parent. A GBS control mutant carrying a chromosomal pG+host6 insertion in the femH gene exhibited a growth rate similar to that of the GBS parent (not shown). These results show that disruption of pcsB in GBS results in a dramatic reduction of growth rate.
In S. aureus, Streptococcus pneumoniae, and Streptococcus pyogenes, a defect in cell wall biosynthesis and turnover results in an altered susceptibility to
-lactam
antibiotics (3, 14, 18, 53). Therefore, the GBS parent and
its isogenic mutant Sep1 were tested for sensitivity to different
classes of antibiotics. As shown in Table
1, mutant strain Sep1 was 5 to 10 times
more susceptible than the GBS parental strain to all
-lactam
antibiotics tested. However, the two strains differed only slightly in
sensitivity to vancomycin, known to complex with the
D-alanyl-D-alanine subunits of the
peptidoglycan polymer (38). Strikingly, the GBS parent and
the Sep1 mutant differed significantly in susceptibility to different
classes of antibiotics known to act intracellularly. The Sep1 strain
was eight times more sensitive than the GBS parent to different
quinolones, and it showed 45- to 170-fold-increased susceptibility to
different aminoglycoside antibiotics. Toward cotrimoxazole, a
sulfonamide-trimethoprim combination, mutant strain Sep1 exhibited
340-fold-higher sensitivity than the parental GBS strain.
|
Microscopic analysis of GBS mutant Sep1.
Light microscopic
inspection of the GBS parent and the Sep1 mutant revealed growth in
irregular clumps for the Sep1 mutant, compared to regular chains for
the GBS parent (Fig. 4). Scanning electron microscopy showed a severely disturbed morphology for the Sep1
mutant (Fig. 5). Importantly, no uniform
cell forms were observed for this strain. While some cells were slice
shaped or kidney shaped (Fig. 5A1 and A2), others had an irregular
giant size (Fig. 5B) or exhibited cell division in different planes (Fig. 5C). This result prompted us to analyze the Sep1 mutant in more
detail by transmission electron microscopy. As depicted in Fig.
6A, the GBS parent shows single septum
formation in one plane, with subsequent cell wall separation between
daughter cells. During exponential growth, new septum formation is
initiated before splitting of the septum of the daughter cells occurs.
Transmission electron microscopy of the Sep1 mutant revealed
severalfold ingrowth of septa in different planes without subsequent
cell wall separation (Fig. 6B). Unequal septum formation of Sep1 not
only resulted in the formation of giant cells (Fig. 6C) but also
produced slice-shaped and kidney-shaped bacteria (Fig. 6D). Taken
together, these results indicate that PcsB is required for cell
division of GBS.
|
|
|
Test of PcsB for murein hydrolase activity. Cell division is terminated by the action of murein hydrolases that cleave bonds in the peptidoglycan polymer. To analyze if PcsB represents a murein hydrolase of GBS, concentrated culture supernatants of the GBS parent and the Sep1 mutant as well as purified PcsB fusion protein were tested in zymograms using embedded GBS cells as substrate. However, the culture supernatants of the GBS parent and the mutant strain Sep1 revealed no difference in their zymographic profiles, nor did the PcsB fusion protein show lytic activity (not shown). To avoid the denaturing conditions of SDS-PAGE, the purified PcsB protein was tested for autolytic activity using GBS cell walls in a photometric assay. Here again, the PcsB fusion protein was not able to hydrolyze GBS cell walls (not shown), indicating the absence of murein hydrolase activity of PcsB under the conditions tested.
| |
DISCUSSION |
|---|
|
|
|---|
Cell division of a bacterium requires a sophisticated concert of topological mechanisms, cell wall biosynthesis, and restricted cell wall degradation. Division is initiated by the ingrowth of a septum, usually located equidistant from the two cell poles. Selection of the midcell site for septum formation and the assembly of several proteins for the formation of a cell division apparatus have been the focus of intense research in gram-negative and gram-positive bacteria (reviewed in references 5, 31, and 42).
Homologs to E. coli proteins known to be involved in the initiation of septum formation and in the assembly of the cell division apparatus have been identified in a variety of bacterial species, including streptococci (42). Since the amino acid sequence of PcsB reveals no similarity to the above-mentioned proteins, it can be speculated that PcsB either is a novel component required for placement of the septum at the midpoint of the cell or plays a crucial role in the splitting of the septum. E. coli mutants impaired in localizing the midpoint of the cell are characterized by the generation of small spherical minicells (12), while those with defects in formation of the cell division apparatus grow uniformly as long, nonseptated filaments (21, 22). However, cultures of the GBS mutant Sep1, carrying a disrupted pcsB gene, revealed the presence of huge, small, as well as slice-shaped cells, a phenotype not matching the uniform phenotypes of the above-mentioned E. coli mutants. Since GBS mutant Sep1 continued to form new septa between still unseparated cells, it can be suggested that Sep1 is impaired in septum separation instead of the placement of the septum.
In E. coli, B. subtilis, and S. pyogenes, mutations in penicillin-binding proteins (PBPs) have
been shown to affect septum separation and to alter the shape of the
bacteria (7, 8, 18, 47). PBPs, collectively exhibiting
covalent binding to
-lactam antibiotics, represent transpeptidases,
endopeptidases, and carboxypeptidases, respectively, that are involved
in peptidoglycan cross-linking and metabolism of eubacteria (15,
48). In several GBS strains, six different PBPs, with molecular
masses of 86, 85, 80, 76, 70, and 42 kDa, have been identified
(10, 25). PcsB from GBS, migrating during SDS-PAGE at 50 kDa, does not correspond to the size of either of the PBPs from GBS. In
addition, the amino acid sequence of PcsB does not possess any of the
highly conserved motifs of PBPs (16), suggesting that PcsB
does not represent a PBP from GBS.
A plausible explanation for the phenotype of mutant Sep1 would be a lack of murein hydrolase activity at its septal sites. Murein hydrolases cleave bonds in the bacterial peptidoglycan, thereby allowing enlargement of the cell wall during growth (23, 45). Furthermore, they are required for splitting of the septum during cell division (46). Interestingly, PcsB reveals similarity to the L. monocytogenes protein P45, which was shown to possess murein hydrolase activity (44). The alignment of PcsB with proteins exhitibing similarity to PcsB revealed in the aligned proteins at approximately the same position a conserved cysteine residue, speculated to be required for murein hydrolase activity (44, 59). Since the PcsB protein revealed autolytic activity neither in zymograms nor in a photometric assay, it can be speculated that PcsB does not represent a murein hydrolase from GBS. However, our failure to detect murein hydrolase activity of PcsB could also be explained by an irreversible denaturation of the fusion protein during the purification procedure. Since the PcsB fusion protein formed inclusion bodies in E. coli, it had to be purified in the presence of urea, possibly resulting in a loss of enzymatic activity. PcsB might also require additional factors for activity that are missing in the purified protein preparation. Furthermore, not all murein hydrolases are potential autolytic enzymes (46), sugggesting that PcsB might play a pivotal role in murein hydrolysis without being able to function as an autolysin.
Inhibition of murein synthesis by
-lactam antibiotics is suggested
to result in the lysis of the cell by an uncontrolled action of murein
hydrolases (23). For E. coli, enterococci, and
pneumococci, it has been demonstrated that a decrease in murein hydrolase activity is correlated with a lower susceptibility to penicillin G and that an increase in murein hydrolase activity results
in enhanced penicillin G-induced lysis (17, 49, 53). Penicillin G tolerance of GBS has also been suggested to be correlated with a defect in the autolytic system (27). In contrast,
GBS mutant Sep1, speculated to be impaired in murein hydrolase
activity, reveals an increased susceptibility to
-lactam
antibiotics. Although the basis for this phenotype remains unclear, GBS
mutant Sep1 is also significantly more sensitive to different classes
of antibiotics that function intracellularly, i.e., quinolones,
aminoglycosides, and a sulfonamide-trimethroprim combination. Since in
gram-positive organisms the lipid bilayer of the cytoplasmic membrane
represents the major permeability barrier for antibiotics, it could be
argued that the cytoplasmic membrane of mutant Sep1 exhibits a higher permeability for different classes of antibiotics. However, the permeability of the cytoplasmic membrane cannot be changed
significantly, because this would result in improper functioning of
membrane proteins, subsequently leading to cell death
(37). It can therefore be speculated that the increased
susceptibility of mutant Sep1 to antibiotics acting intracellularly
originates in defects in its cell wall rather than within its
cytoplasmic membrane. In fact, the uptake of aminoglycosides by
enterococci has been demonstrated to be dependent on the composition of
the cell wall (36). In these bacteria, a combination
of a cell wall-active
-lactam antibiotic with an aminoglycoside
results in a synergistic bactericidal activity; i.e., the cell
wall-active drug enhances the ability of the aminoglycoside to reach
the 16S subunit of the ribosome (26, 30). Taken together, our data indicate that a defect in the cell wall metabolism of mutant
Sep1 results in an increased uptake of different kinds of antibiotics.
The drastically increased susceptibility of GBS strain Sep1 to different classes of antibiotics offers an exciting perspective for the treatment of GBS infections. Although GBS is uniformly susceptible to penicillin G, significant higher doses of this antibiotic are required for the treatment of a GBS infection compared to a S. pyogenes infection (2). In addition, 5 to 17% clinical isolates of GBS show increased in vitro tolerance against penicillin G; that is, the antibiotic is less bactericidal against these strains (4, 28). The importance of PcsB for the growth of GBS and for the sensitivity of GBS to different classes of antibiotics makes this protein an exciting subject for further research to elucidate its biochemical function and role in cell separation of GBS.
| |
ACKNOWLEDGMENTS |
|---|
We thank A. Podbielski for helpful discussion and critical reading of the manuscript and S. Sauter for excellent technical assistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Biotechnology, University of Ulm, Albert-Einstein-Allee 11, D-89069 Ulm, Germany. Phone: 49-731-5024853. Fax: 49-731-5022719. E-mail: dieter.reinscheid{at}biologie.uni-ulm.de.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Archibald, A. R., I. C. Hancock, and C. R. Harwood. 1993. Cell wall structure, synthesis, and turnover., p. 381-410. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria. American Society for Microbiology, Washington, D.C. |
| 2. | Baker, C. J., and M. S. Edwards. 1995. Group B streptococcal infections, p. 980-1054. In J. S. Remington, and J. O. Klein (ed.), Infectious diseases of the fetus and newborn infant. W. B. Saunders, Philadelphia, Pa. |
| 3. | Berger-Bächi, B., L. Barberis-Maino, A. Strässle, and F. H. Kayser. 1989. FemA, a host-mediated factor essential for methicillin resistance in Staphylococcus aureus: molecular cloning and characterisation. Mol. Gen. Genet. 219:263-269[CrossRef][Medline]. |
| 4. |
Betriu, C.,
M. Gomez,
A. Sanchez,
A. Cruceyra,
J. Romero, and J. J. Picazo.
1994.
Antibiotic resistance and penicillin tolerance in clinical isolates of group B streptococci.
Antimicrob. Agents Chemother.
38:2183-2186 |
| 5. | Bramhill, D. 1997. Bacterial cell division. Annu. Rev. Cell Dev. Biol. 13:395-424[CrossRef][Medline]. |
| 6. | Chhatwal, G. S., C. Laemmler, and H. Blobel. 1984. Guanidine extraction enhances the binding of human fibrinogen to group-B streptococci. Med. Microbiol. Immunol. 173:19-27[CrossRef][Medline]. |
| 7. | Daniel, R. A., E. J. Harry, and J. Errington. 2000. Role of penicillin-binding protein PBP 2B in assembly and functioning of the division machinery of Bacillus subtilis. Mol. Microbiol. 35:299-311[CrossRef][Medline]. |
| 8. |
Denome, S. A.,
P. K. Elf,
T. A. Henderson,
D. E. Nelson, and K. D. Young.
1999.
Escherichia coli mutants lacking all possible combinations of eight penicillin binding proteins: viability, characteristics, and implications for peptidoglycan synthesis.
J. Bacteriol.
181:3981-3993 |
| 9. | Dubendorff, J. W., and F. W. Studier. 1991. Controlling basal expression in an inducible T7 expression system by blocking the target T7 promoter with lac repressor. J. Mol. Biol. 219:45-59[CrossRef][Medline]. |
| 10. |
Fontana, R.,
R. Cerini,
P. Longoni,
A. Grossato, and P. Canepari.
1983.
Identification of a streptococcal penicillin-binding protein that reacts very slowly with penicillin.
J. Bacteriol.
155:1343-1350 |
| 11. |
Foster, S. J.
1992.
Analysis of the autolysins of Bacillus subtilis 168 during vegetative growth and differentiation by using renaturing polyacrylamide gel electrophoresis.
J. Bacteriol.
174:464-470 |
| 12. | Frazer, A. C., and R. Curtiss, III. 1975. Production, poperties and utility of bacterial minicells. Curr. Top. Microbiol. Immunol. 69:1-84[Medline]. |
| 13. |
Fürst, P.,
H. U. Mösch, and M. Solioz.
1989.
A protein of unusual composition from Enterococcus faecium.
Nucleic Acids Res.
17:6724 |
| 14. |
Garcia-Bustos, J., and A. Tomasz.
1990.
A biological price of antibiotic resistance: major changes in the peptidoglycan structure of penicillin-resistant pneumococci.
Proc. Natl. Acad. Sci. USA
87:5415-5419 |
| 15. |
Ghuysen, J.-M.
1991.
Serine -lactamases and penicillin-binding proteins.
Annu. Rev. Microbiol.
45:37-67[CrossRef][Medline].
|
| 16. |
Goffin, C., and J.-M. Ghuysen.
1998.
Multimodular penicillin-binding proteins: an enigmatic family of orthologs and paralogs.
Microbiol. Mol. Biol. Rev.
62:1079-1093 |
| 17. |
Goodell, E. W.,
R. Lopez, and A. Tomasz.
1976.
Suppression of lytic effect of beta-lactams on Escherichia coli and other bacteria.
Proc. Natl. Acad. Sci. USA
73:3293-3297 |
| 18. |
Gutmann, L., and A. Tomasz.
1982.
Penicillin-resistant and penicillin-tolerant mutants of group A streptococci.
Antimicrob. Agents Chemother.
22:128-136 |
| 19. | Hanahan, D. 1985. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[CrossRef]. |
| 20. | Hardie, J. 1986. Genus streptococcus Rosenbach 1884, p. 1051-1071. In P. Sneath (ed.), Bergey's manual of systematic bacteriology. The Williams & Wilkins Co., Baltimore, Md. |
| 21. | Hirota, Y., A. Ryter, and F. Jacob. 1968. Thermosensitive mutants of E. coli affected in the process of DNA synthesis and cellular division. Cold Spring Harbor Symp. Quant. Biol. 33:677-693[Medline]. |
| 22. | Hirota, Y., M. Ricard, and B. Shapiro. 1971. The use of thermosensitive mutants of E. coli in the analysis of cell division. Plenum Press, New York, N.Y. |
| 23. | Höltje, J.-V. 1995. From growth to autolysis: the murein hydrolases in Escherichia coli. Arch Microbiol. 164:243-254[CrossRef][Medline]. |
| 24. | Höltje, J.-V., and E. I. Tuomanen. 1991. The murein hydrolases of Escherichia coli: properties, functions and impact on the course of infections in vivo. J. Gen. Microbiol. 137:441-454[Medline]. |
| 25. |
Horne, D., and A. Tomasz.
1981.
pH-dependent penicillin tolerance of group B streptococci.
Antimicrob. Agents Chemother.
20:128-135 |
| 26. | Hunter, T. H. 1947. Use of streptomycin in the treatment of bacterial endocarditis. Am. J. Med. 2:436-442[CrossRef]. |
| 27. | Kim, K. S. 1985. Antimicrobial Susceptibility of GBS. Antibiot. Chemother. 35:83-89[Medline]. |
| 28. | Kim, K. S. 1988. Clinical perspectives on penicillin tolerance. J. Pediatr. 112:509-514[CrossRef][Medline]. |
| 29. | Kunst, F., N. Ogasawaka, I. Mozer, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256[CrossRef][Medline]. |
| 30. | Leclercq, R. 1997. Enterococci acquire new kinds of resistance. Clin. Infect. Dis. 24:S80-S84. |
| 31. | Lutkenhaus, J. 1999. The regulation of bacterial cell division: a time and place for it. Curr. Opin. Microbiol. 1:210-215. |
| 32. |
Maguin, E.,
H. Prevost,
S. Ehrlich, and A. Gruss.
1996.
Efficient insertional mutagenesis in lactococci and other gram-positive bacteria.
J. Bacteriol.
178:931-935 |
| 33. | Maiorino, M., C. Roche, M. Kiess, K. Koenig, D. Gawlik, M. Matthes, E. Naldini, R. Pierce, and L. Flohe. 1996. A selenium-containing phospholipid-hydroperoxide glutathione peroxidase in Schistosoma mansoni. Eur. J. Biochem. 238:838-844[Medline]. |
| 34. | Matsuhashi, M., M. Wachi, and F. Ishino. 1990. Machinery for cell growth and division: penicillin-binding proteins and other proteins. Res. Microbiol. 141:89-103[Medline]. |
| 35. | Mclver, K. S., S. Subbarao, E. M. Kellner, A. S. Heath, and J. R. Scott. 1996. Identification of isp, a locus encoding an immunogenic secreted protein common among group A streptococci. Infect. Immun. 64:2548-2555[Abstract]. |
| 36. |
Moellering, R. C.
1991.
The enterococcus: a classic example of the impact of antimicrobial resistance on therapeutic options.
J. Antimicrob. Chemother.
28:1-12 |
| 37. |
Nikaido, H.
1994.
Prevention of drug access to bacterial targets: permeability barriers and active efflux.
Science
264:382-388 |
| 38. | Perkins, H. R., and M. Nieto. 1974. The chemical basis for the action of the vancomycin group of antibiotics. Ann. N. Y. Acad. Sci. 235:348[Medline]. |
| 39. | Pospiech, A., and B. Neumann. 1995. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet. 11:217-218[CrossRef][Medline]. |
| 40. | Ricci, M. L., R. Manganelli, C. Berneri, G. Orefici, and G. Pozzi. 1994. Electrotransformation of Streptococcus agalactiae with plasmid DNA. FEMS Microbiol. Lett. 119:47-52[CrossRef][Medline]. |
| 41. | Rosenberg, M., and D. Court. 1979. Regulatory sequences involved in the promotion and termination of RNA transcription. Annu. Rev. Genet. 13:319-353[CrossRef][Medline]. |
| 42. | Rothfield, L., S. Justice, and J. Garcia-Lare. 1999. Bacterial cell division. Annu. Rev. Genet. 33:423-448[CrossRef][Medline]. |
| 43. | Sambrook, J., E. F. Fritsch, and J. Maniatis. 1989. Molecular cloning: a laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 44. | Schubert, K., A. M. Bichlmaier, E. Mager, K. Wolff, G. Ruhland, and F. Fiedler. 2000. P45, an extracelular 45 kDa protein of Listeria monocytogenes with similarity to protein p60 and exhibiting peptidoglycan lytic activity. Arch. Microbiol. 173:21-28[CrossRef][Medline]. |
| 45. | Shockman, G. D., and J.-V. Höltje. 1994. Microbial peptidoglycan (murein) hydrolases, p. 131-166. In J.-M. Ghuysen, and R. Hakenbeck (ed.), Bacterial cell wall. Elsevier Science B.V., Amsterdam, The Netherlands. |
| 46. | Shockman, G. D., C.-P. Chu, R. Kariyama, L. K. Tepper, and L. Daneo-Moore. 1993. Peptidoglycan (murein) hydrolases: unusual enzymes for unusual substrates, p. 213-227. In M. A. de Pedro (ed.), Bacterial growth and lysis. Plenum Press, New York, N.Y. |
| 47. |
Spratt, B. G.
1975.
Distinct penicillin binding proteins involved in the division, elongation and shape of Escherichia coli K12.
Proc. Natl. Acad. Sci. USA
72:2999-3003 |
| 48. |
Spratt, B. G.
1983.
Penicillin-binding proteins and the future of -lactam antibiotics.
J. Gen. Microbiol.
129:1247-1260[Medline].
|
| 49. | Storch, G. A., and D. J. Krogstad. 1981. Antibiotic-induced lysis of enterococci. J. Clin. Investig. 68:639-645. |
| 50. | Talay, S. R., E. Ehrenfeld, G. S. Chhatwal, and K. N. Timmis. 1991. Expression of the fibronectin-binding components of Streptococcus pyogenes in Escherichia coli demonstrates that they are proteins. Mol. Microbiol. 5:1727-1734[CrossRef][Medline]. |
| 51. | Teng, F., B. E. Murray, and G. M. Weinstock. 1998. Conjugal transfer of plasmid DNA from Escherichia coli to enterococci: a method to make insertion mutations. Plasmid 39:182-186[CrossRef][Medline]. |
| 52. | Thumm, G., and F. Götz. 1997. Studies of prolysostaphin processing and characterization of lysostaphin immunity factor (Lif) of Staphylococcus simulans biovar staphylolyticus. Mol. Microbiol. 23:1251-1256[CrossRef][Medline]. |
| 53. | Tomasz, A., A. Albino, and E. Zanati. 1970. Multiple antibiotic resistance in a bacterium with suppressed autolytic system. Nature 227:138-140[CrossRef][Medline]. |
| 54. | Valentin-Weigand, P., H. Jungnitz, A. Zock, M. Rohde, and G. S. Chhatwal. 1997. Characterization of group B streptococcal invasion in HEp-2 epithelial cells. FEMS Microbiol. Lett. 147:69-74[CrossRef][Medline]. |
| 55. | Valentin-Weigand, P., P. Benkel, M. Rohde, and G. S. Chhatwal. 1996. Entry and intracellular survival of group B streptococci in J774 macrophages. Infect. Immun. 64:2467-2473[Abstract]. |
| 56. | van Asseldonk, M., G. Rutten, M. Oteman, R. J. Siezen, W. M. de Vos, and G. Simons. 1990. Cloning of usp45, a gene encoding a secreted protein from Lactococcus lactis. Gene 95:155-160[CrossRef][Medline]. |
| 57. | Vieira, J., and J. Messing. 1982. The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268[CrossRef][Medline]. |
| 58. |
Waite, D. C.,
E. J. Alper, and B. J. Mady.
1996.
Adult group B streptococcal disease.
Ann. Intern. Med.
125:152-153 |
| 59. |
Wuenscher, M. D.,
S. Köhler,
A. Bubert,
U. Gerike, and W. Goebel.
1993.
The iap gene of Listeria monocytogenes is essential for cell vialbility, and its gene product, p60, has bacterioytic activity.
J. Bacteriol.
175:3491-3501 |
| 60. | Xu, Y., L. Jiang, B. Murray, and G. M. Weinstock. 1997. Enterococcus faecalis antigens in human infections. Infect. Immun. 65:4207-4215[Abstract]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||