Previous Article | Next Article ![]()
Journal of Bacteriology, February 2001, p. 1296-1299, Vol. 183, No. 4
Department of Microbiology, Eastman Dental
Hospital for Oral Health Care Sciences, University College London,
University of London, London WC1X 8LD, United
Kingdom,1 and
Verfügungsgebäude für Forschung und
Entwicklung, Institut für Medizinische Mikrobiologie und
Hygiene, Johannes-Gutenberg-Universität, 55101 Mainz,
Germany2
Received 21 August 2000/Accepted 21 November 2000
Previous work has identified the conjugative transposon
Tn5397 from Clostridium difficile. This element
was shown to contain a group II intron. Tn5397 can be
conjugatively transferred from C. difficile to
Bacillus subtilis. In this work we show that the intron is
spliced in both these hosts and that nonspliced RNA is also present. We
constructed a mutation in the open reading frame within the intron, and
this prevented splicing but did not prevent the formation of the
circular form of the conjugative transposon (the likely transposition
intermediate) or decrease the frequency of intergeneric transfer of
Tn5397. Therefore, the intron is spliced, but splicing is
not required for conjugation of Tn5397.
Conjugative transposons are genetic
elements that encode their own integration, excision, and transfer
functions. They are remarkably promiscuous and are capable of being
transferred across large phylogenetic distances. They are important
clinically, as they are one of the major vectors involved in the spread
of antibiotic resistance among bacterial pathogens. There are several
recent reviews describing the properties of conjugative transposons
(2, 17, 19, 20).
Tn5397 is a conjugative transposon isolated from the
gram-positive anaerobic pathogen Clostridium difficile
strain 630 (15, 16). Tn5397 encodes
tetracycline resistance via the tet(M) gene and has been
shown to be transferable by a conjugation-like process from C. difficile 630 to Bacillus subtilis CU2189 and back to C. difficile CD37 (16). It has also been shown
to be able to transfer between C. difficile strains
(16). Furthermore, Tn5397 has been shown to
readily transfer from a B. subtilis donor to a
Streptococcus acidominimus recipient in a model oral biofilm community, indicating that the element is likely to be able to transfer
to a new host in the natural environment (18). Physical and genetic analysis has shown that Tn5397 is related to the
extensively studied conjugative transposon Tn916 (7,
15, 16, 24). There are, however, some important differences. The
ends of the two elements are completely different, with the
xis and int genes of Tn916 being
replaced by a gene called tndX in Tn5397. TndX is
a member of the family of large resolvase/invertase proteins. This
protein is responsible for the insertion and excision of Tn5397 (24).
The other major difference between Tn916 and
Tn5397 is that Tn5397 contains a group II intron,
inserted into a gene that is almost identical to orf14 from
Tn916 (15). The Tn5397 version of
this gene is termed orf14*. Group II introns are a class of genetic elements that were first discovered in the genomes of eukaryotic organelles in fungi and in plants. They are categorized by
their secondary structure, which is essential for splicing (12). As well as being capable of splicing, group II
introns can also transpose to allelic sites (a process called homing) at high frequency and to ectopic sites at a much lower frequency (12). Some group II introns encode a multifunctional
protein, with maturase, reverse transcriptase, and endonuclease
activities (4). This protein acts on both RNA and DNA and,
together with the catalytic RNA of the intron, forms a
ribonucleoprotein (RNP) particle which is required to promote homing,
splicing, and transposition activities (3, 4, 27, 28).
Over the past few years, group II introns have been found in a number
of different bacteria (5, 6, 8, 10, 13, 15, 26). In most
cases, however, splicing and mobility have not been reported to occur
in vivo. The main exception to this has been the demonstration that the
Lactococcus lactis intron Ll.ltrB, inserted into the
putative relaxase gene (ltrb) of the conjugative element
pRS01, is spliced and is capable of transposition (13,
14). Furthermore, splicing of this intron was found to be
required for conjugal transfer of pRS01 (13). As the group II intron within Tn5397 is inserted into a gene shown to be
required for conjugative transfer of the related conjugative transposon Tn916 (21), the work described in this paper
was designed to see if the intron is spliced in vivo and if splicing is
required for conjugative transfer of Tn5397. We demonstrate
that the intron is spliced but that splicing is not a requirement for
conjugative transfer of the host conjugative transposon.
Bacterial strains and plasmids.
All bacterial strains and
plasmids used are listed in Table 1.
C. difficile and B. subtilis were routinely grown
on or in brain heart infusion (BHI) agar or broth (Oxoid, Basingstoke, U.K.). C. difficile strains for RNA preparations were grown
in Wilkins-Chalgren medium (Oxoid, Basingstoke). E. coli
strains were grown on or in Luria-Bertani (LB) agar or broth. C. difficile strains were grown anaerobically in an anaerobic chamber
(Don Whitley Scientific) (10% hydrogen, 10% carbon dioxide, and 80% nitrogen), and B. subtilis and E. coli were grown
aerobically. Antibiotics were used at concentrations of 10 µg/ml for
tetracycline, 25 µg/ml for kanamycin, 25 µg/ml for rifampin, and 50 µg/ml for ampicillin. All antibiotics were obtained from Sigma
Aldrich, UK.
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1296-1299.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Demonstration that the Group II Intron from the Clostridial
Conjugative Transposon Tn5397 Undergoes Splicing In
Vivo
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Strains and plasmids
Mating experiments. Filter mating were carried out according to Wang et al. (24).
RNA preparation. C. difficile RNA was isolated as described by Hundsberger et al. (9), but the C. difficile strains were grown in Wilkins-Chalgren medium and not BHI. B. subtilis RNA was isolated using the Qiagen RNeasy kit (Qiagen, Basingstoke, U.K.), according to the manufacturer's instructions.
RT-PCR and PCR. cDNA for reverse transcriptase PCR (RT-PCR) was prepared using Superscript Rnase H reverse transcriptase according to the manufacturer's instructions (Gibco-BRL). The primers used in these experiments were I1 (5'TGCCGAAGGCAGTCATGTGT), I2 (5'AATCTATCCTCAATTGTTGGGAT), I3 (5'TTTCAGGGCGTTACTCCGTC), I4 (5'AAATTACGTGCTTTAGCTGGGA), I5 (5'ACCACGAACCGCACAACAA), and I6 (5'GCCAATCACAACCTTTTTA). PCR was carried out using a program of 94°C for 4 min, followed by 35 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 1 to 3 min, followed by a final extension of 4 min at 72°C. PCR from DNA templates was carried out as above. The primers used in these experiments were 5397 (5'ACGTGTATCAAGCAGAGGGAATCG) and 5397t2 (5'CCGGCCAAGCTTAATTAGTAAGCGTCTTGCTC). Products were analyzed on a 1 to 1.5% agarose gel.
Recombinant DNA techniques. B. subtilis was transformed as described by Agnoustopoulos and Spizizen (1). Genomic DNA was prepared using the Puregene Gram-Positive DNA isolation kit (Flowgen). Plasmid preparations were carried out using the Qiagen miniprep kit according to the manufacturer's instructions. DNA sequencing was carried out using the ABI BigDye terminator mix (PE Biosystems) and analyzed on a Perkin Elmer 310 genetic analyzer. All restriction enzymes were obtained from Promega.
Construction of the intron mutant.
The ClaI
fragment of the intron (Fig. 1) was
replaced with the aphA-3 kanamycin resistance gene
(23). The resulting mutant intron, Intron
kan, was
cloned into the BamHI site of pUC18, generating pPPM70.
Plasmid pPPM70 was linearized by digestion with ScaI and transformed into B. subtilis::Tn5397
(BS6A; Table 1), selecting for kanamycin and tetracycline resistance.
Strains in which a double crossover had occurred with resultant
replacement of the intronic ClaI fragment with Intron
kan
(as demonstrated by PCR) were selected for further study.
|
| |
RESULTS |
|---|
|
|
|---|
Spliced mRNA can be detected from C. difficile
containing Tn5397.
The Tn5397 group II intron is
contained within orf14*, which is almost identical to
orf14 from Tn916 (15, 24). The
genetic organization of this region is shown in Fig. 1. In order to
determine if the intron is spliced, the primers I5 and I6 were used in
an RT-PCR on RNA isolated from C. difficile 630. A product
of 330 bp was obtained from cDNA generated with random primers (Fig. 2A) and with cDNA template generated
with a specific primer from the coding strand. However, no PCR
product was observed when cDNA generated with a specific primer from
the noncoding strand was used as the template, indicating, as
expected, that splicing only occurs in RNA identical to the coding
strand (results not shown). The 330-bp PCR product was sequenced, and
it consisted of an in-frame ligation of the two flanking exons, the
splice site being located exactly as predicted from the secondary
structure of the intron (15). That the intronic open
reading frame (ORF) is transcribed was confirmed by RT-PCR using
primers I1 and I2 (results not shown). The same results were obtained
when the cells were harvested at early, mid-, or late exponential phase
(results not shown).
|
Nonspliced intron-exon borders can be detected from C. difficile containing Tn5397. To determine if unspliced intron was also present, RT-PCR with primer pairs I5 and I3 was used to amplify the 5' intron-exon junction, and primers I4 and I6 were used to amplify the 3' intron-exon junction. The results are shown in Fig. 2A and show that both the 5' and 3' intron-exon junctions are present in the C. difficile RNA. These results were confirmed by DNA sequence analysis.
Spliced and nonspliced RNA can also be detected in B. subtilis. RNA was prepared from the B. subtilis strain BS6A (18), which contains Tn5397, to see if the intron is spliced in this host. Essentially the same experiments as those described for C. difficile 630 were carried out, and the RT-PCR gave products of identical size as those shown in Fig. 2A for the intron in C. difficile 630. Again, DNA sequencing of the PCR products confirmed that they represented ligated exons and intron-exon borders, indicating that both spliced and nonspliced RNA is present in B. subtilis (results not shown).
Determination of relative amounts of spliced and
nonspliced intron.
A dilution series of cDNA template
prepared from C. difficile strains 630 and FM1A (Table 1)
were used in RT-PCRs to determine the relative amounts of 5'
intron-exon junction, 3' intron-exon junction, and ligated exons. The
results of this analysis are shown in Table
2. The results show that the 5'
intron-exon junction was apparently present at about a
106-fold-lower amount than the 3' intron-exon junction.
There also seems to be as much 3' intron-exon junction as spliced
intron. This could mean that the splicing of the 5' intron occurs
106 times faster than that of the 3' intron. Alternatively,
some of the intron intermediates may get degraded before splicing
is complete. Lariat is more stable than linear RNA, so if splicing were aborted before finishing, the 3' half (with the lariat) would be
expected to persist longer than the 5' half.
|
Deletion of part of the intronic ORF prevents splicing but does not prevent conjugative transposition of Tn5397. An intron mutant was constructed in B. subtilis strain BS6A (see Materials and Methods). The mutant was designated BS16A. When RT-PCR using primers I5 and I6 was performed, a PCR product of 478 bp was detected (lane 1, Fig. 2B). This product did not correspond to the size expected of spliced intron. DNA sequencing of the product showed that it resulted from mispriming with primer I5. Therefore, we could not detect splicing in the mutant intron.
Previous work in our laboratory has shown that Tn5397 produces a circular form and that this molecule is likely to be the conjugative transposition intermediate (24). In order to determine if the B. subtilis strain containing the intron mutant was still capable of excision and producing the circular form of the transposon, primers reading out from the ends of the element were used for PCR, as in Wang et al. (24). Using these primers, a PCR product would only be produced if the element circularizes and the left and right ends are ligated together. A PCR product of the expected size (272 bp) corresponding to the ligated ends of the transposon was produced in B. subtilis BS6A (B. subtilis strain containing wild-type Tn5397) and BS16A (BS6A::Tn5397 Intron
kan) (Fig. 2C). DNA sequencing of the PCR product showed that
the two ends of Tn5397 had been ligated together with a GA
dinucleotide at the joint between the ends of the element, as is the
case in the wild-type Tn5397 (24). These
results show that splicing is not required for production of the
circular form of the element.
The B. subtilis strains BS6A and BS16A were used as donors
in a filter mating experiment with C. difficile CD37 as
the recipient. Transconjugants arose at a frequency of 2 × 10
7 per donor, a frequency similar to that previously
reported for the transfer of Tn5397 from B. subtilis to C. difficile (16, 24). All
transconjugants still contained the Intron
kan allele (confirmed by
PCR and DNA sequencing; not shown). Therefore, preventing splicing does
not prevent conjugal transfer.
| |
DISCUSSION |
|---|
|
|
|---|
In this work, we have demonstrated that the intron from Tn5397 splices in vivo in both C. difficile and B. subtilis. This is an important observation as, although group II introns have recently been found in a number of different bacteria (5, 6, 8, 10, 13, 15, 26), only the Lactococcus lactis group II intron Ll.ltrB has previously been showed to be capable of in vivo splicing (13). The same group II intron has also been found independently in the putative relaxase gene of a conjugative element inserted in the chromosome of L. lactis 712 (22). Furthermore, the Ll.ltrB intron is more closely related to the mitochondrial group II introns than to the other introns found in bacteria (13). The Tn5397 intron falls within a group composed of only bacterial introns. A secondary-structure comparison of the introns also showed that the lactococcal intron belongs to subgroup IIA and the Tn5397 intron to subgroup IIB (S. Zimmerly, personal communication). Therefore, this is the first demonstration of in vivo splicing in a member of this family of group II introns.
Most of the group II introns found in bacteria (including the mitochondrion-like Ll.ltrB intron) have been found associated with genes that are proven or likely to be involved in DNA mobility or contained within mobile genetic elements (5, 6, 8, 10, 13, 15, 26). Splicing of the lactococcal intron Ll.ltrB was required for conjugative transfer of the host element (13). In contrast, however, our results show that splicing of the intron is not required for conjugative transfer of Tn5397, even though the gene interrupted by the intron in Tn5397 has been shown to be required for conjugative transfer of the related conjugative transposon Tn916 (2). As the regions concerned with conjugation in Tn916 and Tn5397 are very closely related, we expected that the orf14* gene product would also be required for transfer of Tn5397. However, as the intron is located near the 3' end of the gene, lack of splicing would only result in the translated protein's losing the last 23 amino acids, which may not be required for full function. Furthermore, we cannot rule out the possibility that splicing is required in C. difficile but not in B. subtilis due to different host factors which may substitute for the function provided by Orf14*.
As well as being located within genes, at least one group II intron has been shown to be inserted in an intergenic region within the class II transposon TnMerI1 (8). Therefore, there appears to be no actual requirement for all group II introns to be spliced. However, retention of this ability increases the number of sites into which group II introns can transpose without having an adverse effect on the viability of the host cell. Therefore, it is not unexpected that these introns have retained their splicing ability.
Demonstration that the Tn5397 intron splices in both B. subtilis and C. difficile, and the results of Matsuura et al. (11) showing that the L. lactis intron is capable of in vivo splicing in both L. lactis and E. coli, indicates that group II introns are functional in a wide range of distantly related hosts. Zimmerly and coworkers (personal communication) have shown that there has been extensive horizontal gene transfer of group II introns in the past. The frequent association of these introns with broad-host-range conjugal elements, such as Tn5397 and pRS01, provides a means by which some of these introns are dispersed to distantly related hosts, and the minimal requirement for specific host factors allows the introns to be retained in their new hosts.
In conclusion, we have shown that the group II intron within Tn5397 is capable of splicing in both B. subtilis and C. difficile but that splicing is not required for conjugal transfer of Tn5397.
| |
ACKNOWLEDGMENTS |
|---|
A.P.R. was the recipient of a BBSRC studentship. The work undertaken in one of the laboratories (P.M.) was funded by the Wellcome Trust. The collaboration between the two groups (P.M. and C.v.E.S.) was generously funded by the British Council.
We thank Steven Zimmerly for helpful discussions.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Eastman Dental Institute for Oral Health Care Sciences, University College London, University of London, 256 Gray's Inn Road, London WC1X 8LD, United Kingdom. Phone: 44 020 7915 1223. Fax: 44 020 7915 1127. E-mail: pmullany{at}eastman.ucl.ac.uk.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Anagnostopoulos, G., and J. Spizizen.
1961.
Requirements for transformation in Bacillus subtilis.
J. Bacteriol.
81:741-746 |
| 2. | Clewell, D., S. A. Flannagan, and D. D. Jaworski. 1995. Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons. Trends Microbiol. 229:229-236. |
| 3. | Cousineau, B., S. Lawrence, D. Smith, and M. Belfort. 2000. Retrotransposition of a bacterial group II intron. Nature 404:1081-1021[CrossRef]. |
| 4. | Cousineau, B., D. Smith, S. Lawrence-Cavanagh, J. E. Mueller, J. Yang, D. Mills, D. Manias, G. Dunny, A. M. Lambowitz, and M. Belfort. 1998. Retrohoming of a bacterial group II intron: mobility via complete reverse splicing, independent of homologous DNA recombination. Cell 94:451-462[CrossRef][Medline]. |
| 5. | Ferat, J.-L., M. Le Gouar, and F. Michel. 1994. Multiple group II self-splicing introns in mobile DNA from Escherichia coli. C.R. Acad. Sci. Paris Sci. Vie 317:141-148. |
| 6. | Ferat, J.-L., and F. Michel. 1993. Group II self-splicing introns in bacteria. Nature 364:358-361[CrossRef][Medline]. |
| 7. |
Hachler, H.,
F. H. Kayser, and B. Berger-Bachi.
1987.
Homology of a transferable tetracycline resistance determinant of Clostridium difficile with Streptococcus (Enterococcus) faecalis transposon Tn916.
Antimicrob. Agents Chemother.
31:1033-1038 |
| 8. | Huang, C.-C., M. Narita, T. Yamagata, Y. Itoh, and G. Endo. 1999. Structure analysis of a class II transposon encoding mercury resistance of the Gram-positive bacterium Bacillus megaterium MB1, a strain isolated from Minamata Bay, Japan. Gene 234:361-369[CrossRef][Medline]. |
| 9. | Hundsberger, T., V. Braun, M. Weidmann, P. Leukel, M. Sauerborn, and C. von Eichel-Streiber. 1997. Transcriptional analysis of the genes tcdA-E of the pathogenicity locus of Clostridium difficile. Eur. J. Biochem. 244:735-742[Medline]. |
| 10. |
Knoop, V., and A. Brennicke.
1994.
Evidence for a group II intron in Escherichia coli inserted into a highly conserved reading frame associated with mobile DNA sequences.
Nucleic Acids Res.
22:1167-1171 |
| 11. |
Matsuura, M.,
R. Saldanha,
M. Hongwen,
H. Wank,
J. Yang,
G. Mohr,
S. Cavanagh,
G. M. Dunny,
M. Belfort, and A. M. Lambowitz.
1997.
A bacterial group II intron encoding reverse transcriptase, maturase, and DNA endonuclease activities: biochemical demonstration of maturase activity and insertion of new genetic information within the intron.
Genes Dev.
11:2910-3555 |
| 12. | Michel, F., and J.-L. Ferat. 1995. Structure and activities of group II introns. Annu. Rev. Biochem. 64:435-461[CrossRef][Medline]. |
| 13. |
Mills, D. A.,
L. L. Mckay, and G. Dunny.
1996.
Splicing of a group II intron involved in the conjugative transfer of pRS01 in lactococci.
J. Bacteriol.
178:3531-3538 |
| 14. |
Mills, D. A.,
D. Manias,
L. L. Mckay, and G. Dunny.
1997.
Homing of group II intron from Lactococcus lactis subsp. lactis ML3.
J. Bacteriol.
179:6107-6111 |
| 15. | Mullany, P., M. Pallen, M. Wilks, and S. Tabaqchali. 1996. A group II intron in a conjugative transposon from the Gram-positive bacterium, Clostridium difficile. Gene 174:145-150[CrossRef][Medline]. |
| 16. |
Mullany, P.,
M. Wilks,
I. Lamb,
C. Clayton,
B. Wren, and S. Tabaqchali.
1990.
Genetic analysis of a tetracycline resistance determinant from Clostridium difficile and its conjugal transfer to and from Bacillus subtilis.
J. Gen. Microbiol.
136:1343-1349 |
| 17. |
Rice, L. B.
1998.
Tn916 family of conjugative transposons and dissemination of antimicrobial resistance determinants.
Antimicrob. Agents Chemother.
42:1871-1877 |
| 18. | Roberts, A. P., J. Pratten, M. Wilson, and P. Mullany. 1999. Transfer of a conjugative transposon, Tn5397, in a model oral biofilm. FEMS Microbiol. Lett. 177:63-66[CrossRef][Medline]. |
| 19. |
Salyers, A. A.,
N. B. Shoemaker,
A. M. Stevens, and L. L. Hing-Yew.
1995.
Conjugative transposons: an unusual and diverse set of integrated gene transfer elements.
Microbiol. Rev.
59:579-590 |
| 20. | Scott, J. R., and G. G. Churchward. 1995. Conjugative transposition. Annu. Rev. Microbiol. 49:367-397[CrossRef][Medline]. |
| 21. |
Senghas, E.,
J. M. Jones,
M. Yamamoto,
C. Gawron-Burke, and D. B. Clewell.
1988.
Genetic organization of the bacterial conjugative transposon Tn916.
J. Bacteriol.
170:245-249 |
| 22. | Shearman, C. H., J. J. Gordon, and G. Gasson. 1996. Splicing of a group II intron in a functional transfer gene of Lactococcus lactis. Mol. Microbiol. 21:45-53[CrossRef][Medline]. |
| 23. | Trieu-Cuot, P., G. Gerbaud, T. Lambert, and P. Courvalin. 1985. In vivo transfer of genetic information between Gram positive and Gram negative bacteria. EMBO J. 4:3583-3587[Medline]. |
| 24. |
Wang, H.,
A. P. Roberts,
D. Lyras,
J. I. Rood,
M. Wilks, and P. Mullany.
2000.
Characterization of the ends and target sites of the novel Tn916-like conjugative transposon Tn5397 from Clostridium difficile: demonstration that excision and circularization are mediated by TndX, a member of the large resolvase family.
J. Bacteriol.
182:3775-3783 |
| 25. | Yanisch-Perron, G., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13, mp18, and pUC19 vectors. Gene 33:103-119[CrossRef][Medline]. |
| 26. |
Yeo, C. C.,
J. M. Tham,
M. W. C. Yap, and C. L. Poh.
1997.
Group II intron from Pseudomonas alcaligenes NCIB 9867 (P25X): entrapment in plasmid RP4 and sequence analysis.
Microbiology
143:2833-2840 |
| 27. | Zimmerly, S., H. Guo, P. S. Perlman, and A. M. Lambowitz. 1995. Group II intron mobility occurs by target DNA-primed reverse transcription. Cell 82:545-554[CrossRef][Medline]. |
| 28. | Zimmerly, S., H. Guo, R. Eskes, J. Yang, P. S. Perlman, and A. M. Lambowitz. 1995. A group II intron is a catalytic component of a DNA endonuclease involved in intron mobility. Cell 83:529-538[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»