Previous Article | Next Article 
Journal of Bacteriology, February 2001, p. 1320-1328, Vol. 183, No. 4
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1320-1328.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Characterization of the dnaK Multigene
Family in the Cyanobacterium Synechococcus sp. Strain
PCC7942
Kaori
Nimura,1,2
Hideo
Takahashi,2 and
Hirofumi
Yoshikawa1,*
Department of Bioscience, Tokyo University of
Agriculture, Setagaya-ku, Tokyo 156-8502,1 and
Institute of Molecular and Cellular Biology, University of
Tokyo, Bunkyo-ku, Tokyo 113-0032,2 Japan
Received 7 August 2000/Accepted 29 November 2000
 |
ABSTRACT |
The cyanobacterium Synechococcus sp. strain PCC7942 has
three dnaK homologues (dnaK1, dnaK2, and
dnaK3), and a gene disruption experiment was carried out
for each dnaK gene by inserting an antibiotic resistance
marker. Our findings revealed that DnaK1 was not essential for normal
growth, whereas DnaK2 and DnaK3 were essential. We also examined the
effect of heat shock on the levels of these three DnaK and GroEL
proteins and found a varied response to heat shock, with levels
depending on each protein. The DnaK2 and GroEL proteins exhibited a
typical heat shock response, that is, their synthesis increased upon
temperature upshift. In contrast, the synthesis of DnaK1 and DnaK3 did
not respond to heat shock; in fact, the level of DnaK1 protein
decreased. We also analyzed the effect of overproduction of each DnaK
protein in Escherichia coli cells using an inducible
expression system. Overproduction of DnaK1 or DnaK2 resulted in defects
in cell septation and formation of cell filaments. On the other hand,
overproduction of DnaK3 did not result in filamentous cells; rather a
swollen and twisted cell morphology was observed. When expressed in an
E. coli dnaK756 mutant, dnaK2 could suppress
the growth deficiency at the nonpermissive temperature, while
dnaK1 and dnaK3 could not suppress this
phenotype. On the contrary, overproduction of DnaK1 or DnaK3 resulted
in growth inhibition at the permissive temperature. These results suggest that different types of Hsp70 in the same cellular compartment have specific functions in the cell.
 |
INTRODUCTION |
All living organisms respond to
environmental stresses such as high temperature by synthesizing a set
of proteins which have been called heat shock proteins (Hsps)
(23). Some of them are highly conserved in the course of
evolution, especially the proteins encoded by the groEL
(hsp60 or cpn60) and the dnaK
(hsp70) genes. They have been identified and characterized
in various organisms as well as major cellular compartments, including
cytoplasm, nucleus, endoplasmic reticulum, mitochondria, and
chloroplasts (11, 14, 23). Although the synthesis of Hsp70
is enhanced under various stress conditions, many Hsp70 proteins are
constitutively expressed and have also been shown to be essential under
normal growth conditions (11, 14). One of the
well-established functions of Hsp70 is the regulation of
protein-protein interactions. The folding and assembly of proteins
require the action of protein factors termed molecular chaperones
(7, 8), and the Hsp70 family is one of the ubiquitous
groups of such factors (11, 14).
Cyanobacteria are prokaryotic cells which carry a complete set of genes
for oxygenic photosynthesis similar to that found in chloroplasts of
higher plants. These organisms are also interesting from the point of
view of evolution, since they are associated with prehistoric ages and
have survived various environmental conditions. Under natural
conditions they inhabit areas with suitable amounts of sunlight, where
they are inevitably subject to a variety of stresses such as UV
irradiation and high temperature. Therefore, it is interesting to study
the mechanism of stress response and the function of stress proteins of
cyanobacteria. We have previously identified three dnaK
homologue genes, dnaK1, dnaK2, and dnaK3, in the
transformable cyanobacterium Synechococcus sp. strain
PCC7942 (27, 28).
The genome of another cyanobacterium, Synechocystis sp.
strain PCC6803 (17), also disclosed the presence of three
dnaK homologues (open reading frame [ORF] designations in
the database are sll0058, sll0170, and sll1932). Those three DnaK
homologues show high similarity to each of the three DnaKs of
Synechococcus sp. strain PCC7942. Synechococcus
DnaK3 has a characteristically very long C-terminal region
(28), and the corresponding Synechocystis DnaK
(sll1932) also contains this region, including the conserved
GWDDDDDD/EWF sequence at the termini. The genome of the
cyanobacterium Anabaena sp. strain PCC7120
(http://www.kazusa.or.jp/cyano) also revealed the presence of three
dnaK homologues, although they have less similarity to each
DnaK gene of Synechococcus than those of
Synechocystis. Other than the cyanobacteria, the existence
of multiple dnaK genes is rare among prokaryotes, only two
other examples have been identified so far. One is Escherichia
coli, which also has two dnaK homologues (hsc66 and hsc62) other than dnaK
(20, 36, 45), and the other is Borrelia
burgdorferi B31 (9), which has two dnaK
homologues. In most eukaryotes, Hsp70s constitute a multigene family
whose members have been shown to be expressed differentially under a variety of physiological conditions (23, 42). Some are
expressed constitutively and are not induced by stress, and others are
both constitutive and stress inducible. However, it is not clearly understood how these Hsp70 proteins in the same cellular compartment are assigned with their respective functions. In Saccharomyces cerevisiae, most of the cytosolic Hsp70 proteins belong to either the Ssa or Ssb subfamily. Those which belong to the same subfamily have
compensatory functions for each other, but those from different subfamilies are not interchangeable (5, 6, 43).
Although chaperone functions are well characterized using certain
substrates, it has been a major subject in recent studies to understand
how molecular chaperones find their specific target among many
substrates in a specific cellular process. It would contribute to this
subject to clarify how the different Hsp70s in the same cellular
compartment are allocated to their functions. As an initial step for
studying the functional distinction among spatially colocalized Hsp70s,
we analyzed in vivo functions and gene regulation of the three DnaK
proteins in Synechococcus sp. strain PCC7942. Here we report
the various properties of these proteins, which suggest that each
protein has a specific function(s) in the cell.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
Synechococcus sp. strain PCC7942(R2-spc), which has been
cured of its indigenous plasmid pUH24 (19), was obtained
from T. Endo (Nagoya University, Nagoya, Japan). Cells were grown
photoautotrophically at 30°C in BG-11 medium (4) under
bubbling with air and continuous illumination. When necessary, media
were supplemented with kanamycin at a final concentration of 10 µg/ml. E. coli MC4100 (3) and NRK156
(18) cells were grown in Luria-Bertani (LB) medium at the
indicated temperatures. Media were supplemented with ampicillin at a
final concentration of 100 µg/ml if required.
Disruption of dnaK genes.
Plasmid pDK1A, which
has 2,698-bp DNA fragment including the dnaK1 gene
(27), was used for gene disruption of dnaK1.
The kanamycin resistance gene was isolated as a BamHI
fragment from pUC4K (Pharmacia) and inserted into the HincII
site within the dnaK1 gene of pDK1A to make pDK1KM.
Similarly, plasmid pDK2KM, which has the kanamycin resistance gene
inserted between the BstXII and BglII sites
within the dnaK2 gene, was constructed. To avoid single-cross recombination, pDK1KM and pDK2KM were linearized by
digestion with EcoRI, and the linearized product was used to transform Synechococcus sp. strain PCC7942 according to the
method described by Porter et al. (31). For
dnaK3 gene disruption, three DNA fragments upstream and
downstream of dnaK3 and promoterless kanamycin resistance
cassette were amplified by PCR using primers which have 5' add-on
sequences designed to create overlapping sequences among those
fragments and were recombined by a recombinant PCR technique
(15), as shown in Fig. 1. The resulting fragment frDK3KM
was transformed into Synechococcus. Transformants were grown
on BG-11 agar plate containing kanamycin (10 µg/ml).
Protein purification and preparation of antisera.
DNA
fragments encoding the C-terminal domain of each DnaK protein (amino
acids [aa] 520 to 655 of DnaK1, aa 515 to 634 of DnaK2, and aa 516 to
685 of DnaK3) were amplified by PCR. Those fragments of
dnaK1 and dnaK2 were inserted in the
EcoRI and SalI sites of the hexahistidine fusion
expression vector pET21b (Novagen). Similarly, the fragment of
dnaK3 was inserted in the BamHI and HindIII sites of the hexahistidine fusion expression
vector pQE10 (Qiagen). C-terminal segment of each DnaK protein was
purified using Ni-nitrilotriacetic acid (NTA) affinity resin (Qiagen)
according to the manufacturer's instructions. Purified proteins were
injected into mice. The mice were boosted after 3 weeks and bled for
serum preparation 4 weeks later.
Western blotting analysis.
Crude extracts of
Synechococcus sp. strain PCC7942 cells were prepared as
follows. Nine-milliliter aliquots of cell culture were mixed with 1 ml
of 100% trichloroacetic acid (TCA). After incubation for 15 min or
more on ice, precipitates were harvested by centrifugation at
6,000 × g for 10 min. To remove TCA, the pellet was
washed successively with 500 µl of 100% acetone and then 500 µl of
100% ether and then solubilized with 90 µl of 10 mM Tris-HCl (pH
7.5)-2% sodium dodecyl sulfate (SDS)-20 mM NaOH. The debris was
removed by centrifugation at 10,000 × g for 1 min, and
the supernatant was used as the crude extract. Part of the crude
extract was measured for protein concentration and one-fourth volume of
5× modified sample buffer (250 mM Tris-HCl [pH 6.8], 500 mM
dithiothreitol, 0.5% bromophenol blue, 2% SDS, and 50% glycerol) for
SDS-polyacrylamide gel electrophoresis (PAGE) was added to the extract
and boiled for 3 min. Protein concentration was determined by the Lowry
method with bovine serum albumin as the standard. The proteins were
separated by SDS-PAGE (12.5% polyacrylamide) and transferred onto
polyvinylidene difluoride membranes (Immobilon; Millipore). For the
detection of DnaK proteins, mouse antiserum against each DnaK protein
was used as the primary antibody, and horseradish peroxidase-conjugated
anti-mouse immunoglobulin G (IgG; heavy and light chains) antibody
(sheep; Amersham) was used as the secondary antibody. Horseradish
peroxidase activity was detected by color development using a substrate
kit (Bio-Rad). To detect GroEL protein, rabbit antiserum against
Bacillus subtilis GroEL (H. Yoshikawa, unpublished) was used
as the primary antibody, and alkaline phosphatase-conjugated
anti-rabbit IgG antibody (goat; Biomarker) was used as the secondary
antibody. Color development associated with alkaline phosphatase was
performed using nitro blue tetrazolium (Sigma) and
5-bromo-4-chloro-3-indolyl phosphate (Sigma) as described
(33).
Pulse-labeling experiments.
Synechococcus sp.
strain PCC7942 cells were grown in BG-11 at 30°C, and at the
logarithmic growth phase (optical density at 700 nm
[OD700] of 0.5), the culture temperature was shifted to 45°C. At appropriate intervals, 10-ml aliquots of the culture were
sampled and pulse labeled with 100 µCi of
[35S]methionine (Amersham) at the culture temperature for
30 min. At the end of the labeling, 1.1 ml of 100% TCA (final, 10%)
was added and incubated on ice for 15 min. Precipitates were then harvested by centrifugation at 6,000 × g for 10 min,
washed with acetone and ether, and dissolved in 200 µl of 50 mM
Tris-HCl (pH 7.5)-2% SDS-20 mM NaOH. The solution was mixed with 1 ml of 50 mM Tris-HCl (pH 7.5)-150 mM NaCl-2% Triton X-100-1 mM
EDTA, and the debris was removed by centrifugation at 16,000 × g for 5 min. Supernatant was divided in four, and
immunoprecipitation was carried out with four kinds of antisera. To
each aliquot, 750 µl of 50 mM Tris-HCl (pH 7.5)-150 mM NaCl-2%
Triton X-100-1 mM EDTA and 4 µl of each antiserum were added, and
the mixture was incubated overnight at 4°C. To each sample, 50 µl
of 10% (wt/vol) IgGsorb was added, and the mixture was kept at 4°C
for 20 min. After centrifugation at 10,000 × g for 1 min, the pellets were successively washed with 0.5 ml of 50 mM Tris-HCl
(pH 7.5)-1 M NaCl-1% Triton X-100 and with 0.5 ml of 50 mM
Tris-HCl-0.5 M NaCl-0.05% SDS. The washed pellets were resuspended
in 20 µl of 1× sample buffer for SDS-PAGE (50 mM Tris-HCl [pH
6.8], 100 mM dithiothreitol, 0.1% bromophenol blue, 2% SDS, 10%
glycerol) and then boiled for 3 min. To seperate proteins from the
IgGsorb, the mixture was centrifuged at 10,000 × g for
1 min, and the supernatant was loaded on SDS-PAGE (12.5% polyacrylamide). Bands were detected using Bio-Imaging analyser BAS2000 (Fujix).
Oligonucleotides and construction of plasmids.
Oligodeoxyribonucleotides were synthesized using an ABI392 DNA/RNA
synthesizer (Perkin Elmer Applied Biosystems Japan). Sequences of the
oligonuculeotides used for construction of dnaK
overexpression plasmids are as follows: TRC1-N,
GCGAGCTCTAAGGAGGTAATTTATGGGCAAGGTTATC; TRC1-Na,
GCGAATTCTAAGGAAAAAATTTATGGGCAAGGTTATC; TRC1-C,
GCTCTAGACTACTCAATCGCCTCGTAGTC; TRC2-N,
GCGAGCTCTAAGGAACTGGACTATGGCCAAAGTTGTC; TRC2-C,
GCTCTAGATTACTTCGACTCAGAGAACTCTGC; TRC3-N,
GCGAGCTCTAAGGAGGTGACAGCATGGGACGAGTCGTAG; TRC3-Na,
GCGAGCTCTAAGGAAAGACAGCATGGGACGACGAGTCGTAG; and TRC3-C, GCTCTAGACAGCCTGATCCGCCGACTGAG.
The expression vector pTrc99A/X, which carries the
lacIq gene and trc promoter, was
obtained from T. Endo (Nagoya University) and used to express each
dnaK gene under the control of
isopropyl-
-D-thiogalactopyranoside (IPTG). This vector
contains a ribosome-binding site (RBS) and an initiation codon upstream
of multicloning sites. Therefore, we synthesized forward primers (TRC-N
series: TRC1-N, TRC2-N, and TRC3-N for dnaK1, dnaK2, and
dnaK3, respectively) which contain an in-frame termination
codon (TAA) and RBS downstream of the SacI site to produce
intact DnaK proteins. Reverse primers (TRC-C series: TRC1-C, TRC2-C,
and TRC3-C for dnaK1, dnaK2, and dnaK3, respectively) were designed to contain an XbaI site after
the termination codon of each dnaK gene. A DNA fragment
harboring each dnaK gene was amplified by PCR with the above
primers, digested with SacI and XbaI, and
inserted into the SacI and XbaI sites of
pTrc99A/X.
Expression of dnaK3 in Synechococcus at
the neutral site of the chromosome.
Plasmid pNS1 is a derivative
of pTZ18R containing the spectinomycin resistance cassette of pHP45
(32) in the middle of the Synechococcus
fragment designated the neutral site (22), which allows
homologous recombination between the transforming plasmid DNA and the
recipient cyanobacterial chromosome to take place. A fragment
containing lacIq, trc promoter, and
dnaK3 was isolated from pTrcDK3 and recloned into pNS1
between the separated neutral site segments, next to the spectinomycin
resistance cassette. This plasmid was used to transform
Synechococcus sp. strain PCC7942, and
spectinomycin-resistant transformants were selected on BG-11 medium
containing spectinomycin (40 µg/ml). Chromosomal DNA was extracted
from one of the transformants, and recombination was confirmed by PCR.
This strain, which expresses dnaK3, was designated NSK3.
 |
RESULTS |
Disruption of each dnaK gene.
In E. coli,
dnaK is not essential for growth, but deletion of the gene confers
a temperature-sensitive (ts) phenotype (2, 30). To
determine whether each dnaK homologue gene of
Synechococcus sp. strain PCC7942 is essential for cell
growth, we attempted to disrupt each dnaK gene by inserting
an antibiotics resistance marker. By using plasmid pDK1KM (Fig.
1), dnaK1 was disrupted as
described in Materials and Methods. Synechococcus is known to contain multiple copies of the chromosome. To confirm if all the
chromosomal copies of the dnaK1 gene were changed to the
mutant form, we isolated chromosomal DNA of transformants, and the
dnaK1 gene region was examined by PCR using primers TRC1-N
and TRC1-C. When chromosomal DNA from the wild-type strain was used as
the template, a 2.0-kb DNA fragment was detected, and a band of this size was not amplified from the DNA of transformants; instead, a 2.8-kb
fragment was observed (data not shown). This increase in size
corresponds to the kanamycin resistance gene insertion. Additionally, a
70-kDa protein band was no longer detected in the Western blot analysis
for the crude extracts of the transformant cells using anti-DnaK1
antiserum (data not shown). These results confirmed that all
chromosomal copies of the dnaK1 genes were totally
disrupted. This disruptant, named DK1KM, could grow under normal
conditions. Considering that DnaK1 is a heat shock protein homologue,
we examined the growth of the mutant at high temperatures and found
that DK1KM could grow even at high temperatures, similar to the
wild-type strain (data not shown).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
Disruption of dnaK genes from
Synechococcus sp. strain PCC7942 by insertion of kanamycin
resistance gene. The kanamycin resistance gene (Kmr) from
pUC4K was inserted into each dnaK gene as described in
Materials and Methods. P, promoter.
|
|
In
E. coli, mutation in
dnaK results in high
basal levels of other heat shock proteins at 30°C and failure to turn
off the
heat shock response at 42°C, suggesting that DnaK functions
as
a negative regulatory factor in the heat shock response (
30,
38,
39). We therefore analyzed the effect of heat shock on
the
levels of DnaK2, DnaK3, and GroEL proteins in DK1KM by Western
blotting. We did not detect any difference in the amount of either
DnaK2, DnaK3, or GroEL protein between the wild-type and
dnaK1 mutant cells, both at basal levels and after heat
shock (data
not shown). Therefore,
Synechococcus DnaK1 does
not seem to function
as a regulator in the heat shock response, in
contrast to the
E. coli DnaK.
We also attempted to disrupt
dnaK2 and
dnaK3 by
inserting a kanamycin resistance marker. Considering that
dnaK3 may be cotranscribed
with downstream
dnaJ7942, frDK3KM, which has an insertion of a
promoterless and terminatorless
kanamycin resistance casette, was used
for the
dnaK3 gene disruption
(Fig.
1). However, we could
not disrupt all copies of either
dnaK2 or
dnaK3
gene in the cell. Most transformants formed extremely
small colonies,
and when their
dnaK2 and
dnaK3 loci were examined
by PCR using primers TRC2-N and TRC2-C or TRC3-N and TRC3-C, fragments
of two sizes were amplified as a mixture in each case. The size
of one
band corresponds to the wild-type allele, and the size
of the other
band represents the allele with the kanamycin resistance
cassette
insertion (data not shown). These results suggest that
DnaK2 and DnaK3
are both essential for growth under normal
conditions.
To confirm the essentiality of
dnaK3, the same
Km
r insertion-carrying
dnaK3 fragment was used
to transform the NSK3 strain,
which carries an IPTG-inducible intact
dnaK3 at the neutral site.
Km
r transformants
appeared as normal-size colonies, and all of the
original
dnaK3 alleles in these cells were replaced by ones with
the
Km
r insertion. In these experiments, the transformants were
spread
onto BG-11 plates containing 0, 0.01, 0.1, and 1.0 mM IPTG to
express
dnaK3 at various levels. Most of the transformants
were
viable without IPTG, and the number and size of the colonies
decreased
with increasing IPTG concentration. These findings indicate
that
leaky expression from the
trc promoter produced a
sufficient amount
of DnaK3 protein and that a comparative increase in
DnaK3 expression
had a deleterious effect on the
cell.
Differential accumulation and synthesis of DnaK and GroEL proteins
after heat shock.
To analyze the changes in the level of each DnaK
protein after heat shock, we made specific antisera for each DnaK
protein using less-conserved C-terminal regions. We expressed the
C-terminal polypeptides of the DnaK proteins with a hexahistidine tag
at their C terminus (DnaK1 and DnaK2) or N terminus (DnaK3), purified the polypeptides using Ni-NTA affinity resin, and prepared antisera against them as described in Materials and Methods. We first performed Western blot analyses for crude extracts of Synechococcus
sp. strain PCC7942 cells and confirmed that three dnaK genes
were actually expressed and that each antiserum was specific to each DnaK protein (Fig. 2). Then we examined
the effect of heat shock on the levels of DnaK as well as GroEL
protein. Cells were grown at 30°C and shifted to 45°C at the
logarithmic growth phase. Crude extracts of the cells at various times
were prepared and subjected to Western blot analysis. The levels of
DnaK and GroEL proteins in response to heat shock varied (Fig.
3). DnaK2 protein level increased until
30 min after heat shock, and thereafter, the increased level was
maintained over the period examined. The GroEL protein level also, but
more markedly, increased from 0 to 100 min. Although the levels did not
decrease to those before heat shock within 120 min, these two proteins
exhibited a typical heat shock response. On the other hand, the level
of DnaK3 protein was not affected by heat shock. Characteristically,
the amount of DnaK1 protein decreased after heat shock. These results
indicate that expression of the dnaK and groEL
genes is differentially regulated upon temperature upshift. Since the
band intensities of Western blots using purified proteins were almost
identical (data not shown), the antibody titers of anti-DnaK antiserum
seem to be comparable. Therefore, the weak intensity of the DnaK3 band
reflects a relatively small amount of the protein in the cell, compared
with DnaK1 and DnaK2.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 2.
Specificity of antiserum raised against DnaK proteins of
Synechococcus sp. strain PCC7942. C-terminal regions of
three DnaK proteins were purified, and antisera against these
polypeptides were prepared as described in Materials and Methods. The
specificity of each antiserum was tested by Western blotting of crude
extracts (30 µg of protein) from Synechococcus cells. Lane
1, anti-DnaK1; lane 2, anti-DnaK2; lane3, anti-DnaK3.
|
|

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Western blot analysis of DnaK and GroEL proteins after
heat shock. Synechococcus cells were grown at 30°C and
shifted to 45°C at the logarithmic phase (OD700 of 0.5).
Crude extracts were prepared from cultures at the indicated times after
temperature upshift, and samples (30 µg of protein for DnaK and 10 µg of protein for GroEL) were analyzed by Western blotting using
antiserum specific to each DnaK protein or anti-B. subtilis
GroEL antiserum as described in Materials and Methods.
|
|
In additional experiments, we measured the synthesis rate of DnaK and
GroEL proteins by 30-min pulse labeling at various times
after
temperature upshift. The synthesis rate of DnaK1 protein
was not
obviously changed (Fig.
4). The results
of the Western
blot exhibiting a reduction in protein accumulation
(Fig.
3) show
that DnaK1 seems to be degraded more rapidly during heat
shock.
DnaK2 and GroEL proteins showed a transient but significant
increase
of synthesis rate after heat shock, which correlates with the
result from the Western analysis. While DnaK3 protein did not
show a
distinct change in synthesis rate (Fig.
4), its accumulation
seems to
be kept constant (Fig.
3), suggesting the existence of
a mechanism to
maintain the level of this protein.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 4.
De novo synthesis of DnaK and GroEL proteins after heat
shock. Logarithmically growing Synechococcus cultures
(OD700 of 0.5) were shifted from 30 to 45°C. Aliquots of
the cultures were sampled before (control, first lane in each panel) or
after temperature upshift at appropriate intervals (lane 1, 0 min; 2, 30 min; 3, 60 min; and 4, 90 min after temperature upshift) and pulse
labeled with [35S]methionine at the indicated
temperatures for 30 min. Proteins were immunoprecipitated with either
DnaK or GroEL antiserum and separated by SDS-PAGE. Bands were detected
using Bio-Imaging analyzer BAS2000.
|
|
Heat shock response in
rpoD mutant.
To discern
whether each dnaK or groEL gene is transcribed by
RNA polymerase holoenzyme containing any one of four principal sigma
factors (RpoD1, RpoD2, RpoD3, and RpoD4), we carried out Western blot
analyses on each rpoD mutant. Crude extracts were prepared
from wild-type Synechococcus sp. strain PCC7942 cells and
from mutant strains D1KM (
rpoD1), D2KM
(
rpoD2), D3KM (
rpoD3), and D4KM
(
rpoD4) (12) both before and after heat
shock at 45°C for 60 min. For the non-heat-shocked samples, there was
less difference in the amounts of the DnaK and GroEL proteins between
wild-type cells and rpoD mutant cells (Fig.
5).

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 5.
Heat shock response in rpoD mutants. Crude
extracts were prepared from wild-type Synechococcus cells
(WT) and from the rpoD1 (lanes 1), rpoD2 (lanes
2), rpoD3 (lanes 3), and rpoD4 (lanes 4) mutants,
which encode each of four principal type sigma factors, both before
(NH) and after (H) heat shock at 45°C for 60 min, and subjected to
Western blotting. Note that RpoD1 is an essential sigma factor, and the
rpoD1 mutant, in which the rpoD1 gene is
partially deleted at its N terminus, has residual RpoD1 activity.
|
|
The responses of these proteins to heat shock in the
rpoD
mutants exhibited the same pattern as those of the wild-type cells;
the
amount of DnaK1 protein decreased, that of DnaK2 and GroEL
increased, and that of DnaK3 was constant. RpoD2, RpoD3, and RpoD4
are
not responsible for the transcription of these Hsp genes,
since
these
rpoD genes are completely inactivated in strains D2KM,
D3KM, and D4KM, respectively. On the other hand, RpoD1 is an essential
sigma factor, and strain D1KM, in which
rpoD1 is partially
deleted
at its N terminus, has residual RpoD1 activity (Masuda et al.,
unpublished results). Therefore, the possibility that RpoD1 controls
the transcription of these Hsp genes cannot be ruled
out.
Differential effects of Synechococcus DnaK
overproduction on E. coli cell morphology.
To examine
the effect of Synechococcus sp. strain PCC7942 DnaK
production on cell physiology in E. coli and to determine
whether the E. coli dnaK756 ts phenotype can be complemented
by the Synechococcus dnaK genes, we constructed
IPTG-inducible expression plasmids for each dnaK in which
Synechococcus sequences are preceded by Shine-Dalgarno
sequences of E. coli. The sequences of the junction regions
are shown in Table 1. Our initial
constructs are those containing sequences TRC1-Na, TRC2-N, and TRC3-Na.
Among these, cells harboring a plasmid carrying TRC1-Na and TRC3-Na
produced only detectable amounts of DnaK protein (Table 1), whereas
pTrcDK2 could produce distinct amounts of DnaK2 (Fig.
6). We therefore reconstructed plasmids
with primers in which RBSs and the preceding sequences are modified
close to the complementary sequence of the 3' end of 16SRNA of E. coli (Table 1). Newly constructed pTrcDK1 and pTrcDK3 indeed drove
overexpression of DnaK proteins, as shown in Fig. 6.

View larger version (122K):
[in this window]
[in a new window]
|
FIG. 6.
Overproduction of DnaK1, DnaK2, and DnaK3 proteins in
E. coli. E. coli MC4100 cells harboring the
dnaK expression plasmids pTrcDK1 (lanes 1 and 2), pTrcDK2
(lanes 3 and 4), and pTrcDK3 (lanes 5 and 6) were grown at 37°C in
the presence (lanes 2, 4, and 6) or absence (lanes 1, 3, and 5) of 1 mM
IPTG. After incubation for 5 h, cultures were sampled and cells
were harvested by centrifugation. Cells were suspended in SDS sample
buffer and subjected to SDS-PAGE on 10% polyacrylamide gels, followed
by Coomassie blue staining. The positions of molecular size standards
are indicated on the left. Arrows indicate the positions of the DnaK
proteins.
|
|
By using the expression plasmids described above, we examined the
effect of DnaK overproduction on the cell morphology of
E. coli MC4100. Strains expressing any of the
Synechoccccus DnaK
proteins from these plasmids were found
to produce colonies of
equal size to those of the control strain
harboring no plasmid.
We also observed that cells grown on LB plates
without IPTG were
indistinguishable from those containing no plasmid
(Fig.
7). The
addition of 1 mM IPTG,
which results in overproduction of DnaK
proteins (Fig.
6), led cells
harboring each
dnaK producer to exhibit
aberrant morphology.
A substantial population of cells producing
DnaK1 or DnaK2 became
filamentous (Fig.
7). Overproduction of
E. coli DnaK has
been shown to result in cell filamentation (
1).
From the
viewpoint that overproduction leads to a defect in cell
septation,
DnaK1 and DnaK2 seem to exhibit a function similar
to that of
E. coli DnaK.

View larger version (138K):
[in this window]
[in a new window]
|
FIG. 7.
Effects of Synechococcus DnaK overproduction
on E. coli cell morphology. E. coli MC4100 cells
harboring Synechococcus dnaK expression plasmids were grown
on LB agar plates in the presence or absence of 1 mM IPTG. After
incubation for 18 and 36 h at 37°C, cells from multiple
representative colonies were examined under a microscope (BX60;
Olympus) with a U Plan F1 objective lens (×40), and photographs were
taken with Neopan 400 Presto films (Fujifilm). In the absence of IPTG,
the cells showed no difference in morphology after incubation for 18 and 36 h. As controls, MC4100 cells without plasmid were similarly
grown on LB agar plates and examined after incubation for 18 and
36 h. Bar, 10 µm.
|
|
Moreover, the toxic effect of DnaK2 protein is more prominent than that
of DnaK1, since extremely filamentous cells were observed
just 18 h after the addition of IPTG. These two proteins seem
to be produced at
similar levels (Fig.
6), and therefore, the
difference in extent of the
toxic effect suggests a functional
difference between these proteins.
When DnaK3 was overproduced,
filamentous cells were not seen; rather,
somewhat unusual morphology
was observed (Fig.
7). Cells were
relatively swollen and sometimes
twisted. The appearance of the
colonies on an LB plate was also
unique, with heterologous regions at
their edges. It is possible
that the plasmid was instantaneously
rearranged and cells no longer
overproducing DnaK3 began to
grow.
Complementation of E. coli dnaK ts mutant.
To
determine whether the three DnaK proteins are functional homologues of
the E. coli DnaK, complementation experiments were carried
out using the E. coli NRK156 strain, which has the
dnaK756(Ts) mutation (Table
2). NRK156 cells harboring each
dnaK expression plasmid were grown in LB medium at 37°C,
and at the logarithmic growth phase (OD660 of 0.2), 5 × 103 cells were spread on LB agar plates containing
various concentrations of IPTG as indicated. Cells were incubated at
the permissive temperature (37 or 42°C) or nonpermissive
temperature (44.5°C), and colony-forming ability was
determined. As summarized in Table 2, DnaK2 could suppress ts growth at
44.5°C, while DnaK1 and DnaK3 could not suppress growth at 44.5°C;
rather, overproduction of these proteins resulted in growth inhibition
even at the permissive temperature (42°C). This inhibitory effect was
not seen in the absence of IPTG and became more severe as the IPTG
concentration was increased. Therefore, the effect is likely the
consequence of overproduction of DnaK1 or DnaK3. DnaK3 seems to be more
toxic, since overproduction of DnaK3 inhibited growth at relatively
lower IPTG concentrations than DnaK1. The growth inhibition was not
observed at 37°C even in the presence of 1 mM IPTG, indicating that
this effect is temperature dependent.
 |
DISCUSSION |
We could not completely disrupt all copies of either
dnaK2 or dnaK3 in Synechococcus cells,
as our results indicate. This strongly suggests that these two genes
are essential for normal growth and that DnaK2 and DnaK3 have some
specific function which cannot be compensated for by the remaining two
DnaK proteins. There have been no previous reports mentioning that two
species of Hsp70 in the same cellular compartment are both essential. In Saccharomyces cerevisiae, 15 genes of the Hsp70 family
which encode proteins localized in different cellular compartments have been found. Among them, Ssa and Ssb represent the two classes of
abundant cytosolic Hsp70s. The essential Ssa proteins are encoded by
four genes, SSA1 to SSA4. The Ssb proteins are
encoded by the SSB1 and SSB2 genes. Though Ssbs
are not essential for growth (6), the Ssa and Ssb families
have been suggested to be functionally distinct; overexpression of an
Ssa protein fails to rescue the phenotype of an ssb mutant,
and vice versa (5). A chimera consisting of the N-terminal
ATPase domain from Ssa1 protein and the remainder from Ssb1 protein was
shown to be able to rescue the phenotype of ssb1 ssb2 cells
(16). The N-terminal regions of DnaK2 and DnaK3 bearing
the ATP-binding domain and the following ca. 100 amino acids are quite
similar, and the remaining C-terminal regions are variable. Since DnaK3
is characteristic in that it has a relatively long C-terminal
nonconserved region, it would be interesting to discern whether this
C-terminal region is responsible for functional specificity.
We have shown here that each DnaK protein exhibits a characteristic
accumulation pattern and synthesis rate after heat shock, suggesting
that the three dnaK genes are differentially regulated. The
different responses after heat shock suggest functional differences between Hsp70 proteins in a multigene family. In our study, the synthesis of DnaK1 was constitutive but the protein was found to be
degraded after heat shock. This property, similar to that of Ssb
proteins in S. cerevisiae, seems instead to reflect a
general response of ordinary proteins after heat shock.
The level of DnaK2 increased in response to heat shock, like that of
GroEL and other typical Hsp proteins. In prokaryotic cells, the
regulation of heat shock response in E. coli has been well
studied and is known to be under the control of the rpoH gene product, a
32 transcription factor (10, 13,
38, 48). However,
32 might not be a universal
regulator of the heat shock response in prokaryotes, since no
32-related factor or
32-specific heat
shock promoter has been found in many other bacteria (47).
Instead, a novel inverted repeat termed CIRCE has been found between
the transcriptional and translational start sites of heat-inducible
genes in some gram-positive bacteria, including Bacillus
subtilis and cyanobacteria (21, 44, 49). In B. subtilis, groE is transcribed by RNA polymerase
holoenzyme containing the principal
A factor, and its
heat-inducible transcriptional start sites are the same as those at low
temperature and are preceded exclusively by vegetative promoters
(21, 34, 40). From in vivo and in vitro studies, the
inverted repeat (CIRCE) has been suggested to serve as an operator, and
both dnaK and groE operons have been postulated
to be negatively regulated by a repressor encoded by the
hrcA gene (24, 35, 46, 49). The Western blot
analyses for four principal sigma factor mutants of
Synechococcus sp. strain PCC7942 suggested that three
dnaK and groEL genes are transcribed by RNA
polymerase holoenzyme containing either principal sigma factor RpoD1 or
another, if any, minor sigma factor. In Synechococcus sp.
strain PCC7942,
32-related factor has not been found,
but CIRCE is conserved upstream of the groESL operon
(41). Therefore, it is possible that the dnaK2
gene also contains a CIRCE element in the promoter region and is
transcribed by RNA polymerase holoenzyme containing the principal RpoD1
factor. However, no CIRCE element was found in the upstream region of
any of the three dnaK genes of Synechocystis sp.
strain PCC6803, although it is conserved in both the groESL operon and groEL-2 gene. Alternatively, cyanobacterial
dnaK genes may have another regulatory mechanism that dose
not depend on CIRCE or
32.
The synthesis rate of DnaK1 and DnaK3 did not show any distinct change
after temperature upshift. After heat shock, the DnaK3 level was kept
constant, while DnaK1 seems to be degraded more rapidly, suggesting the
existence of a mechanism to maintain the level of DnaK3 protein. Gene
disruption experiments indicated that DnaK3 is essential for growth.
DnaK3 therefore appears to play an important role in cell physiology
under normal conditions other than heat shock response.
Although E. coli dnaK is dispensable under normal growth
conditions, mutation in dnaK causes ts growth at both high
and low temperatures and defects in septation, which result in cell
filamentation (2, 30). E. coli dnaK mutants
also survive poorly during carbon starvation and stationary phase
(37). Overproduction of DnaK also results in the formation
of filamentous cells and reduced cell viability during stationary phase
(1). It is interesting to note that both DnaK deficiency
and overproduction result in similar physiological defects.
Overproduction of the FtsZ protein in dnaK mutants
suppressed filamentation, suggesting that DnaK might play a role in
cell division via some action on FtsZ (2). Defective
septation in strains overproducing DnaK may also result from an
interaction(s) between DnaK protein and proteins involved in cell
division (1). Since overproduction of
Synechococcus DnaK1 or DnaK2 in E. coli resulted
in cell filamentation, it is possible that DnaK1 and DnaK2 interact
with E. coli proteins involved in cell division. When
expressed in the E. coli dnaK756 mutant, dnaK2
could suppress the growth deficiency at the nonpermissive temperature,
while dnaK1 and dnaK3 could not. On the contrary, overproduction of DnaK1 or DnaK3 resulted in growth inhibition at the
permissive temperature. Taken together, these results suggest that
DnaK2 is a functional counterpart of the E. coli DnaK protein.
The E. coli genome project has disclosed two other
dnaK homologs in this organism. However, neither of these
seems to be structurally related to any dnaK gene of
Synechococcus. It should be noted that both DnaK2 and DnaK3
contain several motifs specific to Hsp70 proteins in chloroplasts and
significant amounts of DnaK3 are localized to the thylakoid membrane
(26). Moreover, a dnaJ homologue gene
(dnaJ7942) which is located immediately
downstream of dnaK3 has also been identified and
characterized (29). dnaJ7942 is
essential for growth, and DnaJ7942 is also detected
quantitatively in the thylakoid membranes. These facts suggest that
DnaK3 and DnaJ7942 cooperatively have some specific
function(s) related to photosynthesis. Synechocystis sp.
PCC6803 was revealed to have four DnaJ homologues (ORF
designations in the database are sll0897, sll1666, sll1933, and
slr0093). Among them, dnaJ6803 (sll1933) is
similarly located downstream of dnaK6803
(sll1932), which corresponds to Synechococcus dnaK3, and
DnaJ6803 (sll1933) shows similarity with
DnaJ7942 in that they do not have a Gly/Phe-rich domain or
a zinc finger domain, both of which are often identified in DnaJ
homologues. These two genes seem to be cotranscribed and to be the only
pair which constitute an operon among the three dnaK and
four dnaJ genes. It is therefore intriguing to assume that
DnaK3/DnaJ7942 is involved in localizing proteins required
for photosynthesis to thylakoid membranes.
 |
ACKNOWLEDGMENTS |
We are indebted to T. Endo (Nagoya University, Nagoya, Japan) for
providing the Synechococcus strain and plasmid pTrc99A/X. We
also thank H. Yamamoto (Osaka University, Osaka, Japan) for his help in
preparation of mouse antibodies.
This research was supported by a grant-in-aid from the Ministry of
Education, Science, Sports and Culture of Japan and by a grant from the
Biodesign Research Program of Riken.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Bioscience, Tokyo University of Agriculture, Sakuragaoka, Setagaya-ku, Tokyo 156-8502, Japan. Phone: 81 (3) 5477-2758. Fax: 81 (3)
5477-2668. E-mail:
hiyoshik{at}imcbns.iam.u-tokyo.ac.jp.
 |
REFERENCES |
| 1.
|
Blum, P.,
J. Ory,
J. Bauernfeind, and J. Krska.
1992.
Physiological consequences of DnaK and DnaJ overproduction in Escherichia coli.
J. Bacteriol.
174:7436-7444[Abstract/Free Full Text].
|
| 2.
|
Bukau, B., and G. C. Walker.
1989.
Cellular defects caused by deletion of the Escherichia coli dnaK gene indicate roles for heat shock protein in normal metabolism.
J. Bacteriol.
171:2337-2346[Abstract/Free Full Text].
|
| 3.
|
Casadaban, M. J.
1976.
Transposition and fusion of the lac genes to selected promoters in Escherichia coli using bacteriophage lambda and Mu.
J. Mol. Biol.
104:541-556[CrossRef][Medline].
|
| 4.
|
Castenholz, R. W.
1988.
Culturing methods for cyanobacteria.
Methods Enzymol.
167:68-93.
|
| 5.
|
Craig, E. A., and K. Jacobsen.
1985.
Mutations in cognate gene of Saccharomyces cerevisiae hsp70 result in reduced growth rates at low temperatures.
Mol. Cell. Biol.
5:3517-3524[Abstract/Free Full Text].
|
| 6.
|
Craig, E. A., and K. Jacobsen.
1984.
Mutations of the heat inducible 70 kilodalton genes of yeast confer temperature-sensitive growth.
Cell
38:841-849[CrossRef][Medline].
|
| 7.
|
Ellis, R. J.
1987.
Proteins as molecular chaperones.
Nature
328:378-379[CrossRef][Medline].
|
| 8.
|
Ellis, R. J., and S. M. van der Vies.
1991.
Molecular chaperones.
Annu. Rev. Biochem.
60:321-347[CrossRef][Medline].
|
| 9.
|
Fraser, C. M.,
S. Casjens,
W. M. Huang,
G. G. Sutton,
R. Clayton,
R. Lathigra,
O. White,
K. A. Ketchum,
R. Dodson,
E. K. Hickey,
M. Gwinn,
B. Dougherty,
J. F. Tomb,
R. D. Fleischmann,
D. Richardson,
J. Peterson,
A. R. Kerlavage,
J. Quackenbush,
S. Salzberg,
M. Hanson,
R. van Vugt,
N. Palmer,
M. D. Adams,
J. Gocayne,
J. C. Venter, et al.
1997.
Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi.
Nature
390:580-586[CrossRef][Medline].
|
| 10.
|
Gamer, J.,
G. Multhaup,
T. Tomoyasu,
J. S. McCarty,
S. Rüdiger,
H.-J. Schönfeld,
C. Schirra,
H. Bujard, and B. Bukau.
1996.
A cycle of binding and release of the DnaK, DnaJ, and GrpE chaperones regulates activity of the Escherichia coli heat shock transcription factor 32.
EMBO J.
15:607-617[Medline].
|
| 11.
|
Gething, M.-J., and J. Sambrook.
1992.
Protein folding in the cell.
Nature
355:33-45[CrossRef][Medline].
|
| 12.
|
Goto-Seki, A.,
M. Shirokane,
S. Masuda,
K. Tanaka, and H. Takahashi.
1999.
Specificity crosstalk among group 1 and group 2 sigma factors in the cyanobacterium Synechococcus sp. PCC7942: in vitro specificity and phylogenetic analysis.
Mol. Microbiol.
34:473-484[CrossRef][Medline].
|
| 13.
|
Grossman, A. D.,
D. B. Straus,
W. A. Walter, and C. A. Gross.
1987.
Sigma 32 synthesis can regulate the synthesis of heat shock proteins in Escherichia coli.
Genes Dev.
1:179-184[Abstract/Free Full Text].
|
| 14.
|
Hartl, F. U.
1996.
Molecular chaperones in cellular protein folding.
Nature
381:571-580[CrossRef][Medline].
|
| 15.
|
Higuchi, R.
1989.
Using PCR to engineer DNA, p. 61-70.
In
H. A. Erlich (ed.), PCR technology. Stockton Press, New York, N.Y.
|
| 16.
|
James, P.,
C. Pfund, and E. A. Craig.
1997.
Functional specificity among Hsp70 molecular chaperones.
Science
275:387-389[Abstract/Free Full Text].
|
| 17.
|
Kaneko, T.,
S. Sato,
H. Kotani,
A. Tanaka,
E. Asamizu,
Y. Nakamura,
N. Miyajima,
M. Hirosawa,
M. Sugiura,
S. Sasamoto,
T. Kimura,
T. Hosouchi,
A. Matsuno,
A. Muraki,
N. Nakazaki,
K. Naruo,
S. Okumura,
S. Shimpo,
C. Takeuchi,
T. Wada,
A. Watanabe,
M. Yamada,
M. Yasuda, and S. Tabata.
1996.
Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions.
DNA Res.
3:109-136[Abstract].
|
| 18.
|
Kawasaki, Y.,
C. Wada, and T. Yura.
1990.
Roles of Esherichia coli heat shock proteins Dnak, DnaJ, and GrpE in mini-F plasmid replication.
Mol. Gen. Genet.
220:277-282[Medline].
|
| 19.
|
Kuhlemeier, C. J.,
A. A. M. Thomas,
A. van der Ende,
R. W. van Leen,
W. E. Borrias,
C. A. M. J. J. van den Hondel, and G. A. van Arkel.
1983.
A host-vector system for gene cloning in the cyanobacterium Anacystis nidulans R2.
Plasmid
10:156-163[CrossRef][Medline].
|
| 20.
|
Lelivelt, M. J., and T. H. Kawula.
1995.
Hsc66, an Hsp70 homolog in Escherichia coli, is induced by cold shock but not by heat shock.
J. Bacteriol.
177:4900-4907[Abstract/Free Full Text].
|
| 21.
|
Li, M., and S.-L. Wong.
1992.
Cloning and characterization of the groESL operon from Bacillus subtilis.
J. Bacteriol.
174:3981-3992[Abstract/Free Full Text].
|
| 22.
|
Li, R., and S. S. Golden.
1993.
Enhancer activity of light-responsive regulatory elements in the untranslated leader regions of cyanobacterial psbA genes.
Proc. Natl. Acad. Sci. USA
90:11678-11682[Abstract/Free Full Text].
|
| 23.
|
Lindquist, S., and E. A. Craig.
1988.
The heat-shock proteins.
Annu. Rev. Genet.
22:631-677[CrossRef][Medline].
|
| 24.
|
Mogk, A.,
G. Homuth,
C. Scholz,
L. Kim,
F. X. Schmid, and W. Schumann.
1997.
The GroE chaperonin machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis.
EMBO J.
16:4579-4590[CrossRef][Medline].
|
| 25.
|
Narberhaus, F., and H. Bahl.
1992.
Cloning, sequencing, and molecular analysis of the groESL operon of Clostridium acetobutylicum.
J. Bacteriol.
174:3282-3289[Abstract/Free Full Text].
|
| 26.
|
Nimura, K.,
H. Yoshikawa, and H. Takahashi.
1996.
DnaK3, one of the three DnaK proteins of cyanobacterium Synechococcus sp. PCC7942, is quantitatively detected in the thylakoid membrane.
Biochem. Biophys. Res. Commun.
229:334-340[CrossRef][Medline].
|
| 27.
|
Nimura, K.,
H. Yoshikawa, and H. Takahashi.
1994.
Identification of dnaK multigene family in Synechococcus sp. PCC7942.
Biochem. Biophys. Res. Commun.
201:466-471[CrossRef][Medline].
|
| 28.
|
Nimura, K.,
H. Yoshikawa, and H. Takahashi.
1994.
Sequence analysis of the third dnaK homolog gene in Synechococcus sp. PCC7942.
Biochem. Biophys. Res. Commun.
201:848-854[CrossRef][Medline].
|
| 29.
|
Oguchi, K.,
K. Nimura,
H. Yoshikawa, and H Takahashi.
1997.
Sequence and analysis of a dnaJ homologue gene in cyanobacterium Synechococcus sp. PCC7942.
Biochem. Biophys. Res. Commun.
236:461-466[CrossRef][Medline].
|
| 30.
|
Paek, K.-H., and G. C. Walker.
1987.
Escherichia coli dnaK null mutants are inviable at high temperature.
J. Bacteriol.
169:283-290[Abstract/Free Full Text].
|
| 31.
|
Porter, R. D.
1988.
DNA transformation.
Methods Enzymol.
167:703-712[Medline].
|
| 32.
|
Prentki, P., and H. M. Krisch.
1984.
In vitro insertional mutagenesis with a selectable DNA fragment.
Gene
29:303-313[CrossRef][Medline].
|
| 33.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 34.
|
Schmidt, A.,
M. Schiesswohl,
U. Völker,
M. Hecker, and W. Schumann.
1992.
Cloning, sequencing, mapping, and transcriptional analysis of the groESL operon from Bacillus subtilis.
J. Bacteriol.
174:3993-3999[Abstract/Free Full Text].
|
| 35.
|
Schulz, A., and W. Schumann.
1996.
hrcA, the first gene of the Bacillus subtilis dnaK operon, encodes a negative regulator of class I heat shock genes.
J. Bacteriol.
178:1088-1093[Abstract/Free Full Text].
|
| 36.
|
Seaton, B. L., and L. E. Vickery.
1994.
A gene encoding a DnaK/hsp70 homolog in Escherichia coli.
Proc. Natl. Acad. Sci. USA
91:2066-2070[Abstract/Free Full Text].
|
| 37.
|
Spence, J.,
A. Cegielska, and C. Georgopoulos.
1990.
Role of Escherichia coli heat shock proteins DnaK and HtpG(C62.5) in response to nutritional deprivation.
J. Bacteriol.
172:7157-7166[Abstract/Free Full Text].
|
| 38.
|
Straus, D.,
W. Walter, and C. Gross.
1990.
DnaK, DnaJ, and GrpE heat shock proteins negatively regulate heat shock gene expression by controlling the synthesis and stability of 32.
Genes Dev.
4:2202-2209[Abstract/Free Full Text].
|
| 39.
|
Tilly, K.,
N. McKittrick,
M. Zylicz, and C. Georgopoulos.
1986.
The dnaK protein modulates the heat-shock response of Escherichia coli.
Cell
34:641-646.
|
| 40.
|
Tozawa, Y.,
H. Yoshikawa,
F. Kawamura,
M. Itaya, and H. Takahashi.
1992.
Isolation and characterization of the groES and groEL genes of Bacillus subtilis Marburg.
Biosci. Biotechnol. Biochem.
56:1995-2002[Medline].
|
| 41.
|
Webb, R.,
K. J. Reddy, and L. A. Sherman.
1990.
Regulation and sequence of the Synechococcus sp. strain PCC7942 groESL operon, encoding a cyanobacterial chaperonin.
J. Bacteriol.
172:5079-5088[Abstract/Free Full Text].
|
| 42.
|
Werner-Washburne, M.,
J. Becker,
J. Kosic-Smithers, and E. A. Craig.
1989.
Yeast Hsp70 RNA levels vary in response to the physiological status of the cell.
J. Bacteriol.
171:2680-2688[Abstract/Free Full Text].
|
| 43.
|
Werner-Washburne, M.,
D. E. Stone, and E. A. Craig.
1987.
Complex interactions among members of an essential subfamily of hsp70 genes in Saccharomyces cerevisiae.
Mol. Cell. Biol.
7:2568-2577[Abstract/Free Full Text].
|
| 44.
|
Wetzstein, M.,
U. Völker,
J. Dedio,
S. Löbau,
U. Zuber,
M. Schiesswohl,
C. Herget,
M. Hecker, and W. Schumann.
1992.
Cloning, sequencing, and molecular analysis of the dnaK locus from Bacillus subtilis.
J. Bacteriol.
174:3300-3310[Abstract/Free Full Text].
|
| 45.
|
Yoshimune, K.,
T. Yoshimura, and N. Esaki.
1998.
Hsc62, a new DnaK homolog of Escherichia coli.
Biochem. Biophys. Res. Commun.
250:115-118[CrossRef][Medline].
|
| 46.
|
Yuan, G., and S.-L. Wong.
1995.
Regulation of groE expression in Bacillus subtilis: the involvement of the A-like promoter and the roles of the inverted repeat sequence (CIRCE).
J. Bacteriol.
177:5427-5433[Abstract/Free Full Text].
|
| 47.
|
Yura, T., and K. Nakahigashi.
1999.
Regulation of the heat-shock response.
Curr. Opin. Microbiol.
2:153-158[CrossRef][Medline].
|
| 48.
|
Yura, T.,
H. Nagai, and H. Mori.
1993.
Regulation of the heat-shock response in bacteria.
Annu. Rev. Microbiol.
47:321-350[CrossRef][Medline].
|
| 49.
|
Zuber, U., and W. Schumann.
1994.
CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis.
J. Bacteriol.
176:1359-1363[Abstract/Free Full Text].
|
Journal of Bacteriology, February 2001, p. 1320-1328, Vol. 183, No. 4
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1320-1328.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Koksharova, O. A., Klint, J., Rasmussen, U.
(2007). Comparative proteomics of cell division mutants and wild-type of Synechococcus sp. strain PCC 7942. Microbiology
153: 2505-2517
[Abstract]
[Full Text]
-
Rupprecht, E., Gathmann, S., Fuhrmann, E., Schneider, D.
(2007). Three different DnaK proteins are functionally expressed in the cyanobacterium Synechocystis sp. PCC 6803. Microbiology
153: 1828-1841
[Abstract]
[Full Text]
-
Sato, M., Nimura-Matsune, K., Watanabe, S., Chibazakura, T., Yoshikawa, H.
(2007). Expression Analysis of Multiple dnaK Genes in the Cyanobacterium Synechococcus elongatus PCC 7942. J. Bacteriol.
189: 3751-3758
[Abstract]
[Full Text]
-
Andersson, F. I., Blakytny, R., Kirstein, J., Turgay, K., Bukau, B., Mogk, A., Clarke, A. K.
(2006). Cyanobacterial ClpC/HSP100 Protein Displays Intrinsic Chaperone Activity. J. Biol. Chem.
281: 5468-5475
[Abstract]
[Full Text]
-
Mary, I., Tu, C.-J., Grossman, A., Vaulot, D.
(2004). Effects of high light on transcripts of stress-associated genes for the cyanobacteria Synechocystis sp. PCC 6803 and Prochlorococcus MED4 and MIT9313. Microbiology
150: 1271-1281
[Abstract]
[Full Text]
-
Sung, D. Y., Guy, C. L.
(2003). Physiological and Molecular Assessment of Altered Expression of Hsc70-1 in Arabidopsis. Evidence for Pleiotropic Consequences. Plant Physiol.
132: 979-987
[Abstract]
[Full Text]