Previous Article | Next Article 
Journal of Bacteriology, February 2001, p. 1413-1422, Vol. 183, No. 4
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1413-1422.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Influence of the Nucleoid on Placement of FtsZ
and MinE Rings in Escherichia coli
Qin
Sun and
William
Margolin*
Department of Microbiology and Molecular
Genetics, University of Texas-Houston Medical School, Houston,
Texas 77030
Received 5 July 2000/Accepted 15 November 2000
 |
ABSTRACT |
We previously presented evidence that replicating but unsegregated
nucleoids, along with the Min system, act as topological inhibitors to
restrict assembly of the FtsZ ring (Z ring) to discrete sites in the
cell. To test if nonreplicating nucleoids have similar exclusion
effects, we examined Z rings in dnaA (temperature
sensitive) mutants. Z rings were excluded from centrally localized
nucleoids and were often observed at nucleoid edges. Cells with
nonreplicating nucleoids formed filaments, some of which contained
large nucleoid-free areas in which Z rings were positioned at regular
intervals. Because MinE may protect FtsZ from the action of the MinC
inhibitor in these nucleoid-free zones, we examined the localization of
a MinE-green fluorescent protein (GFP) fusion with respect to Z rings
and nucleoids. Like Z rings, MinE-GFP appeared to localize
independently of nucleoid position, forming rings at regular intervals
in nucleoid-free regions. Unlike FtsZ, however, MinE-GFP often
localized on top of nucleoids, replicating or not, suggesting that MinE
is relatively insensitive to the nucleoid inhibition effect. These data
suggest that both replicating and nonreplicating nucleoids are capable of topologically excluding Z rings but not MinE.
 |
INTRODUCTION |
Escherichia coli cells
divide precisely at the midpoint of the long axis of the cell to
produce two daughter cells of equal length. One of the key questions in
bacterial cell biology is how the correct division plane is identified.
We recently proposed a new model for division site selection in
E. coli that integrated several previous hypotheses
(39). One of these hypotheses, known as the nucleoid
occlusion model, proposes that the nucleoid inhibits septation
throughout the area of the cell that it occupies (37, 38).
How might this occur? Recent evidence suggests that oriC and
its associated components, such as SeqA, are centered with respect to
the cell and coincide with future division sites (23, 24).
We propose that when these components duplicate and migrate outward
from midcell during replication and segregation, they may relieve the
nucleoid-mediated inhibition at the vacated midcell site. The end
result is that the Z ring, which is a ring structure composed of the
tubulin-like protein FtsZ and is essential for initiation of septation
(2, 15, 29), is allowed to assemble at the exact middle of
the cell, followed by formation of the septum between the nucleoids.
The experimental evidence for nucleoid-mediated inhibition of Z rings
includes (i) the tendency of Z rings and septa to form in nucleoid-free
regions in various mutants (4, 21, 39) and (ii) the
failure of Z rings to assemble at the middle of parC cells,
defective in topoisomerase IV, that contain a large, centrally located
unsegregated nucleoid (33). Instead of assembling at midcell, Z rings in such cells usually form on the edge of the unsegregated nucleoid mass. This seems to be the default site for FtsZ
assembly when the primary site at midcell is blocked.
Nucleoid-mediated inhibition is only part of how division site
positioning might be regulated. Surprisingly, Z rings are often present
near the middle of anucleate cells produced by parC mutants as well as other mutants defective in chromosome segregation
(33). The lower precision of Z-ring placement in these
cells lacking nucleoids is consistent with the idea that normal
nucleoid-mediated inhibition helps to guide FtsZ to the precise midcell
location. However, the existence of Z rings near the center of these
cells indicates that some factor other than the nucleoid must also play a role in guiding their localization. In support of this idea, Cook and
Rothfield found that septa could form at locations far away from
nucleoids in DNA replication mutants and that these septa were
positioned at a fairly fixed distance from a cell pole (4). This result is consistent with our integrated model,
in which the Min proteins are proposed to be the primary
nucleoid-independent factors involved in guiding FtsZ to the correct
cellular location.
The Min proteins consist of MinC, MinD, and MinE, encoded by the
minB operon. Deletion of this operon results in the
formation of septa at either midcell or the poles; polar septation
events result in anucleate minicells (5, 6). MinC is an
inhibitor of FtsZ self-assembly, whereas MinD enhances the activity of
MinC by recruiting MinC to the membrane and driving a remarkable
oscillation of the two proteins from one cell pole to the other
(12, 13, 26, 28). MinE, on the other hand, localizes as a
ring near midcell independently of FtsZ, although its localization is
not as precise as that of FtsZ (27). The MinE ring is
proposed to counteract MinCD inhibition in its vicinity, perhaps by
physically excluding MinCD, allowing the Z ring to assemble safely
nearby (32). It is unclear how MinE gets targeted to the
cell center, although interestingly, this targeting requires MinD. One
attractive model is that the MinD oscillation serves to mark the
position equidistant between the two cell poles
perhaps the region of
lowest average MinD concentration
guiding the MinE ring to this position.
How does the Min system fit into our integrated model? The presence of
a MinE ring near the center of anucleate cells would explain how the Z
ring can assemble near midcell in the absence of the guiding influence
of the nucleoid. The presence of a MinE ring that locally counteracts
MinCD inhibition would also explain how septa in nucleoid-free segments
of filamentous DNA replication mutants are allowed to form. Without
MinE, the midcell relief of nucleoid inhibition is not sufficient to
suppress MinCD-mediated inhibition, explaining why minE
mutants cannot divide (6). Likewise, without relief of
nucleoid inhibition, the MinE ring at midcell is not sufficient to
allow a Z ring to form there. The combined requirement of both the
nucleoid and the Min system for Z-ring placement is best illustrated by
our previous study, in which Z rings form promiscuously throughout a
minB cell, but only in nucleoid-free gaps
(39). This finding prompted us to formulate our model,
which proposes that there are two main negative topological regulators
of Z-ring assembly in E. coli: the nucleoid and MinCD. These
two components are proposed to be sufficient to define the division
site, by preventing Z-ring assembly throughout the nucleoid-containing
and nucleoid-free (polar) segments of the wild-type cell, respectively,
until the inhibition at midcell is relieved. The mechanisms of
nucleoid-mediated exclusion and its suppression are not yet known.
Some aspects of the model require refinement. For example, we made our
conclusions from studies of a parC mutant, which contains very large nucleoids because they are replication competent despite being segregation defective. As a result, we could not rule out the
possibility that such large nucleoids have nonspecific inhibitory effects on Z-ring assembly that are not typical of wild-type nucleoids. In addition, Z rings or septa have been shown clearly to transect, or
guillotine, nucleoids in some mutants defective in chromosome replication or organization (4, 22, 33). This would seem to be a direct contradiction of the nucleoid occlusion portion of the
model. However, such nucleoid cutting is not observed in wild-type
cells, and it can be argued that in many cases where it is observed,
such as mukB mutants, the structure of the nucleoid is
grossly altered (30), which might suppress the inhibitory activity. Guillotining of nucleoids has also been proposed to occur in
ftsK, dif, and xerCD mutants, which
are unable to resolve dimeric chromosomes in a proportion of cells
(11, 31). It is not yet clear what allows guillotining of
these dimer chromosomes.
In the present study, we have sought to refine our integrated model in
several ways. First, we have addressed the potential problem of high
DNA concentrations by using a chromosome replication initiation mutant.
We found that Z rings were still blocked from the central site when the
nucleoid occupied this area and instead assembled at the edge of the
nucleoid. In filaments arising after extensive incubation at the
nonpermissive temperature, Z rings localized to discrete sites in the
long nucleoid-free segments of these filaments in a Min-dependent
fashion. Our results therefore suggest that small, nonreplicating
nucleoids are able to inhibit local assembly of Z rings. Second, we
investigated whether this unusual Z-ring positioning was a direct
result of colocalization with, and thus protection by, MinE, and
whether MinE localization was inhibited by nucleoids. We found that
localization of a MinE-green fluorescent protein (GFP) fusion, unlike
FtsZ, appears to be relatively insensitive to the postulated
nucleoid-mediated inhibition.
 |
MATERIALS AND METHODS |
Strains, plasmids, and growth conditions.
All strains used
for this work are derivatives of E. coli K-12 and are listed
in Table 1. The
minCDE
dnaA46 double mutant WM1384 was constructed by P1-mediated
cotransduction of tna::Tn10 and
dnaA46 (14) into the
minCDE
strain WM1032. Tetracycline-resistant, temperature-sensitive colonies
which produced minicells were confirmed to be defective in DNA
replication by staining with DAPI (4',6-diamidino phenylindole).
To construct a
minE-gfp fusion that also carries the
minD gene, which is required for MinE localization, we first
obtained
the
minC'
DE fragment described
previously (
27) by PCR from
E. coli DNA. We
used the upstream primer CGGAGCTCAATCCCAGCAGA and
the
downstream primer TTTCTAGATTTCAGCTCTTCTGCT. Plasmid pWM1005
was constructed by cleaving the PCR fragment with
SacI and
XbaI
and cloning in between the
SacI and
XbaI sites of pGBC to fuse
gfp translationally
with
minE. A short linker was then inserted
between
minE and
gfp as previously described
(
27) to generate
pWM1025. Plasmid pWM1079 was constructed
by inserting the
SacI-
KpnI
fragment of pWM1025
containing the entire
minC'
DE-linker-
gfp into
SacI-
KpnI-cleaved pBAD33. WM1081 was constructed
by introducing
the Cm
r pWM1079 plasmid into the
parC281 mutant WM1033, which is defective
in topoisomerase
IV function. WM1326 was constructed by introducing
pWM1079 into the
dnaA46 strain
WM1270.
Unless otherwise noted, cells were grown overnight in Luria-Bertani
(LB) medium with 0.5% NaCl at 30°C, diluted 200-fold in
fresh LB,
and grown at 30°C to early logarithmic phase. At this
point, cells
were shifted to 37 or 42°C and grown for several
additional hours
before they were analyzed. For normal growth
of
thyA
strains, the medium was supplemented with 50 µg of thymine
per ml.
For induction of MinE-GFP synthesis, 0.2%
L-arabinose
was
added, and FtsZ synthesis from pMK4 was induced by addition
of 40 µM
IPTG (isopropylthiogalactoside). For growth of the
dnaA5 and
dnaA177 strains in more defined medium, we used M9 salts
supplemented
with 0.2% glucose and 50 µg of thymine per ml, with or
without
1% tryptone. For thymine starvation,
thyA cells in
logarithmic
growth were washed and resuspended in fresh medium lacking
thymine
and grown at 42°C for an additional 3 to 4
h.
Cell fixation, staining, and microscopy.
Fixation of cells,
staining with DAPI, and immunofluorescence microscopy (IFM) were
performed as previously described (39). Rabbit polyclonal
antibodies against purified FtsZ and purified GFP were raised at
Cocalico Biologicals, Inc. (Reamstown, Pa.) and were affinity purified
using Affi-Gel 15 (Bio-Rad Laboratories, Hercules, Calif.) according to
the manufacturer's instructions (25). The
affinity-purified antibodies were used as primary antibodies for IFM.
Anti-rabbit immunoglobulin secondary antibodies conjugated to green
Alexa 488 (Molecular Probes, Eugene, Oreg.) were used to visualize
FtsZ- and GFP-tagged MinE.
In order to visualize nucleoids and GFP simultaneously in intact cells,
we used blue Hoechst 33342 (Sigma Chemical Co., St.
Louis, Mo.), which
efficiently stains nucleoids in live
E. coli cells. A 3-µl
aliquot of cell culture was first attached to the
surface of a 0.1%
polylysine-coated cover glass. Then 20 µl of
Hoechst dye (0.5 µg/ml
in H
2O) was added to stain nucleoids for
several minutes.
After staining, excess dye was removed, and the
cover glass containing
stained cells was placed on top of a slide
containing a drop of
antibleaching buffer (0.1%
p-phenylenediamine
and 80%
glycerol in phosphate-buffered saline). Fixed samples
were examined by
fluorescence microscopy, and a DAPI filter was
used to visualize the
Hoechst staining. Red-green-blue (RGB) images
were captured as
previously described (
39), with red and blue
cables
reversed in order to convert the blue DAPI and Hoechst
images into red
pseudocolor for better contrast. Distance and
length measurements were
made in Adobe Photoshop with the measurement
tool. Data were then
graphed with SigmaPlot (Jandel
Scientific).
 |
RESULTS |
Deficient cell division in dnaA46 mutants.
DnaA
protein is responsible for initiation of chromosome replication from
oriC (3). To examine FtsZ localization in cells with nonreplicating chromosomes, we used a well-characterized temperature-sensitive allele of dnaA, dnaA46,
present in strain WM1270 (20, 36). When shifted to the
nonpermissive temperature of 42°C, dnaA(Ts) mutants stop
initiating replication at oriC, and any active replication
forks continue until they terminate. Assuming that it takes about 40 min to replicate the entire chromosome and that the amount of
initiation at 42°C is negligible, essentially all replication should
be stopped within 1 h after temperature shift.
We first examined WM1270 cells shifted to 42°C by DAPI staining to
detect nucleoids and by IFM to detect Z rings. At 42°C,
the cells
continued to elongate for several hours, well after
replication would
have stopped, indicating that cell division
is deficient. This cell
division deficit was observed relatively
early after the temperature
shift, as short filaments containing
two to four nucleoids were present
in 26% of nucleoid-containing
cells after 2 h at 42°C. Single Z
rings were visible in the gaps
between nucleoids in these cells (see
below). Some of these Z
rings were probably competent for subsequent
septation, because
the frequency of cells containing two or more
nucleoids was reduced
to 10% after 1 to 2 h of additional growth
at 42°C. This suggested
that the division problem was not caused by a
deficiency of FtsZ
in the cells as a result of lower gene dosage. In
support of this
idea, FtsZ levels normalized to total cell protein were
found
to be equivalent in WM1270 cells growing at either 42 or 28°C
by immunoblotting (data not shown). Another possible cause of
the
division deficiency, induction of the SOS response and subsequent
SulA-mediated inhibition of Z-ring assembly, was ruled out because
WM1270 is
recA; this is also consistent with the presence of
Z
rings in the
filaments.
Continued growth and some cell division at 42°C resulted in the
formation of short and long filaments, with long filaments
being more
common at later times. Both types of cells exhibited
clear signs of
chromosome replication arrest, with large areas
of the cells devoid of
DNA. Many of the short (4 to 8 µm) filaments
contained one centrally
located nucleoid. In contrast, other filaments
contained a single
nucleoid located acentrally or close to a cell
pole (Fig.
1). Anucleate cells were also produced
(Fig.
1), indicating
that cell division, though delayed, was still
occurring at regions
distal from the nonreplicating nucleoid. A similar
phenotype was
also observed in a
recA+
dnaA46 strain (data not shown).

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 1.
Asymmetric localization of FtsZ in a dnaA46
mutant. WM1270 cells shifted to 42°C for 3 h in LB plus thymine
were fixed and immunostained for FtsZ. (A) FtsZ staining in green; (B)
nucleoids stained with DAPI, pseudocolored red; (C) digital overlay of
panels A and B; (D) overlay of panel A and a phase contrast image. Bar,
5 µm.
|
|
Exclusion of Z rings from the midcell site of short
dnaA46 mutant filaments by a nonreplicating nucleoid.
How do such cells with acentral and polar nucleoids arise? We
hypothesize that after temperature shift, the unreplicated nucleoid remains at midcell, blocking the normal division site. Z rings then
form adjacent to the nucleoid, sometimes leading to septation. This
type of nucleoid-inhibited septation is similar to what we previously
observed in parC mutants (33). The end result
is the generation of one daughter cell with a nucleoid near one pole and another cell without a nucleoid. Subsequent cell elongation will
lead to a nucleoid that is neither adjacent to the cell pole nor at midcell.
To test this hypothesis, we examined Z-ring localization with respect
to the nucleoid in short filaments of WM1270 3 to 4
h after the
temperature shift. The results indicate that most
of these cells have a
single Z ring, and, as expected, many Z
rings were localized acentrally
(Fig.
1). Whereas all Z rings
were located at the midpoint of wild-type
MG1655 cells in a range
of 0.45 to 0.5 of the total cell length (0.5 is
the midcell point,
with the poles defined as 0 and 1, and the standard
deviation
from 0.5 was 0.013 for the 130 MG1655 cells counted), only
about
45% of the Z rings were within this range in WM1270 cells (Fig.
2A). The scatter in the data suggests
that Z rings did not localize
to predetermined sites, such as potential
division sites at the
cell quarters. Importantly, in these short
filaments, most Z rings
(93%), including those at midcell, were
positioned close to nucleoid
edges (Fig.
2B). A small proportion
(3.5%) of Z rings appeared
to form on top of the nucleoid under our
conditions, indicating
that the apparent inhibition effect by the
nucleoid is not absolute.
In summary, these results are consistent with
the idea that the
majority of Z rings are excluded from their normal
midcell position
by unreplicated nucleoids. Similar results were
observed in other
strain backgrounds containing the
dnaA46
mutation (data not shown).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
Distribution of Z-ring positions in the
dnaA46 mutant. A total of 129 cells equivalent to those used
in Fig. 1 were used to measure positioning of Z rings and nucleoid
edges relative to the cell poles. A total of 96% of the cells examined
contained only one Z ring. (A) The x axis represents the
distance between the Z ring and the proximal pole, with 0.0 defined as
the pole and 0.5 as the midcell. The solid line at the 0.45 position
represents the border of the normal range of FtsZ localization (0.45 to
0.50) in 130 wild-type MG1655 cells counted. (B) Distances between the
nucleoid edge and the proximal pole are plotted versus the distances
between the Z ring and the proximal pole; 93% of the Z rings examined
localized as close to the edge of the nucleoid as could be measured.
|
|
Z-ring localization in other dnaA(Ts) mutants.
To
rule out the possibility that the effects on Z-ring positioning
resulted from a peculiarity of the dnaA46 allele, we
investigated FtsZ localization in two other dnaA mutants,
PC5 (dnaA5) and E177 (dnaA177). The
dnaA5 mutant had been used in a previous study to analyze
septal position relative to the nucleoid and cell pole (4). Both PC5 and E177, like WM1270, require thymine for
growth. In LB, M9 tryptone medium, or M9 minimal medium, all containing thymine, we frequently found nucleoids of extended size (over 4 µm in
length) at the nonpermissive temperature. This was different from what
we observed in the dnaA46 mutant and surprising, because these mutants cannot form colonies at the nonpermissive temperature and
should not be able to initiate replication under these conditions. This
prompted us to suspect either that residual replication occurred under
our experimental conditions or that the nucleoids were not replicating
but instead were decondensed. These effects were also observed in other
strain backgrounds containing these two alleles (data not shown).
To circumvent this problem, we arrested DNA replication by removing
thymine from the medium, thus depleting cellular thymine
pools.
Nucleoids in thymine-depleted PC5 and E177 cells were significantly
smaller than those in cells with thymine, as expected. Interestingly,
IFM analysis of these cells revealed no FtsZ localization at all,
probably because thymine starvation of
recA+
cells induces the SOS response and prevents Z-ring assembly via
the
action of SulA. To overcome these effects, we introduced plasmid
pMK4,
which expresses
ftsZ under
tac promoter control,
into the
dnaA177 mutant E177. In the absence of IPTG, some
additional FtsZ
was synthesized in these cells, resulting in the
formation of
acentral rings at nucleoid edges (Fig.
3A to
C). These results
are similar to what we
found in the
dnaA46 mutant. When higher
levels of FtsZ were
induced by addition of IPTG, multiple Z rings
appeared in the short
filaments, and they usually assembled in
nucleoid-free regions (Fig.
3D
to F). This suggests that nonreplicating
nucleoids are able to exclude
Z rings even when FtsZ levels are
relatively high.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 3.
Z rings in the dnaA177 mutant. To counteract
any potential SOS response in the recA+
dnaA177 cells after replication arrest, FtsZ synthesis was
increased with a plasmid expressing ftsZ under
tac promoter control (WM1179). WM1179 cells were grown in LB
plus thymine to early log phase at 30°C. Cells were then washed three
times and resuspended in LB without thymine, containing no IPTG (A to
C) or 40 µM IPTG to induce extra FtsZ synthesis (D to F), and grown
at 42°C for 3 h. (A and D) FtsZ staining in green; (C and F),
nucleoids stained with DAPI, pseudocolored red; (B and E), digital
overlays of panels A plus C and panels D plus F, respectively.
|
|
Z rings localize at regular intervals in long nucleoid-free regions
of dnaA mutant filaments.
As mentioned above, when
WM1270 was grown for extended periods at the nonpermissive temperature
of 42°C, many cells became long filaments because of an overall delay
in septation. Most of these long filaments contained far fewer
nucleoids per cell length than replication-proficient cells, resulting
in long anucleate regions up to 20 µm in length. IFM analysis
revealed that the anucleate regions often contained regularly spaced Z
rings. Interestingly, the distance between the rings was significantly
longer than the normal 2 to 3 µm seen in filaments with normal
nucleoids, and this distance varied from cell to cell (Fig.
4). This result suggests that in DNA
replication mutants, Z rings can localize at discrete intervals in a
regular pattern in the absence of the nucleoid.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
Periodic localization of Z rings in anucleate segments
of long dnaA46 filaments. WM1270 cells shifted to 42°C for
4 h in LB plus thymine were fixed and immunostained for FtsZ. The
left panel shows FtsZ staining in green, and the right panel shows
nucleoids stained with DAPI, pseudocolored red. The middle panel is a
digital overlay of the left and right panels. Bar, 5 µm.
|
|
Involvement of the Min system in regular Z-ring localization in the
absence of the nucleoid.
What factors might guide Z rings to
assemble at regular intervals in the extensive nucleoid-free spaces in
these dnaA mutants? Because the Min system is intact in
these cells, our integrated model would predict that MinCD inhibits Z
rings from assembling throughout most of the nucleoid-free areas except
within zones protected by MinE.
We therefore investigated whether MinE rings localized in patterns
similar to FtsZ in these cells. We used a MinE-GFP fusion
to report
localization of MinE in the
dnaA46 mutant. Such fusions
appear to be fully functional (
27). WM1326 is WM1270
(
dnaA46)
containing a plasmid (pWM1079) coexpressing
MinE-GFP and MinD,
which is required for localization of MinE, under
arabinose control.
Because the MinE-GFP fluorescent signal was unstable
at temperatures
above 40°C in WM1326, the mutant was shifted instead
from 30 to
37°C to observe MinE-GFP localization. At 37°C, WM1326
still failed
to form colonies, and nucleoid and Z-ring patterns were
equivalent
to those observed at 42°C. To detect both MinE-GFP and
nucleoids
with DAPI in the same cells, we fixed the cells and
immunostained
for MinE-GFP using a polyclonal anti-GFP antibody. Cell
fixation
was necessary for efficient DAPI staining, and both MinE-GFP
and
nucleoid staining signals were stable and clear under these
conditions.
To use an independent method, we also used the
membrane-permeating
DNA stain Hoechst 33342 and MinE-GFP to detect both
nucleoids
and MinE localization directly in live cells. With either
technique,
we observed that MinE-GFP localized in a pattern roughly
similar
to that of Z rings in nucleoid-free segments of these mutant
filaments
(Fig.
5M to R, arrows, and data
not shown). This result suggests
that MinE may be required for regular
Z-ring localization in the
anucleate portions of the filaments.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 5.
MinE-GFP localization in the dnaA46 mutant.
WM1326 (MinDE-GFP under pBAD control in dnaA46) cells
growing at 30°C in LB plus thymine were shifted to 37°C. This
temperature, like 42°C, is an effective nonpermissive temperature for
this mutant. After 0 and 1 h of growth at 37°C,
L-arabinose was added to induce MinE-GFP synthesis. Samples
were taken after 3 to 4 h of incubation at 37°C. (A to L)
MinE-GFP rings in short filaments. (M to R) MinE-GFP rings in longer
filaments. (A, D, G, J, M, and P) MinE-GFP immunostaining with anti-GFP
and Alexa 488 (green). (C, F, I, L, O and R) Nucleoids stained with
DAPI, pseudocolored red. (B, E, H, K, N, and Q) Digital overlays of
MinE-GFP and nucleoid staining, corresponding to panels A plus C, D
plus F, G plus I, J plus L, M plus O, and P plus R, respectively.
Arrows in panels M, N, P, and Q highlight the regular MinE-GFP bands in
longer filaments. Bars, 5 µm; the bar in panel R pertains to panels M
to R.
|
|
To test further the requirement of the Min system for Z-ring
localization in nucleoid-free segments of
dnaA filaments,
the
dnaA46 mutation was introduced into the
minCDE strain WM1032,
producing the double
dnaA46
minCDE mutant WM1384. Cells lacking
the Min system are normally
a mixture of short multinucleate filaments
and minicells, because each
polar division event occurs at the
expense of a midcell division
(
1). As expected, prior to shifting
to the nonpermissive
temperature, many of the WM1384 cells already
were filamentous and
multinucleate, and cells continued to elongate
after the temperature
shift in spite of the replication arrest.
This resulted in filaments
with multiple nonreplicating nucleoids
and some long anucleate regions,
as well as small anucleate cells.
In IFM experiments, dramatic clusters
of Z rings localized within
nucleoid-free gaps (Fig.
6). We did not observe transection of
nucleoids by any Z rings (Fig.
6). This promiscuous and seemingly
random assembly of Z rings in nucleoid-free regions of
minCDE cells is similar to our previous results with
parC mutants (
39)
and further supports the idea
that the Min system limits Z-ring
assembly to discrete locations in
these nucleoid-free segments.
These results also support the idea that
nonreplicating nucleoids
can inhibit FtsZ localization in
minCDE strains as efficiently
as unsegregated but
replicating nucleoids.

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 6.
Z-ring clusters in the dnaA46 minCDE
double mutant. WM1384 cells shifted to 42°C for 4 h in LB were
fixed and immunostained for FtsZ. Many filaments appear to be
multinucleate because many minCDE cells were already
multinucleate filaments prior to the temperature shift. (A and D) FtsZ
staining in green; (C and F), nucleoids stained with DAPI,
pseudocolored red; (B and E), digital overlays of panels A plus C and
panels D plus F, respectively.
|
|
MinE-GFP localization is relatively insensitive to inhibition by
the nucleoid and is independent of nucleoid position.
The apparent
inhibition of Z-ring assembly by the nucleoid and the similar patterns
of MinE and FtsZ localization prompted us to ask whether the nucleoid
also inhibits MinE localization in its vicinity. To address this
question, we first investigated the localization of MinE-GFP in short
dnaA46 mutant filaments. WM1326, the dnaA46
mutant carrying MinE-GFP under arabinose control (pWM1079), was shifted
to the nonpermissive temperature of 37°C, and MinE-GFP expression was
induced by adding 0.2% L-arabinose. In IFM experiments, we
found that MinE-GFP rings, in addition to localizing independently of
nucleoids, often formed on top of them (Fig. 5E, H, and K). Staining of
FtsZ in parallel samples showed, as expected, that Z rings were
excluded from the nucleoid (data not shown). This suggests that, unlike
the Z ring, the MinE ring appears to be relatively insensitive to
nucleoid-mediated inhibition.
To test this idea more rigorously, we investigated whether large
parC mutant nucleoids containing multiple unsegregated
chromosomes
might be more likely to exert a negative effect on MinE
ring formation.
WM1081 is a
parC mutant containing the
arabinose-inducible MinE-GFP.
As was done with the
dnaA
mutants, we obtained stable MinE-GFP
localization by shifting to a
lower nonpermissive temperature
(37°C) for
parC, which
still exhibited the segregation defect
at this temperature. MinE-GFP
and nucleoids were visualized simultaneously
in unfixed cells by using
Hoechst 33342. As in the
dnaA46 mutant,
MinE-GFP rings
localized both on top of unsegregated nucleoids
(Fig.
7D to
F) and in the polar nucleoid-free regions
of these
short filaments (Fig.
7A to C). Among 190 cells examined, 22%
exhibited clear transection of the nucleoid by the MinE-GFP ring
(Fig.
8). The results with the
parC
mutant therefore agree with
those with the
dnaA46 mutant.
Our data suggest that MinE localization
is independent of and
relatively insensitive to (i) unsegregated
but replicating nucleoids
and (ii) nonreplicating nucleoids.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 7.
MinE-GFP localization in the parC mutant.
WM1081 cells were grown at 30°C to early logarithmic phase. Then
0.2% L-arabinose was added, and the culture was shifted to
37°C for 2 h. Live cells with MinE-GFP fluorescence were then
stained with Hoechst 33342 in order to visualize MinE-GFP and nucleoids
simultaneously. (A and D) MinE-GFP; (C and F) nucleoids stained with
Hoechst 33342; (B and E) digital overlays of MinE-GFP and Hoechst 33342 staining, corresponding to panels A plus C and D plus F,
respectively.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 8.
Relative positions of MinE-GFP and the nucleoid with
respect to the cell pole. WM1081 (parC) cultures treated as
described in the legend to Fig. 7 were used to measure distances
between the MinE-GFP ring and the pole and the nucleoid edge to the
pole. A total of 190 cells containing MinE-GFP rings were counted.
|
|
We also examined the localization of Z rings in this WM1081
(
parC) strain by IFM under the same conditions used to
visualize
MinE rings. Similar to our previous results
(
33), essentially
all Z rings were positioned at nucleoid
edges, and cutting of
unsegregated nucleoids by a Z ring was not
detected (data not
shown). The results suggest that the unsegregated
chromosomes
in this mutant retained the capacity to inhibit Z-ring
formation,
causing the rings to be acentral, but often allowed central
localization
of MinE
rings.
 |
DISCUSSION |
In this study, we present evidence suggesting that a
nonreplicating nucleoid is able to exclude the Z ring, an essential
component of the division septum. This evidence complements and extends our previous studies, in which Z rings formed throughout nucleoid-free portions of the cell and in small gaps between nucleoids, but did not
form on top of a clearly unsegregated nucleoid mass (33, 39). The unsegregated nucleoid masses in the parC
mutant were very large, because they were replication proficient
despite being segregation deficient. Therefore, the possibility
remained that Z rings are not normally excluded from normal-sized
nucleoids, only from the large parC nucleoids. In the
present study, we show that Z rings are almost always excluded from
small, nonreplicating nucleoids. These results suggest that
nucleoid-mediated inhibition of FtsZ is broadly significant and is not
restricted to a particular type of mutant nucleoid. The fact that
MinE-GFP rings often form on top of both parC and
dnaA mutant nucleoids suggests that the inhibitory effect of
an unsegregated nucleoid on FtsZ is fairly specific, not merely a
steric effect on any protein that normally would localize in the
nucleoid zone.
Despite the evidence for nucleoid-mediated exclusion of Z rings, the
nature of the exclusion is not clear. A recent population study in
wild-type cells suggested that Z rings form at about the time of
termination of chromosomal replication (7). As chromosome
segregation is probably an ongoing process, it is reasonable to propose
that relief of nucleoid-mediated inhibition would occur when
chromosomes were initially being pulled apart, which might occur at the
time of termination. Proper timing of this relief of inhibition would
prevent assembly of the division machinery until after chromosome
replication is complete. Moreover, proper positioning of the relief of
inhibition at the precise center of the cell would help to prevent
scission of the symmetrically segregating chromosomes by the septum.
Although MinE counteracts MinCD inhibition at midcell to allow Z-ring
assembly, MinE localization is not precise; therefore, we postulate
that it is the task of the nucleoid inhibition mechanism and its
subsequent suppression of segregation to provide a more precise site
for Z-ring assembly. When a nucleoid is not nearby, our data suggest
that the Min system may be sufficient to allow Z rings to form in
discrete zones that correspond roughly to MinE rings.
In a recent study, Cook and Rothfield analyzed the positions of septa
in mutant filaments defective in DNA replication (4). They
found that most septa formed approximately 4 to 6 µm from the poles,
usually within nucleoid-free regions of these cells, and that the
position of the often distant nucleoids had no effect on the position
of these septa. This result is consistent with our findings. The
ability of septa to form in a range might be explained by protection of
this region by a nearby MinE ring; the imprecision of septal
positioning within this 4- to 6-µm range would be consistent with the
imprecision of MinE localization. However, another aspect of their
study differed from ours, namely, that large nucleoids near the pole in
dnaA5 ftsA and dnaB sfiA mutants were transected
by septa at higher frequencies than the 3.5% that we observed. The
dnaA5 ftsA mutant is defective in both DNA replication
initiation and a post-FtsZ step in septation at 42°C, necessitating a
return to the permissive temperature of 30°C in order to form visible
septa. It is possible that replication reinitiation under these
conditions might have resulted in the suppression of nucleoid-mediated
inhibition of Z rings. We also found that nucleoids of both
dnaA5 and dnaA177 cells at 42°C were significantly larger than those of dnaA46 mutant cells at
42°C and that these effects were independent of strain background. This suggests that differences in nucleoid structure in
dnaA5 and dnaA177 mutants compared to
dnaA46 mutants might lead to different effects on Z rings.
Another possible explanation is that the nucleoid may not be properly
segregated away from the septum in certain mutants. While Z rings
initially form at the nucleoid edge, subsequent extension of the
nucleoid during a delay in septation might result in occasional
trapping of segments at the edges of nucleoids by the septum. Clearly,
further studies are needed to refine our model for division site
placement and to define more precisely the nucleoid-mediated inhibition
mechanism and the effects of cell physiology on its proper functioning.
The apparent nucleoid independence of MinE localization suggests that,
unlike FtsZ, MinE uses cues other than the nucleoid for its proper
targeting. The dependence of MinE localization on the MinD oscillator
suggests that MinE rings form in the area of the cell with the lowest
average concentration of MinD. This area in wild-type cells should be
around midcell, because MinD dwells mostly at each cell pole and only
appears to migrate transiently through the midcell area
(28). This model is also consistent with the imprecision
of MinE localization (27), in that if MinE dynamically
senses MinD concentration during its oscillation in real time, MinE may
also oscillate in a small range around midcell (18) and
thus may seldom be precisely at midcell.
In the parC mutant, 22% of the MinE rings formed on top of
an unsegregated nucleoid, a position where Z-ring assembly is normally prevented. Because Z rings often form at the edge of these unsegregated nucleoids, it is therefore possible that in some of these cells with
MinE rings on top of nucleoids, Z rings might assemble at a significant
distance away from MinE. How might MinE protect FtsZ from MinCD if this
occurs? Perhaps FtsZ, once above its critical concentration for
assembly, integrates the level of inhibition from both the nucleoid and
MinCD and nucleates a ring at the site with the lowest total inhibitory
activity. In cells with unsegregated nucleoids with active inhibition
mechanisms, this spot would automatically be in the nucleoid-free area.
When the MinE ring is on top of the nucleoid and not in this area, the
inhibition of MinCD by MinE may occur via a gradient of inhibition that
is lowest at the poles and highest near midcell. We speculate that Z
rings form at the edge of the nucleoid because this is farthest away from the maximum inhibitory activity of MinCD and still not in the
nucleoid space. In the dnaA mutant filaments, MinCD and the nucleoid block most parts of the cell except for regularly spaced zones
occupied by MinE rings, which are available sites for Z-ring assembly.
The problem of how MinD oscillates and how MinE localization depends on
this oscillation must be addressed in the future in order to refine
further our integrated division site placement model. Additional
insights about the regulation of Z-ring placement will come from other
model systems that lack MinE and whose nucleoids exert somewhat
different effects on Z-ring assembly and activity (10,
35).
The formation of filaments after inhibition of DNA replication
indicates that there is a deficiency in cell division under these
conditions, although production of cells with fewer nucleoids or no
nucleoids implies that division still occurs, just at a lower rate. The
fact that most of these filaments contain Z rings suggests that the
deficiency is not caused by the lack of Z rings, but instead by a block
downstream from Z-ring formation that results in unused Z rings. The
nature of this block is not yet clear. The Z rings in most cases appear
normal in morphology, indicating that if they are structurally
defective, the defect must be subtle. Another possibility is that a
later cell division protein, such as FtsA, may be limiting, perhaps
because of the lower gene dosage relative to cell volume in these
filaments. Limitation of FtsA can have a major effect on cell division
even in the presence of sufficient FtsZ (1).
After this paper was submitted, Gullbrand and Nordström reported
the effects of nonreplicating nucleoids on Z-ring positioning (8). They observed both cell division deficiencies and
anucleate cell production in a dnaA46 mutant and also found
that Z rings were located on both sides of the centrally located
nucleoids. These results were similar to ours. Work is currently in
progress to understand the mechanism of nucleoid occlusion and the
reasons for the division delay in dnaA mutants.
 |
ACKNOWLEDGMENTS |
We thank Jon Kaguni, Jill Zielstra-Ryalls, and Mary Berlyn at the
E. coli Genetic Stock Center for sending us dnaA
mutant strains and Shelley Sazer for suggesting the use of Hoechst for staining nucleoids of live cells.
This work was supported by grants from the Texas Advanced Technology
Program (011618-0231-1999) and the National Institutes of Health
(1R01-GM61074-01).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Molecular Genetics, University of Texas-Houston
Medical School, 6431 Fannin, Houston, TX 77030. Phone: (713) 500-5452. Fax: (713) 500-5499. E-mail:
margolin{at}utmmg.med.uth.tmc.edu.
 |
REFERENCES |
| 1.
|
Begg, K.,
Y. Nikolaichik,
N. Crossland, and W. D. Donachie.
1998.
Roles of FtsA and FtsZ in activation of division sites.
J. Bacteriol.
180:881-884[Abstract/Free Full Text].
|
| 2.
|
Bramhill, D.
1997.
Bacterial cell division.
Annu. Rev. Cell Dev. Biol.
13:395-424[CrossRef][Medline].
|
| 3.
|
Bramhill, D., and A. Kornberg.
1988.
A model for initiation at origins of DNA replication.
Cell
54:915-918[CrossRef][Medline].
|
| 4.
|
Cook, W. R., and L. I. Rothfield.
1999.
Nucleoid-independent identification of cell division sites in Escherichia coli.
J. Bacteriol.
181:1900-1905[Abstract/Free Full Text].
|
| 5.
|
de Boer, P. A.,
W. R. Cook, and L. I. Rothfield.
1990.
Bacterial cell division.
Annu. Rev. Genet.
24:249-274[Medline].
|
| 6.
|
de Boer, P. A.,
R. E. Crossley, and L. I. Rothfield.
1992.
Roles of MinC and MinD in the site-specific septation block mediated by the MinCDE system of Escherichia coli.
J. Bacteriol.
174:63-70[Abstract/Free Full Text].
|
| 7.
|
den Blaauwen, T.,
N. Buddelmeijer,
M. E. Aarsman,
C. M. Hameete, and N. Nanninga.
1999.
Timing of FtsZ assembly in Escherichia coli.
J. Bacteriol.
181:5167-5175[Abstract/Free Full Text].
|
| 8.
|
Gullbrand, B., and K. Nordström.
2000.
FtsZ ring formation without subsequent cell division after replication runout in Escherichia coli.
Mol. Microbiol.
36:1349-1359[CrossRef][Medline].
|
| 9.
|
Guzman, L. M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130[Abstract/Free Full Text].
|
| 10.
|
Harry, E. J.,
J. Rodwell, and R. G. Wake.
1999.
Co-ordinating DNA replication with cell division in bacteria: a link between the early stages of a round of replication and mid-cell Z ring assembly.
Mol. Microbiol.
33:33-40[CrossRef][Medline].
|
| 11.
|
Hendricks, E. C.,
H. Szerlong,
T. Hill, and P. Kuempel.
2000.
Cell division, guillotining of dimer chromosomes and SOS induction in resolution mutants (dif, xerC and xerD) of Escherichia coli.
Mol. Microbiol.
36:973-981[CrossRef][Medline].
|
| 12.
|
Hu, Z., and J. Lutkenhaus.
1999.
Topological regulation of cell division in Escherichia coli involves rapid pole to pole oscillation of the division inhibitor MinC under the control of MinD and MinE.
Mol. Microbiol.
34:82-90[CrossRef][Medline].
|
| 13.
|
Hu, Z.,
A. Mukherjee,
S. Pichoff, and J. Lutkenhaus.
1999.
The MinC component of the division site selection system in Escherichia coli interacts with FtsZ to prevent polymerization.
Proc. Natl. Acad. Sci. USA
96:14819-14824[Abstract/Free Full Text].
|
| 14.
|
Hwang, D. S., and J. M. Kaguni.
1988.
Purification and characterization of the dnaA46 gene product.
J. Biol. Chem.
263:10625-10632[Abstract/Free Full Text].
|
| 15.
|
Lutkenhaus, J., and S. G. Addinall.
1997.
Bacterial cell division and the Z ring.
Annu. Rev. Biochem.
66:93-116[CrossRef][Medline].
|
| 16.
|
Ma, X.,
D. W. Ehrhardt, and W. Margolin.
1996.
Colocalization of cell division proteins FtsZ and FtsA to cytoskeletal structures in living Escherichia coli cells by using green fluorescent protein.
Proc. Natl. Acad. Sci. USA
93:12998-13003[Abstract/Free Full Text].
|
| 17.
|
Ma, X.,
Q. Sun,
R. Wang,
G. Singh,
E. L. Jonietz, and W. Margolin.
1997.
Interactions between heterologous FtsA and FtsZ proteins at the FtsZ ring.
J. Bacteriol.
179:6788-6797[Abstract/Free Full Text].
|
| 18.
|
Margolin, W.
2000.
Themes and variations in prokaryotic cell division.
FEMS Microbiol. Rev.
24:531-548[CrossRef][Medline].
|
| 19.
|
Margolin, W., and S. R. Long.
1994.
Rhizobium meliloti contains a novel second copy of the cell division gene ftsZ.
J. Bacteriol.
176:2033-2043[Abstract/Free Full Text].
|
| 20.
|
Messer, W., and C. Weigel.
1996.
Initiation of chromosome replication, p. 1579-1601.
In
F. C. Neidhardt, et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 2. ASM Press, Washington, D.C.
|
| 21.
|
Mulder, E., and C. L. Woldringh.
1989.
Actively replicating nucleoids influence positioning of division sites in Escherichia coli filaments forming cells lacking DNA.
J. Bacteriol.
171:4303-4314[Abstract/Free Full Text].
|
| 22.
|
Niki, H.,
A. Jaffe,
R. Imamura,
T. Ogura, and S. Hiraga.
1991.
The new gene mukB codes for a 177 kd protein with coiled-coil domains involved in chromosome partitioning of E. coli.
EMBO J.
10:183-193[Medline].
|
| 23.
|
Niki, H.,
Y. Yamaichi, and S. Hiraga.
2000.
Dynamic organization of chromosomal DNA in Escherichia coli.
Genes Dev.
14:212-223[Abstract/Free Full Text].
|
| 24.
|
Onogi, T.,
H. Niki,
M. Yamazoe, and S. Hiraga.
1999.
The assembly and migration of SeqA-Gfp fusion in living cells of Escherichia coli.
Mol. Microbiol.
31:1775-1782[CrossRef][Medline].
|
| 25.
|
Pringle, J. R.,
A. E. M. Adams,
D. G. Drubin, and B. K. Haarer.
1991.
Immunofluorescence methods for yeast.
Methods Enzymol.
194:565-602[Medline].
|
| 26.
|
Raskin, D. M., and P. A. de Boer.
1999.
MinDE-dependent pole-to-pole oscillation of division inhibitor MinC in Escherichia coli.
J. Bacteriol.
181:6419-6424[Abstract/Free Full Text].
|
| 27.
|
Raskin, D. M., and P. A. de Boer.
1997.
The MinE ring: an FtsZ-independent cell structure required for selection of the correct division site in E. coli.
Cell
91:685-694[CrossRef][Medline].
|
| 28.
|
Raskin, D. M., and P. A. de Boer.
1999.
Rapid pole-to-pole oscillation of a protein required for directing division to the middle of Escherichia coli.
Proc. Natl. Acad. Sci. USA
96:4971-4976[Abstract/Free Full Text].
|
| 29.
|
Rothfield, L.,
S. Justice, and J. Garcia-Lara.
1999.
Bacterial cell division.
Annu. Rev. Genet.
33:423-448[CrossRef][Medline].
|
| 30.
|
Sawitzke, J. A., and S. Austin.
2000.
Suppression of chromosome segregation defects of Escherichia coli muk mutants by mutations in topoisomerase I.
Proc. Natl. Acad. Sci. USA
97:1671-1676[Abstract/Free Full Text].
|
| 31.
|
Steiner, W.,
G. Liu,
W. D. Donachie, and P. Kuempel.
1999.
The cytoplasmic domain of FtsK protein is required for resolution of chromosome dimers.
Mol. Microbiol.
31:579-583[CrossRef][Medline].
|
| 32.
|
Sullivan, S. M., and J. R. Maddock.
2000.
Bacterial division: finding the dividing line.
Curr. Biol.
10:249-252.
|
| 33.
|
Sun, Q.,
X.-C. Yu, and W. Margolin.
1998.
Assembly of the FtsZ ring at the central division site in the absence of the chromosome.
Mol. Microbiol.
29:491-504[CrossRef][Medline].
|
| 34.
|
Tsui, H. C.,
G. Feng, and M. E. Winkler.
1997.
Negative regulation of mutS and mutH repair gene expression by the Hfq and RpoS global regulators of Escherichia coli K-12.
J. Bacteriol.
179:7476-7487[Abstract/Free Full Text].
|
| 35.
|
Ward, D., and A. Newton.
1997.
Requirement of topoisomerase IV parC and parE genes for cell cycle progression and developmental regulation in Caulobacter crescentus.
Mol. Microbiol.
26:897-910[CrossRef][Medline].
|
| 36.
|
Wechsler, J., and J. Gross.
1971.
Escherichia coli mutants temperature-sensitive for DNA synthesis.
Mol. Gen. Genet.
113:273-84[CrossRef][Medline].
|
| 37.
|
Woldringh, C. L.,
E. Mulder,
P. G. Huls, and N. Vischer.
1991.
Toporegulation of bacterial division according to the nucleoid occlusion model.
Res. Microbiol.
142:309-20[Medline].
|
| 38.
|
Woldringh, C. L.,
E. Mulder,
J. A. Valkenburg,
F. B. Wientjes,
A. Zaritsky, and N. Nanninga.
1990.
Role of the nucleoid in the toporegulation of division.
Res. Microbiol.
141:39-49[Medline].
|
| 39.
|
Yu, X.-C., and W. Margolin.
1999.
FtsZ ring clusters in min and partition mutants: role of both the Min system and the nucleoid in regulating FtsZ ring localization.
Mol. Microbiol.
32:315-326[CrossRef][Medline].
|
| 40.
|
Zeilstra-Ryalls, J.,
O. Fayet, and C. Georgopoulos.
1996.
In vivo protein folding: suppressor analysis of mutations in the groES cochaperone gene of Escherichia coli.
FASEB J.
10:148-152[Abstract].
|
Journal of Bacteriology, February 2001, p. 1413-1422, Vol. 183, No. 4
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1413-1422.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lan, G., Daniels, B. R., Dobrowsky, T. M., Wirtz, D., Sun, S. X.
(2009). Condensation of FtsZ filaments can drive bacterial cell division. Proc. Natl. Acad. Sci. USA
106: 121-126
[Abstract]
[Full Text]
-
Shiomi, D., Margolin, W.
(2007). The C-Terminal Domain of MinC Inhibits Assembly of the Z Ring in Escherichia coli. J. Bacteriol.
189: 236-243
[Abstract]
[Full Text]
-
Wang, X., Possoz, C., Sherratt, D. J.
(2005). Dancing around the divisome: asymmetric chromosome segregation in Escherichia coli. Genes Dev.
19: 2367-2377
[Abstract]
[Full Text]
-
Grantcharova, N., Lustig, U., Flardh, K.
(2005). Dynamics of FtsZ Assembly during Sporulation in Streptomyces coelicolor A3(2). J. Bacteriol.
187: 3227-3237
[Abstract]
[Full Text]
-
Cho, H. S., Lee, S. S., Kim, K. D., Hwang, I., Lim, J.-S., Park, Y.-I., Pai, H.-S.
(2004). DNA Gyrase Is Involved in Chloroplast Nucleoid Partitioning. Plant Cell
16: 2665-2682
[Abstract]
[Full Text]
-
Anderson, D. E., Gueiros-Filho, F. J., Erickson, H. P.
(2004). Assembly Dynamics of FtsZ Rings in Bacillus subtilis and Escherichia coli and Effects of FtsZ-Regulating Proteins. J. Bacteriol.
186: 5775-5781
[Abstract]
[Full Text]
-
Sun, Q., Margolin, W.
(2004). Effects of Perturbing Nucleoid Structure on Nucleoid Occlusion-Mediated Toporegulation of FtsZ Ring Assembly. J. Bacteriol.
186: 3951-3959
[Abstract]
[Full Text]
-
Ferguson, P. L., Shaw, G. S.
(2004). Human S100B Protein Interacts with the Escherichia coli Division Protein FtsZ in a Calcium-sensitive Manner. J. Biol. Chem.
279: 18806-18813
[Abstract]
[Full Text]
-
Wells, W. A., LeBrasseur, N.
(2004). Cells on Parade: The American Society for Cell Biology San Francisco, CA December 13-17, 2003. JCB
164: 480-486
[Full Text]
-
Janakiraman, A., Goldberg, M. B.
(2004). From the Cover: Evidence for polar positional information independent of cell division and nucleoid occlusion. Proc. Natl. Acad. Sci. USA
101: 835-840
[Abstract]
[Full Text]
-
Manasherob, R., Zaritsky, A., Metzler, Y., Ben-Dov, E., Itsko, M., Fishov, I.
(2003). Compaction of the Escherichia coli nucleoid caused by Cyt1Aa. Microbiology
149: 3553-3564
[Abstract]
[Full Text]
-
Weart, R. B., Levin, P. A.
(2003). Growth Rate-Dependent Regulation of Medial FtsZ Ring Formation. J. Bacteriol.
185: 2826-2834
[Abstract]
[Full Text]
-
Geissler, B., Elraheb, D., Margolin, W.
(2003). A gain-of-function mutation in ftsA bypasses the requirement for the essential cell division gene zipA in Escherichia coli. Proc. Natl. Acad. Sci. USA
100: 4197-4202
[Abstract]
[Full Text]
-
Lackner, L. L., Raskin, D. M., de Boer, P. A. J.
(2003). ATP-Dependent Interactions between Escherichia coli Min Proteins and the Phospholipid Membrane In Vitro. J. Bacteriol.
185: 735-749
[Abstract]
[Full Text]
-
Greendyke, R., Rajagopalan, M., Parish, T., Madiraju, M. V. V. S.
(2002). Conditional expression of Mycobacterium smegmatis dnaA, an essential DNA replication gene. Microbiology
148: 3887-3900
[Abstract]
[Full Text]
-
Nanninga, N.
(2001). Cytokinesis in Prokaryotes and Eukaryotes: Common Principles and Different Solutions. Microbiol. Mol. Biol. Rev.
65: 319-333
[Abstract]
[Full Text]