Previous Article | Next Article 
Journal of Bacteriology, February 2001, p. 1434-1440, Vol. 183, No. 4
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1434-1440.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Multiple Catalase Genes Are Differentially
Regulated in Aspergillus nidulans
Laura
Kawasaki and
Jesús
Aguirre*
Departamento de Genética Molecular,
Instituto de Fisiología Celular, Universidad Nacional
Autónoma de México, 04510 México, D. F., Mexico
Received 4 August 2000/Accepted 21 November 2000
 |
ABSTRACT |
Detoxification of hydrogen peroxide is a fundamental aspect of the
cellular antioxidant responses in which catalases play a major role.
Two differentially regulated catalase genes, catA and
catB, have been studied in Aspergillus
nidulans. Here we have characterized a third catalase gene,
designated catC, which predicts a 475-amino-acid
polypeptide containing a peroxisome-targeting signal. With a molecular
mass of 54 kDa, CatC shows high similarity to other small-subunit
monofunctional catalases and is most closely related to catalases from
other fungi, Archaea, and animals. In contrast, the CatA
(~84 kDa) and CatB (~79 kDa) enzymes belong to a family of
large-subunit catalases, constituting a unique fungal and bacterial
group. The catC gene displayed a relatively constant
pattern of expression, not being induced by oxidative or other types of
stress. Targeted disruption of catC eliminated a
constitutive catalase activity not detected previously in zymogram gels. However, a catalase activity detected in catA catB
mutant strains during late stationary phase was still present in
catC and catABC null mutants, thus
demonstrating the presence of a fourth catalase, here named catalase D
(CatD). Neither catC nor catABC triple
mutants showed any developmental defect, and both mutants grew as well
as wild-type strains in H2O2-generating
substrates, such as fatty acids, and/or purines as the sole carbon and
nitrogen sources, respectively. CatD activity was induced during late
stationary phase by glucose starvation, high temperature, and, to
a lesser extent, H2O2 treatment. The existence
of at least four differentially regulated catalases indicates a
large and regulated capability for H2O2
detoxification in filamentous fungi.
| |
INTRODUCTION |
Several studies indicate that
reactive oxygen species play crucial roles in various aspects of cell
physiology, such as cellular defense (45), life span
(38), stress signaling (22), development (19), apoptosis (30), and pathology
(33). The hydrogen peroxide formed during aerobic
metabolism is capable of generating other reactive oxygen species,
which can damage many cellular components (18). Catalases
and peroxidases are the most important enzymatic systems used to
degrade H2O2. There are
three separate families of catalases: Mn-catalases, bifunctional
catalase-peroxidases, and monofunctional, or "true," catalases. The
last group is the one best characterized and corresponds to
homotetrameric heme-containing enzymes present in eubacteria and
eukaryotes and recently also found in the Archaea
(34). Within this family of catalases, two clearly
distinct classes can be recognized: the small-subunit (50- to 65-kDa)
and the large-subunit (~80-kDa) enzymes. The first class includes a
large number of catalases from bacteria, plants, fungi, and animals. An
increasing number of catalases of the second class have been identified
in bacteria and filamentous fungi (5, 8, 13, 15, 23-25, 27,
37) but not in higher eukaryotes.
The core sequence of the true catalases is composed of 360 to 390 amino
acid residues (24, 48), while the large-subunit enzymes
typically have ~70 and ~150 additional residues at the N and C
termini, respectively. These terminal sequences seem to confer
increased stability on the enzymes (6, 24).
Our studies focused on the antioxidant response in eukaryotes and its
possible connections to cellular development (19), through
the detailed analysis of catalase gene regulation in Aspergillus nidulans. Well-characterized sexual and asexual development
processes in this filamentous fungus are amenable to genetic analysis
(1, 40). In A. nidulans the catalase genes
catA and catB have been characterized, both
encoding large-subunit (~84- and ~79-kDa, respectively) true
catalases (23, 27). The catA and
catB genes are evolutionarily divergent, as judged from the
relatively low similarity among the encoded polypeptides (40%
identity) and the different exon structures (23). The
catA mRNA accumulates during sporulation as well as in
response to multiple types of stress, and its translation is connected
to asexual and sexual spore formation, resulting in the high levels of
catalase A activity in spores. This regulation is mediated by the
catA 5' untranslated mRNA region (26). In
contrast, the catB gene is induced and translated in growing
and developing hyphae and in response to oxidative and other types of
stress. Both catalases provide protection against H2O2 at different stages of
the A. nidulans life cycle, and CatA, and to a lesser extent
CatB, protects germlings from heat shock (23, 27, 28).
Here, we present the characterization of a third catalase gene, the
catC gene, and present evidence for the existence of a
fourth catalase (CatD) in A. nidulans. Unlike
catA and catB, catC encodes a
small-subunit catalase with a peroxisomal targeting sequence which is
closely related to catalases from other fungi, animals, and
Archaea. The catC gene is not essential for fatty
acid and/or purine utilization, and its expression is constitutive,
overlapping in time with the expression of the other catalase genes. On
the other hand, the CatD activity was induced under a narrow set of
conditions, such as the late stationary phase, glucose starvation, high
temperature, and H2O2 treatment.
| |
MATERIALS AND METHODS |
Strains, media, transformation, and growth conditions.
The
A. nidulans strains used in this work are shown in Table
1. All strains were grown in supplemented
minimal-nitrate or minimal-ammonium (20 mM ammonium tartrate) medium
(21). When carbon sources other than glucose were used,
the concentrations were 100 mM (50 mM in solid medium) sodium acetate,
0.5% Tween 80, 200 mM ethanol, 200 mM methanol, 1% glycerol, and 6 mM
oleate in 1% Tergitol NP-10. Nitrogen sources other than nitrate or
ammonium were 2.2 mM adenine or 0.8 mg of uric acid/ml. Developmental
cultures were induced as previously described (2). To
disrupt the catC gene, strain RMS011 was transformed with
plasmid pLK20 by using standard techniques (46).
Catalase induction by different types of stress.
Wild-type
strain FGSC26 was used to study catC gene expression under
different conditions. Liquid cultures were inoculated with 5 × 105 spores/ml and grown for 12 h (nitrate as
the nitrogen source) or 14 h (ammonium as the nitrogen source) at
37°C and 300 rpm. Then mycelia were incubated under different
conditions or filtered through Miracloth and transferred to different
media. Stress conditions were heat shock (42°C), 5 mM paraquat, 0.5 mM H2O2 (added every 30 min), 1 M sorbitol, and 1 M NaCl. Cultures were incubated under these
conditions for 2 to 6 h. Mycelia were harvested and frozen in
liquid nitrogen. Total RNA was extracted using Trizol (Gibco-BRL) and
Northern blotting analysis was performed using standard techniques using catC as a probe.
Cloning of catC, sequencing, and plasmid
construction.
Oligonucleotides catC1
(5'CTAGGTACCGAGCGAGTGGTCCATGCC3') and catC2
(5'AGTAGATCTCGGGATTCTCGTCAAGG3') were designed based upon a
1,085-bp A. nidulans genomic sequence (contig ANIC10430),
predicting a catalase fragment different from CatA and CatB, provided
by Cereon Genomics, LLC. These primers were used to amplify by PCR a
770-bp DNA fragment, using total A. nidulans DNA as the
template. This PCR product was cloned into PCRII (pLK12) vector
(Invitrogen) and subsequently used to probe an A. nidulans
chromosome-specific cosmid library (4). Eight cosmids
belonging to chromosome I were identified: L9E07, L28G03, W6C12, W9009,
W10009, W11609, W17G01, and W28001. Restriction analysis of cosmids
W6C12, W9009, W28001, and W17G01 indicated that they represent the same
chromosomal region. Cosmid W17G01 was used as a template to fully
sequence both DNA strands of the catC gene, by automatic
fluorescent sequencing in an ABI PRISM 310 from Perkin-Elmer. After DNA
sequencing was completed, primers catC8
(5'TTCCTCAATGCTTAGTGC3') and catC9
(5'TCCCGGGAACTTTAAGGCATGTTAG3') were used to amplify by PCR
a 2,200-bp fragment containing the complete catC gene, using
cosmid W17G01 as the template. This 2,200-bp fragment was cloned into
PCRII to originate plasmid pLK17. The catC
KpnI-NotI fragment from pLK17 was ligated into
pBluescript II KS(+) (Stratagene) to generate plasmid pLK19. pLK19 was
digested with XhoI and HincII and ligated to the
argB XhoI-SmaI fragment from plasmid pDC1 to
generate pLK20, which was used to transform strain RMS011.
Hybridization analyses and nucleic acid isolation.
Genomic
DNA was isolated as reported previously (39). Total RNA
was isolated with the Trizol reagent (Gibco-BRL), fractionated in
formaldehyde-agarose gels, transferred to Hybond-N nylon membranes (Amersham), and hybridized by using standard techniques. The
EcoRI fragment from pLK17 was used as a
catC-specific probe, and the BamHI-NruI fragment from pDC1 was used as an
argB-specific probe. Both were labeled with
32P using the BRL random priming labeling kit.
Transformants containing the desired catC disruption were
identified by Southern blotting, using first the catC
XhoI-HincII internal fragment from pLK19 and then the
entire catC EcoRI fragment from pLK17 as probes.
Catalase activity determination.
Mycelial samples from 50-ml
cultures were filtered through Whatman paper, dried by passing ~200
ml of cold acetone through the mycelia, and stored at 
75°C until
used. Acetone-dried mycelia were ground with mortar and pestle by using
dry ice, until a fine powder was obtained. Ground mycelia were used to
prepare protein extracts, which were used to determine catalase
activity in zymograms (23) or by O2
evolution, using an oxygen electrode (11).
Nucleotide sequence accession number.
The sequence obtained
for catC has been deposited in GenBank under accession
number AF316033.
| |
RESULTS |
Cloning and characterization of the catC
gene.
Using catalase activity zymograms, we detected the presence
of a third catalase activity in mycelial samples obtained from several
catA catB null mutants grown for 48 h. This novel
activity, which was later named CatD (see below), migrated slightly
faster than CatB and was not present in asexual spores (Fig.
1). This result led us to contact Cereon
Genomics, LLC (Cambridge, Mass.), for possible catalase gene sequences,
different from catA and catB, present in their
A. nidulans genomic sequence database. We used a 1,085-bp
sequence identified in the database to design primers to amplify a
770-bp DNA fragment, using A. nidulans genomic DNA as the
template. The cloned PCR product was confirmed by sequencing and used
to probe a chromosome-specific library (4), which identified eight cosmid clones from chromosome I. Restriction analysis
of four of these cosmids indicated that they represent the same
chromosomal region. Using one of the cosmid clones, W17G01, the region
of interest was sequenced in both strands. The resulting genomic
sequence contains an uninterrupted open reading frame encoding a
475-amino-acid polypeptide. Because the predicted amino acid sequence
showed high similarity to known catalases, this newly identified gene
and its protein product were named catC and CatC,
respectively.
View larger version (87K):
[in this window]
[in a new window]
|
FIG. 1.
A catalase activity is detected in zymogram analysis of
mutants carrying different deletions in the catA and
catB genes. Protein extracts (55 µg) obtained from
mycelia grown for 48 h in minimal-nitrate liquid media were
fractionated in a native polyacrylamide gel and stained for catalase
activity. Catalase activity from isolated conidia (strain RMS011) is
shown as a reference.
|
|
catC encodes a small-subunit monofunctional catalase
with a putative peroxisomal targeting signal.
The catC
gene predicts a protein with a molecular mass of 54,128 Da. CatC is
highly similar to catalase P from the fungal human pathogen
Ajellomyces (Histoplasma) capsulatus
(84% identity), Ctt1 from Schizosaccharomyces pombe (61%
identity), CAT1 (43) from Candida albicans
(61% identity), and the peroxisomal catalase Cta1p from
Saccharomyces cerevisiae (58% identity). CatC also shows
high similarity to CatA (14) from the slime mold
Dictyostelium discoideum (52% identity) and catalases from
the strict anaerobic methanogenic archaeon Methanosarcina
barkeri (52% identity) and animals (data not shown). All of these
enzymes belong to the family of small-subunit (50- to 65-kDa)
monofunctional catalases. As shown in Fig.
2, amino acid sequences that form part of
the active and heme coordination sites are conserved in CatC and these
enzymes.
View larger version (78K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of A. nidulans CatC with the
most similar catalases. CatC was aligned with catalases from
Ajellomyces capsulatus (GenBank accession number
AF189369), Schizosaccharomyces pombe (47),
Saccharomyces cerevisiae (10), D.
discoideum (14), and M. barkeri
(34). Conserved amino acids that form part of the active
(*) and heme coordination (|) sites are indicated. The alignment was
performed using the programs PILEUP and PRETTY (12).
|
|
The CatC carboxy terminus contains the tripeptide ARL, which fits the
consensus ([S/C/A][K/R/H]L) peroxisomal targeting signal
type I. This signal has been shown to be both necessary and sufficient
to
direct proteins to peroxisomes (
17,
20). It is present
in
other enzymes from filamentous fungi that very likely are peroxisomal,
such as monoamino oxidase (ARL) and urate oxidase (AKL) (
29,
32).
catC expression is constant under different
conditions.
We have reported that the catA and
catB genes are differentially regulated during the A. nidulans life cycle as well as in response to different types of
stress (23, 26, 27). With argB mRNA and rRNA
staining (not shown) as loading controls, we examined the expression of
catC by Northern blot analysis, using RNA samples from the
wild-type strain FGSC26 grown under different conditions. As shown in
Fig. 3A, the catC mRNA was
detected in young hyphae as early as 12 h of growth, and its level
was relatively constant up to 48 h of growth. This result
suggested either that catC did not encode the catalase
activity that appears after 48 h of growth (Fig. 1) or that it was
subject to some type of posttranscriptional control. During asexual
development, the catC message level showed little change up
to 6 h, increased slightly by 12 h, and declined thereafter
(Fig. 3B), to become barely detectable in isolated conidia (not shown).
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
catC expression during growth, asexual
development, and stress. Total RNA extracted from wild-type strain
FGSC26 mycelia, subject to the indicated conditions, was fractionated
in a formaldehyde-agarose gel and used for Northern blot analyses. (A)
Regulation during growth and stationary phase. RNA samples were from
mycelia harvested at 12, 24, and 48 h of growth in liquid
minimal-nitrate medium. (B) Expression during asexual development. RNA
samples obtained from mycelia grown for 18 h in liquid minimal
nitrate medium (0 h) and from mycelia induced to conidiate for the
indicated time. (C) catC expression under different
nutritional and stress conditions. Strain FGSC26 was grown in liquid
minimal-ammonium medium for 14 h and then incubated at 42°C (HS)
or in the presence of 5 mM paraquat or 0.5 mM
H2O2 for 4 h. In the case of 1 M sorbitol,
0.1% glucose, 0.5% Tween 80, and 200 mM ethanol, the 14-h-grown
mycelia were filtered, washed, and transferred to the indicated media
for 4 h (sorbitol and glucose) or 6 h. Glucose (0.1%
), Tween 80, and ethanol were used as the sole carbon sources.
The EcoRI catC fragment from pLK12 was
used as the probe. The same blots probed with argB are
shown as RNA loading controls.
|
|
The
catC mRNA level was virtually unaffected by several
stress and nutritional conditions, including oxidative stress, osmotic
stress, and growth for 6 h in Tween 80 or ethanol as the sole
carbon source (Fig.
3C). A slight induction was noticeable only
during
heat shock (Fig.
3C) and growth in uric acid as the sole
nitrogen
source (not
shown).
Targeted disruption of catC revealed the existence
of an unidentified catalase gene.
To determine if catC
encoded a catalase different from the one previously detected in
catA catB double null mutants (Fig. 1), we designed plasmid
pLK20 to perform a targeted disruption of catC. In pLK20 a
central region of 740 bp from the catC gene was replaced by
the argB gene as a selectable marker. This resulted in the
deletion of amino acid residues 94 to 341 from CatC. Linear pLK20 was
used to transform strain RMS011 to arginine independence. Forty-one
Arg+ transformants were analyzed by Southern
blotting using the catC internal
XhoI-HincII fragment deleted in pLK20. Among
these, 12 transformants gave no hybridization signal, indicating
deletion of the corresponding catC fragment. Genomic DNA
from three of these catC mutants was digested with
BamHI, EcoRI, and SalI and analyzed by
Southern blotting using the entire catC gene as the probe.
All three transformants gave hybridization patterns identical to the
one shown in Fig. 4B for strain TLK61.
This pattern is consistent with the double recombination event and
consequent disruption of the catC gene, depicted in Fig. 4A.
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
catC gene targeted disruption. (A)
Plasmid pLK20 was constructed by replacing a central region of 740 bp
from the catC gene with the argB gene,
used as a selectable marker. The CatC region removed corresponds to
amino acids 94 to 341 (Fig. 2). Linear pLK20 was used to transform
strain RMS011 to arginine independence. Restriction sites: B,
BamHI; E, EcoRI; S, SalI.
(B) Total DNA extracted from recipient strain RMS011 and the
 catC strain TLK61 was digested with indicated
restriction enzymes and used for Southern blot analysis. The probe used
was the EcoRI catC fragment from pLK17.
The same membrane probed with argB (not shown) gave a
hybridization pattern fully consistent with the illustrated integration
event. MW, molecular weight (weights are in thousands); WT, wild
type.
|
|
To analyze zymogram catalase activity patterns in a more conclusive
way, we created triple
catABC mutant strains (Table
1).
Both
catA catB (strain CLK20) and
catA catB catC
(strain CLK36)
mutants were grown for 12, 24, and 48 h, and
corresponding protein
extracts were used to detect catalase activity in
zymograms. As
shown in Fig.
5, the
catalase activity detected previously in
48-h samples from the
catAB double mutants (Fig.
1) was unaffected
by the deletion
of the
catC gene, demonstrating that this catalase,
which we
have designated CatD, is encoded by an as-yet-unidentified
gene.
View larger version (98K):
[in this window]
[in a new window]
|
FIG. 5.
A. nidulans contains at least four
different catalases. Protein extracts (40 µg) prepared from strains
CLK20 (catA
catB) and CLK36
(catA catB
catC) grown for 12, 24 and 48 h were
fractionated in a native polyacrylamide gel that was stained to detect
catalase activity. A protein sample from isolated conidia (strain
FGSC26) is shown as a catalase A and B reference. Numbers below the
zymogram are catalase-specific activities (in units per milligram of
protein per milliliter) in each sample, measured by O2
evolution (11). Data are the averages of two
determinations, with a maximum variation of 13% with respect to the
average.
|
|
Samples from the
catA catB double mutant showed a catalase
activity smear at the gel wells and a more defined band right below
the
concentrator gel. These activities were totally absent in
samples from
the
catABC triple mutant (Fig.
5), indicating that
the
catC-encoded catalase was not detected in our previous
zymogram
gel system. This was supported when catalase-specific activity
was assayed by O
2 evolution in the samples used
for the zymogram.
As shown at the bottom of Fig.
5, ~250 U of
catalase activity
was detected in samples from strain CLK20 grown for
12 h, which
remained constant at 24 h of growth. In contrast,
catalase activity
was negligible in 12- and 24-h samples from strain
CLK36. The
48-h sample of CLK36 contained 92 U of catalase activity,
which
would correspond to the catalase D activity detected in the
zymogram.
A slight decrease in CatC activity in the CLK20 48-h sample
may
explain why the total catalase-specific activity remained around
250 U, despite the contribution of CatD activity. These results
confirm
that
catC encodes a novel catalase activity that remains
relatively unchanged during 12 to 48 h of growth. This pattern
of
CatC activity is consistent with the
catC mRNA levels
detected
during the same period of growth (Fig.
3A).
Catalase C activity is not required for asexual or sexual
development or for fatty acid and/or purine utilization.
We
observed no obvious defect during asexual development of A. nidulans catC mutants. However, Berteaux-Lecellier et al.
(3) reported that peroxisomal function is necessary for
caryogamy and sexual development in Podospora anserina. We
found that wild-type strain FGSC26 and catAB (CLK20),
catB (TLK12), catC (TLK61), and catABC
(CLK35) null mutant strains were all able to differentiate sexual
fruiting bodies (cleistothecia) in similar amounts and produced viable
sexual spores.
A. nidulans can utilize oleate as the sole carbon source and
purines as the sole nitrogen source. The degradation of these
compounds
appears to occur in peroxisomes and involve
H
2O
2 generation
(
31,
42). We tested the growth response of CLK20, TLK12, TLK61,
and
CLK35 mutant strains in media containing different carbon
and/or
nitrogen sources (see Material and Methods). In particular,
we tested
oleate and Tween 80 as the sole carbon sources, adenine
and uric acid
as the sole nitrogen sources, and combinations of
both carbon and
nitrogen sources. All four catalase mutants grew
as well as the
wild-type strain in all tested media, indicating
that CatC function is
dispensable for growth in these
substrates.
Catalase D is induced during late stationary phase, by glucose
starvation, and heat shock.
We used catA catB double
mutants to examine CatD activity under different conditions. As shown
in Fig. 5 and 6, CatD activity was not
detectable before 48 h of growth. After 48 h, a slight increase was observed by 72 h (data not shown). Under our growing conditions, glucose in the medium becomes exhausted by 36 h
(35). Therefore, 48 to 72 h of growth corresponds to
a very late stationary phase under severe nutrient starvation. To
analyze CatD activity under different growth and stress conditions,
strain CLK20 was grown for 24 h, and then mycelia were shifted to
different media for 10 to 12 h. Alternatively, 24-h mycelia were
exposed for 10 h to osmotic stress, high temperature, or the
oxidative stress caused by paraquat and
H2O2 treatments. Figure 6
shows that glucose starvation and incubation at 42°C resulted in a
clear induction of CatD activity, while
H2O2 produced a modest
induction. All other treatments, including nitrate starvation, failed
to induce CatD.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 6.
Catalase D is induced during late stationary phase, by
glucose starvation, heat shock, and H2O2.
Strain CLK20 (catA
catB) was grown in minimal-nitrate medium
for 24, 34, and 48 h. Mycelia grown for 24 h were incubated
at 42°C, in the presence of 1 M sorbitol, 5 mM paraquat, or 0.5 mM
H2O2 for 10 h. Where indicated, 24-h
mycelia were shifted for 10 to 12 h to fresh media containing or
lacking glucose, lacking nitrate, or containing 0.5% Tween 80 or 0.8 mg of uric acid/ml as the sole carbon and nitrogen sources,
respectively. A total of 100 µg of protein was loaded in each lane.
|
|
| |
DISCUSSION |
The catC gene encodes a small-subunit monofunctional
catalase, likely localized in peroxisomes.
Here we have shown that
A. nidulans catC encodes a catalase more related to
small-subunit catalases from other fungi, a slime mold,
Archaea, and animals than to catalases from eubacteria and plants. In contrast, CatA and CatB, along with other enzymes up to now
found only in filamentous fungi and eubacteria, form the large-subunit
catalase family (5, 8, 13, 15, 23, 24, 27, 37, 48). In
fact, endosymbiosis and horizontal gene transfer mechanisms have been
invoked to explain the grouping of these fungal and bacterial catalases
(24). It seems clear that catC and
catAB genes have different evolutionary origins, as judged
from their sequence and size disparity and the catC lack of introns.
The
catC gene was expressed at relatively constant levels
under several growth, stress, and nutritional conditions, the most
noticeable change being a gradual decrease during conidiation.
This
constitutive expression correlates well with the CatC activity
detected
during 12 to 48 h of growth (Fig.
5). CatC activity was
not
detected previously due to its extremely low migration rate
in our
zymogram gel system. This can be explained by the high
isoelectric
point (8.69) predicted for CatC, perhaps the most
basic reported for a
catalase, with our starting electrophoresis
conditions at pH 8.5. A
slight change in pH during electrophoresis
may account for the CatC
activity that enters the zymogram gel.
Our attempt to resolve and/or
detect CatC using electrofocusing
gels was unsuccessful, while CatA and
CatB were well separated
and detected under the same conditions. This
result could be explained
by a higher stability of CatA and CatB than
of the smaller CatC
enzyme. In fact, CatB has been found to be
resistant to 9 M urea,
2% sodium dodecyl sulfate, and
ethanol-chloroform treatment (
6).
Several lines of evidence suggest that CatC may be a peroxisomal
enzyme. First, it contains the peroxisome-targeting signal
ARL. Second,
our preliminary cell fractionation experiments using
cell extracts from
catA catB double mutant grown for 18 h showed
that at
least 20% of the total CatC activity is contained within
the
subcellular particle pellet, along with high activity levels
of the
peroxisomal marker isocitrate lyase (
41) and the
mitochondrial
marker fumarase. Third, a catalase activity has been
cytochemically
localized in microbodies from young growing hyphae, and
cosedimentation
of catalase activity and peroxisome marker enzymes has
also been
shown in
A. nidulans (
42). It is
unlikely that the reported
peroxisome-associated catalase
(
42) corresponds to CatA, CatB,
or CatD. CatA and CatB do
not contain peroxisome-targeting signals
(
23,
27). CatA
activity is largely associated with spores
(
26) and has
been immunolocalized in the asexual spore cell
wall and cytosol
(R. E. Navarro and J. Aguirre, unpublished data),
whereas CatB has
been immunolocalized in the cell wall and cytosol
from hyphae (L. Kawasaki and J. Aguirre, unpublished data). CatD
has been shown here to
be present in old and high-temperature-grown
hyphae.
Multiple catalases and other H2O2
detoxification enzymes in A. nidulans.
Although
there is some overlap, CatA and CatB are present at different stages of
the A. nidulans life cycle and protect different cell types
from H2O2 or other types of
oxidative stress (23, 26, 27) and heat shock stress
(28). The fact that the catC gene is expressed
at relatively constant levels suggests that CatC activity overlaps CatA
or CatB activity. However, confirmation of a peroxisomal location for
CatC would argue against such functional overlap or redundancy. CatD
seems repressed by glucose and is induced during late stationary phase,
showing a partial overlap with CatB expression. No other catalase genes
besides catA, -B, and -C were found in
the A. nidulans genome database, suggesting that the
database is not complete or that CatD does not belong to the
monofunctional catalase family.
The fact that CatC is dispensable for growth in oleic acid as the sole
carbon source and/or in purines as the sole nitrogen
sources suggests
the presence of alternative peroxisomal
H
2O
2 detoxification
systems. A search of an
A. nidulans cDNA partial
sequence
database (
http://www.genome.ou.edu/fungal.html) for
genes
encoding enzymes involved in
H
2O
2 detoxification
identified two
genes in addition to
catA and
catB. Clone r2g02a1 predicts a protein
with high similarity
to fungal and mammalian PMP20 peroxisomal
peroxidases (
9,
16,
44). Clone c7g02a1 predicts a protein
with high similarity to
glutathione peroxidases. The existence
of two putative thiol-dependent
peroxidases and at least four
catalases suggests a large and regulated
capability for H
2O
2
degradation
in filamentous
fungi.
| |
ACKNOWLEDGMENTS |
This work was supported by grants IN206097 and IN214199, both
from DGAPA-UNAM (PAPIIT).
We are grateful to Thomas Adams and Vicky Gavrias from Cereon Genomics,
LLC, for the catC fragment DNA sequence. We thank Fabiola Méndez for experimental support and the IFICE-UNAM
Molecular Biology Unit for DNA sequencing and oligonucleotide
synthesis. We are indebted to Wilhelm Hansberg for helpful discussions
and Kazuhiro Shiozaki for critical reading of the manuscript.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Departamento de
Genética Molecular, Instituto de Fisiología Celular,
Universidad Nacional Autónoma de México, Apartado Postal
70-242, 04510 México, D. F., Mexico. Phone: (525) 622-5651. Fax: (525) 622-5630. E-mail: jaguirre{at}ifisiol.unam.mx.
| |
REFERENCES |
| 1.
|
Adams, T. H.,
J. K. Wieser, and J. H. Yu.
1998.
Asexual sporulation in Aspergillus nidulans.
Microbiol. Mol. Biol. Rev.
62:35-54[Abstract/Free Full Text].
|
| 2.
|
Aguirre, J.
1993.
Spatial and temporal controls of the Aspergillus brlA developmental regulatory gene.
Mol. Microbiol.
8:211-218[CrossRef][Medline].
|
| 3.
|
Berteaux-Lecellier, V.,
M. Picard,
C. Thompson-Coffe,
D. Zickler,
A. Panvier-Adoutte, and J. M. Simonet.
1995.
A nonmammalian homolog of the PAF1 gene (Zellweger syndrome) discovered as a gene involved in caryogamy in the fungus Podospora anserina.
Cell
81:1043-1051[CrossRef][Medline].
|
| 4.
|
Brody, H.,
J. Griffith,
A. J. Cuticchia,
J. Arnold, and W. E. Timberlake.
1991.
Chromosome-specific recombinant DNA libraries from the fungus Aspergillus nidulans.
Nucleic Acids Res.
19:3105-3109[Abstract/Free Full Text].
|
| 5.
|
Calera, J. A.,
S. Paris,
M. Monod,
A. J. Hamilton,
J. P. Debeaupuis,
M. Diaquin,
R. Lopez-Medrano,
F. Leal, and J. P. Latge.
1997.
Cloning and disruption of the antigenic catalase gene of Aspergillus fumigatus.
Infect. Immun.
65:4718-4724[Abstract].
|
| 6.
|
Calera, J. A.,
J. Sanchez-Weatherby,
R. Lopez-Medrano, and F. Leal.
2000.
Distinctive properties of the catalase B of Aspergillus nidulans.
FEBS Lett.
475:117-120[CrossRef][Medline].
|
| 7.
|
Chang, Y. C.,
B. H. Segal,
S. M. Holland,
G. F. Miller, and K. J. Kwon-Chung.
1998.
Virulence of catalase-deficient Aspergillus nidulans in p47(phox)/ mice. Implications for fungal pathogenicity and host defense in chronic granulomatous disease.
J. Clin. Investig.
101:1843-1850[Medline].
|
| 8.
|
Cho, Y. H.,
E. J. Lee, and J. H. Roe.
2000.
A developmentally regulated catalase required for proper differentiation and osmoprotection of Streptomyces coelicolor.
Mol. Microbiol.
35:150-160[CrossRef][Medline].
|
| 9.
|
Choi, H. J.,
S. W. Kang,
C. H. Yang,
S. G. Rhee, and S. E. Ryu.
1998.
Crystal structure of a novel human peroxidase enzyme at 2.0 A resolution.
Nat. Struct. Biol.
5:400-406[CrossRef][Medline].
|
| 10.
|
Cohen, G.,
W. Rapatz, and H. Ruis.
1988.
Sequence of the Saccharomyces cerevisiae CTA1 gene and amino acid sequence of catalase A derived from it.
Eur. J. Biochem.
176:159-163[Medline].
|
| 11.
|
del Rio, L. A.,
M. Gomez Ortega,
A. Leal Lopez, and J. Lopez Gorge.
1977.
A more sensitive modification of the catalase assay with the Clark oxygen electrode.
Anal. Biochem.
80:409-415[CrossRef][Medline].
|
| 12.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 13.
|
Fowler, T.,
M. W. Rey,
P. Vaha-Vahe,
S. D. Power, and R. M. Berka.
1993.
The catR gene encoding a catalase from Aspergillus niger: primary structure and elevated expression through increased gene copy number and use of a strong promoter.
Mol. Microbiol.
9:989-998[CrossRef][Medline].
|
| 14.
|
Garcia, X. M.,
C. Foote,
S. van Es,
P. N. Devreotes,
S. Alexander, and H. Alexander.
2000.
Differential developmental expression and cell type specificity of Dictyostelium catalases and their response to oxidative stress and UV-light.
Biochim. Biophys. Acta
1492:295-310[Medline].
|
| 15.
|
Garre, V.,
U. Muller, and P. Tudzynski.
1998.
Cloning, characterization, and targeted disruption of cpcat1, coding for an in planta secreted catalase of Claviceps purpurea.
Mol. Plant-Microbe Interact.
11:772-783[Medline].
|
| 16.
|
Godon, C.,
G. Lagniel,
J. Lee,
J. M. Buhler,
S. Kieffer,
M. Perrot,
H. Boucherie,
M. B. Toledano, and J. Labarre.
1998.
The H2O2 stimulon in Saccharomyces cerevisiae J.
Biol. Chem.
273:22480-22489[Abstract/Free Full Text].
|
| 17.
|
Gould, S. J.,
G. A. Keller,
N. Hosken,
J. Wilkinson, and S. Subramani.
1989.
A conserved tripeptide sorts proteins to peroxisomes.
J. Cell Biol.
108:1657-1664[Abstract/Free Full Text].
|
| 18.
|
Halliwell, B., and J. M. C. Gutteridge.
1989.
Free radicals in biology and medicine, 2nd ed.
Clarendon Press and Oxford University Press, Oxford, United Kingdom.
|
| 19.
|
Hansberg, W., and J. Aguirre.
1990.
Hyperoxidant states cause microbial cell differentiation by cell isolation from dioxygen.
J. Theor. Biol.
142:201-221[CrossRef][Medline].
|
| 20.
|
Hettema, E. H.,
B. Distel, and H. F. Tabak.
1999.
Import of proteins into peroxisomes.
Biochim. Biophys. Acta
1451:17-34[Medline].
|
| 21.
|
Käfer, E.
1977.
Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations.
Adv. Genet.
19:33-131[Medline].
|
| 22.
|
Kamata, H., and H. Hirata.
1999.
Redox regulation of cellular signalling.
Cell. Signal.
11:1-14[CrossRef][Medline].
|
| 23.
|
Kawasaki, L.,
D. Wysong,
R. Diamond, and J. Aguirre.
1997.
Two divergent catalase genes are differentially regulated during Aspergillus nidulans development and oxidative stress.
J. Bacteriol.
179:3284-3292[Abstract/Free Full Text].
|
| 24.
|
Klotz, G. M.,
G. R. Klassen, and P. C. Loewen.
1997.
Phylogenetic relationships among prokaryotic and eukaryotic catalases.
Mol. Biol. Evol.
14:951-958[Abstract].
|
| 25.
|
Lledias, F.,
P. Rangel, and W. Hansberg.
1998.
Oxidation of catalase by singlet oxygen.
J. Biol. Chem.
273:10630-10637[Abstract/Free Full Text].
|
| 26.
|
Navarro, R. E., and J. Aguirre.
1998.
Posttranscriptional control mediates cell type-specific localization of catalase A during Aspergillus nidulans development.
J. Bacteriol.
180:5733-5738[Abstract/Free Full Text].
|
| 27.
|
Navarro, R. E.,
M. A. Stringer,
W. Hansberg,
W. E. Timberlake, and J. Aguirre.
1996.
catA, a new Aspergillus nidulans gene encoding a developmentally regulated catalase.
Curr. Genet.
29:352-359[Medline].
|
| 28.
|
Noventa-Jordao, A. M.,
R. M. Couto,
M. H. Goldman,
J. Aguirre,
S. Iyer,
A. Caplan,
H. F. Terenzi, and G. H. Goldman.
1999.
Catalase activity is necessary for heat-shock recovery in Aspergillus nidulans germlings.
Microbiology
145:3229-3234[Abstract/Free Full Text].
|
| 29.
|
Oestreicher, N., and C. Scazzocchio.
1993.
Sequence, regulation, and mutational analysis of the gene encoding urate oxidase in Aspergillus nidulans.
J. Biol. Chem.
268:23382-23389[Abstract/Free Full Text].
|
| 30.
|
Quillet-Mary, A.,
J. P. Jaffrezou,
V. Mansat,
C. Bordier,
J. Naval, and G. Laurent.
1997.
Implication of mitochondrial hydrogen peroxide generation in ceramide-induced apoptosis.
J. Biol. Chem.
272:21388-21395[Abstract/Free Full Text].
|
| 31.
|
Scazzocchio, C.
1994.
The purine degradation pathway, genetics, biochemistry and regulation, p. 221-251.
In
S. D. Martinelli, and J. R. Kinghorn (ed.), Aspergillus: 50 years on, vol. 29. Elsevier, Amsterdam, The Netherlands.
|
| 32.
|
Schilling, B., and K. Lerch.
1995.
Cloning, sequencing and heterologous expression of the monoamine oxidase gene from Aspergillus niger.
Mol. Gen. Genet.
247:430-438[CrossRef][Medline].
|
| 33.
|
Sheikh, F. G.,
K. Pahan,
M. Khan,
E. Barbosa, and I. Singh.
1998.
Abnormality in catalase import into peroxisomes leads to severe neurological disorder.
Proc. Natl. Acad. Sci. USA
95:2961-2966[Abstract/Free Full Text].
|
| 34.
|
Shima, S.,
A. Netrusov,
M. Sordel,
M. Wicke,
G. C. Hartmann, and R. K. Thauer.
1999.
Purification, characterization, and primary structure of a monofunctional catalase from Methanosarcina barkeri.
Arch. Microbiol.
171:317-323[CrossRef][Medline].
|
| 35.
|
Skromne, I.,
O. Sanchez, and J. Aguirre.
1995.
Starvation stress modulates the expression of the Aspergillus nidulans brlA regulatory gene.
Microbiology
141:21-28[Abstract/Free Full Text].
|
| 36.
|
Stringer, A. M.,
R. A. Dean,
T. C. Sewall, and W. E. Timberlake.
1991.
Rodletless, a new Aspergillus developmental mutant induced by directed gene inactivation.
Genes Dev.
5:1161-1171[Abstract/Free Full Text].
|
| 37.
|
Takasuka, T.,
N. M. Sayers,
M. J. Anderson,
E. W. Benbow, and D. W. Denning.
1999.
Aspergillus fumigatus catalases: cloning of an Aspergillus nidulans catalase B homologue and evidence for at least three catalases.
FEMS Immunol. Med. Microbiol.
23:125-133[CrossRef][Medline].
|
| 38.
|
Taub, J.,
J. F. Lau,
C. Ma,
J. H. Hahn,
R. Hoque,
J. Rothblatt, and M. Chalfie.
1999.
A cytosolic catalase is needed to extend adult lifespan in C. elegans daf-C and clk-1 mutants.
Nature
399:162-166[CrossRef][Medline].
|
| 39.
|
Timberlake, W. E.
1980.
Developmental gene regulation in Aspergillus nidulans.
Dev. Biol.
78:497-510[CrossRef][Medline].
|
| 40.
|
Timberlake, W. E., and A. J. Clutterbuck.
1994.
Genetic regulation of conidiation, p. 383-427.
In
S. D. Martinelli, and J. R. Kinghorn (ed.), Aspergillus: 50 years on, vol. 29. Elsevier, Amsterdam, The Netherlands.
|
| 41.
|
Valenciano, S.,
J. R. De Lucas,
I. Van der Klei,
M. Veenhuis, and F. Laborda.
1998.
Characterization of Aspergillus nidulans peroxisomes by immunoelectron microscopy.
Arch. Microbiol.
170:370-376[CrossRef][Medline].
|
| 42.
|
Valenciano, S.,
J. R. D. Lucas,
A. Pedregosa,
I. F. Monistrol, and F. Laborda.
1996.
Induction of beta-oxidation enzymes and microbody proliferation in Aspergillus nidulans.
Arch. Microbiol.
166:336-341[CrossRef][Medline].
|
| 43.
|
Wysong, D. R.,
L. Christin,
A. M. Sugar,
P. W. Robbins, and R. D. Diamond.
1998.
Cloning and sequencing of a Candida albicans catalase gene and effects of disruption of this gene.
Infect. Immun.
66:1953-1961[Abstract/Free Full Text].
|
| 44.
|
Yamashita, H.,
S. Avraham,
S. Jiang,
R. London,
P. P. Van Veldhoven,
S. Subramani,
R. A. Rogers, and H. Avraham.
1999.
Characterization of human and murine PMP20 peroxisomal proteins that exhibit antioxidant activity in vitro.
J. Biol. Chem.
274:29897-29904[Abstract/Free Full Text].
|
| 45.
|
Yang, Y.,
J. Shah, and D. F. Klessig.
1997.
Signal perception and transduction in plant defense responses.
Genes Dev.
11:1621-1639[Free Full Text].
|
| 46.
|
Yelton, M. M.,
J. E. Hamer, and W. E. Timberlake.
1984.
Transformation of Aspergillus nidulans by using a trpC plasmid.
Proc. Natl. Acad. Sci. USA
81:1470-1474[Abstract/Free Full Text].
|
| 47.
|
Yoshioka, S.,
K. Kato,
K. Nakai,
H. Okayama, and H. Nojima.
1997.
Identification of open reading frames in Schizosaccharomyces pombe cDNAs.
DNA Res.
4:363-369[Abstract].
|
| 48.
|
Zamocky, M., and F. Koller.
1999.
Understanding the structure and function of catalases: clues from molecular evolution and in vitro mutagenesis.
Prog. Biophys. Mol. Biol.
72:19-66[CrossRef][Medline].
|
Journal of Bacteriology, February 2001, p. 1434-1440, Vol. 183, No. 4
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1434-1440.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Reverberi, M., Zjalic, S., Ricelli, A., Punelli, F., Camera, E., Fabbri, C., Picardo, M., Fanelli, C., Fabbri, A. A.
(2008). Modulation of Antioxidant Defense in Aspergillus parasiticus Is Involved in Aflatoxin Biosynthesis: a Role for the ApyapA Gene. Eukaryot Cell
7: 988-1000
[Abstract]
[Full Text]
-
Hynes, M. J., Murray, S. L., Khew, G. S., Davis, M. A.
(2008). Genetic Analysis of the Role of Peroxisomes in the Utilization of Acetate and Fatty Acids in Aspergillus nidulans. Genetics
178: 1355-1369
[Abstract]
[Full Text]
-
Thon, M., Al-Abdallah, Q., Hortschansky, P., Brakhage, A. A.
(2007). The Thioredoxin System of the Filamentous Fungus Aspergillus nidulans: IMPACT ON DEVELOPMENT AND OXIDATIVE STRESS RESPONSE. J. Biol. Chem.
282: 27259-27269
[Abstract]
[Full Text]
-
Vargas-Perez, I., Sanchez, O., Kawasaki, L., Georgellis, D., Aguirre, J.
(2007). Response Regulators SrrA and SskA Are Central Components of a Phosphorelay System Involved in Stress Signal Transduction and Asexual Sporulation in Aspergillus nidulans. Eukaryot Cell
6: 1570-1583
[Abstract]
[Full Text]
-
Xi, L., Xu, X., Liu, W., Li, X., Liu, Y., Li, M., Zhang, J., Li, M.
(2007). Differentially expressed proteins of pathogenic Penicillium marneffei in yeast and mycelial phases. J Med Microbiol
56: 298-304
[Abstract]
[Full Text]
-
Giles, S. S., Stajich, J. E., Nichols, C., Gerrald, Q. D., Alspaugh, J. A., Dietrich, F., Perfect, J. R.
(2006). The Cryptococcus neoformans Catalase Gene Family and Its Role in Antioxidant Defense.. Eukaryot Cell
5: 1447-1459
[Abstract]
[Full Text]
-
Schliebs, W., Wurtz, C., Kunau, W.-H., Veenhuis, M., Rottensteiner, H.
(2006). A Eukaryote without Catalase-Containing Microbodies: Neurospora crassa Exhibits a Unique Cellular Distribution of Its Four Catalases.. Eukaryot Cell
5: 1490-1502
[Abstract]
[Full Text]
-
Pedrini, N., Juarez, M. P., Crespo, R., de Alaniz, M. J.T.
(2006). Clues on the role of Beauveria bassiana catalases in alkane degradation events.. Mycologia
98: 528-534
[Abstract]
[Full Text]
-
Tribus, M., Galehr, J., Trojer, P., Brosch, G., Loidl, P., Marx, F., Haas, H., Graessle, S.
(2005). HdaA, a Major Class 2 Histone Deacetylase of Aspergillus nidulans, Affects Growth under Conditions of Oxidative Stress. Eukaryot Cell
4: 1736-1745
[Abstract]
[Full Text]
-
Tsitsigiannis, D. I., Bok, J.-W., Andes, D., Nielsen, K. F., Frisvad, J. C., Keller, N. P.
(2005). Aspergillus Cyclooxygenase-Like Enzymes Are Associated with Prostaglandin Production and Virulence. Infect. Immun.
73: 4548-4559
[Abstract]
[Full Text]
-
Davis, M. A., Askin, M. C., Hynes, M. J.
(2005). Amino Acid Catabolism by an areA-Regulated Gene Encoding an L-Amino Acid Oxidase with Broad Substrate Specificity in Aspergillus nidulans. Appl. Environ. Microbiol.
71: 3551-3555
[Abstract]
[Full Text]
-
Lev, S., Hadar, R., Amedeo, P., Baker, S. E., Yoder, O. C., Horwitz, B. A.
(2005). Activation of an AP1-Like Transcription Factor of the Maize Pathogen Cochliobolus heterostrophus in Response to Oxidative Stress and Plant Signals. Eukaryot Cell
4: 443-454
[Abstract]
[Full Text]
-
Missall, T. A., Lodge, J. K., McEwen, J. E.
(2004). Mechanisms of Resistance to Oxidative and Nitrosative Stress: Implications for Fungal Survival in Mammalian Hosts. Eukaryot Cell
3: 835-846
[Full Text]
-
Fast, N. M., Law, J. S., Williams, B. A. P., Keeling, P. J.
(2003). Bacterial Catalase in the Microsporidian Nosema locustae: Implications for Microsporidian Metabolism and Genome Evolution. Eukaryot Cell
2: 1069-1075
[Abstract]
[Full Text]
-
Michan, S., Lledias, F., Hansberg, W.
(2003). Asexual Development Is Increased in Neurospora crassa cat-3-Null Mutant Strains. Eukaryot Cell
2: 798-808
[Abstract]
[Full Text]
-
Klotz, M. G., Loewen, P. C.
(2003). The Molecular Evolution of Catalatic Hydroperoxidases: Evidence for Multiple Lateral Transfer of Genes Between Prokaryota and from Bacteria into Eukaryota. Mol Biol Evol
20: 1098-1112
[Abstract]
[Full Text]
-
Scherer, M., Wei, H., Liese, R., Fischer, R.
(2002). Aspergillus nidulans Catalase-Peroxidase Gene (cpeA) Is Transcriptionally Induced during Sexual Development through the Transcription Factor StuA. Eukaryot Cell
1: 725-735
[Abstract]
[Full Text]
-
Johnson, C. H., Klotz, M. G., York, J. L., Kruft, V., McEwen, J. E.
(2002). Redundancy, phylogeny and differential expression of Histoplasma capsulatum catalases. Microbiology
148: 1129-1142
[Abstract]
[Full Text]
Top
Abstract
Introduction
