Previous Article | Next Article 
Journal of Bacteriology, February 2001, p. 1472-1475, Vol. 183, No. 4
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1472-1475.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Putative Sigma Factor SigI (YkoZ) of Bacillus
subtilis Is Induced by Heat Shock
Ulrich
Zuber,
Kathrin
Drzewiecki, and
Michael
Hecker*
Institut für Mikrobiologie,
Ernst-Moritz-Arndt-Universität Greifswald, D-17487 Greifswald,
Germany
Received 15 June 2000/Accepted 9 November 2000
 |
ABSTRACT |
A Bacillus subtilis disruption mutant with a mutation
in sigI (formerly ykoZ) shows a
temperature-sensitive growth on agar plates. The transcription of the
sigI gene is heat shock induced in rich medium but not in
minimal medium. Proteome studies revealed a reduced amount of GsiB
protein in the sigI mutant under heat shock conditions.
| |
TEXT |
The soil bacterium Bacillus
subtilis has to adapt to a huge variety of environmental
conditions like high-salt conditions, nutrition starvation, and cold
and heat stress. During the last few years, much progress has been made
in unraveling the heat shock response of B. subtilis. The
heat shock genes can be classified into several groups according to
their regulation: class I is controlled by HrcA binding to CIRCE
(15, 26, 27), class II is controlled by the alternative
sigma factor 
B (1, 7, 8, 18, 24, 25), and
class III is controlled by CtsR, the negative regulator of
clpP, clpE, and the clpC operon I
(3, 12). There are other heat shock genes like
htpG (22) and ykdA
(17), which do not belong to classes I to III. In
Escherichia coli two alternative sigma factors
(32 and E) are involved in heat shock
regulation and show a complex type of interplay (16, 19,
21). Under heat stress conditions there is a need for additional
capacity of chaperones and proteases, due to the heat denaturation of
proteins. In B. subtilis the nature of heat-inducible
regulation of the DnaK and GroE chaperone machines, as well as the
ClpCP proteases, is already known (3, 15). However, the
details of the regulation of several heat shock genes like
clpX (U. Gerth, personal communication), htpG (S. Versteeg, personal communication), and ykdA, coding for a
HtrA-like protease (17), are still unclear. Therefore,
additional regulators seem to be involved in the regulation of the heat
shock stimulon in B. subtilis.
Several new sigma factors have been described in the genome sequence of
B. subtilis (9-11, 13). For our understanding
of the global regulatory network (the "regulome"), analysis of
sigma factor mutants is very promising. If the conditions under which a
sigma factor is active are known, a comparison between the behavior of
wild-type and mutant strains under those conditions will lead to the
detection of genes which are controlled by that specific sigma factor,
using global methods like two-dimensional polyacrylamide gel
electrophoresis (2-D PAGE) or DNA array technologies. In this type of analysis, we initially looked for conditions under which the
transcription of ykoZ coding for a sigma factor with unknown function is induced, even if an induced transcription does not necessarily mean that the sigma factor is also active under these conditions.
A sigI mutant cannot grow at high temperature.
BFA
251, a sigI mutant was constructed by Mathieu Simon and
Patrick Stragier. Briefly, a PCR was performed using chromosomal DNA of
B. subtilis 168 and a primer pair; this resulted in an amplicon consisting of sigI internal bases 1411388 to
1411627 according to the BSUB genome annotation (SubtiList database)
and BamHI (HindIII) cleavable ends. The PCR
product was purified and digested with BamHI and
HindIII and ligated into the vector pMUTIN (23), which was also digested with BamHI and
HindIII, resulting in plasmid pDG1773. B. subtilis 168 was transformed with pDG1773 and selected for
Ermr on Luria-Bertani LB plates containing 0.3 µg of
erythromycin per ml to favor single integration events. Colonies were
subsequently transferred to LB plates containing 150 µg of
erythromycin per ml to select for true integrants. The correct
integration was then checked by PCR.
During the systematic function analysis project, we made the initial
observation that strain BFA 251 (sigI::pMUTIN4)
did not grow at very high temperatures (55°C) after replica plating
on LB plates. Also, the strain did not form colonies at 54°C on SMM plates (1 liter of SMM consists of 200 ml of 5× minimal salt solution [0.057 M K2SO4, 0.31 M
K2HPO4, 0.22 M KH2PO4,
0.017 N sodium citrate, 0.004 M MgSO4; pH 7.0], 20 ml of
glucose [20%, wt/vol]), 5 ml of L-tryptophane [1%,
wt/vol], 50 ml of L-glutamine [4%, wt/vol], 2 ml of
FeCl3 [2 mg/ml], 2 ml of MnSO4 [0.1 mg/ml],
10 ml of 100× trace element solution [0.55 g of CaCl2,
0.17 g of ZnCl2, 0.043 g of CuCl2,
0.06 g of CoCl2, and 0.06 g of
Na2MoO4 dissolved in H2O to 1 liter]; for plates, 15 g of agar per liter was added).
To be sure that the temperature-sensitive (TS) phenotype is indeed
linked to the
ykoZ::pMUTIN4 insertion and does not
result
from putative second-site mutations, we transformed chromosomal
DNA from BFA 251 into
B. subtilis 168 and checked the
transformants
for growth on LB plates at 55°C. All the 16 tested
clones showed
the TS phenotype. The survival rate of that mutant was
determined
by using serial dilutions after plating and incubation at
55°C
for 18 h. As described in Table
1, the survival rate of the
sigI mutant was about 1,000-fold reduced compared to that of
the wild
type. Nevertheless, some colonies grew on plates at high
temperature.
Several clones were streaked out and cultivated at 55°C,
and some
of these clones showed wild-type-like growth at high
temperature.
These clones were considered to be TS suppressors.
Transcription of sigI is heat shock induced in rich
medium.
To study the transcriptional profile of sigI, a
digoxigenin-labeled riboprobe of sigI was created by using
the primers Ykoz7F1 (CTAATCGACTCACTATAGGGAGCACCCGTAATGATAA)
and Ykoz7R1 (AAACCAGTGCTTAGCTTTT) in a PCR. The
amplicon was purified with the QIAquick gel extraction kit (Qiagen)
after the right sized fragment was cut out of an agarose gel. For the
digoxigenin labeling reaction, the T7 transcription kit from Roche and
primer Ykoz7F1 were used as specified in the manufacturer's protocol.
This riboprobe was used for slot blot hybridization against total RNA
prepared from B. subtilis cells grown in LB medium under
different stress and starvation conditions as described earlier
(12). The sigI gene was clearly induced under
heat shock conditions, leading to the idea that it is an additional
heat shock-specific sigma factor. Total RNA was prepared from cells
grown in minimal medium and in rich medium before and after the heat
shock and was used for additional slot blot experiments probed with the
sigI riboprobe. As presented in Fig.
1, sigI is induced by heat
shock only in rich medium (DSM [6] or LB medium), not in
minimal medium (SMM). As expected, the sigI mutant BFA 251 did not show any signal, due to the pMutin insertion. No CIRCE sequence, CtsR binding site, or SigB-dependent promoter could be
detected within the upstream region of sigI. Therefore, the sigI gene should be classified into group IV of the B. subtilis heat shock genes.
View larger version (68K):
[in this window]
[in a new window]
|
FIG. 1.
Concentration of sigI/ykoZ mRNA in B. subtilis 168 and BFA 251 grown in LB medium and SMM. A slot blot
analysis of total RNA, which was isolated before (0 min) and 3, 6, and
9 min after a heat shock from 37 to 50°C (or 52°C, as indicated) is
shown. The amount of total RNA used was 5, 2.5, or 1.3 µg as
indicated.
|
|
To characterize the heat induction kinetics, additional slot blot
experiments with RNA prepared after different time points
(3, 6, 9, 30, and 60 min [data not shown]) were used for quantification.
As
calculated from several experiments, the maximal induction
rate was
about 15-fold 3 to 6 minutes after heat shock and declined
to about
4-fold after 60 min. Like other heat shock genes,
sigI is
also transiently
induced.
To define putative transcriptional start sites, a primer extension
experiment was performed as described elsewhere (
12),
using YkozPE1 (TGCAGATCTTTATTGCCTTTTTG) as the primer and
RNA
prepared from
B. subtilis 168 before and 5 min after a
heat shock
from 37 to 52°C. Two putative transcriptional start sites
(S1
and S2) were detected, as shown in Fig.
2. The intensity of the
signal of S1
remained unchanged before and after the heat shock,
and the putative
promoter resembles a weak
A-dependent recognition
sequence (Fig.
2B). After the heat shock
an additional signal of a
putative transcriptional start site
was visible (S2). The deduced
recognition sequence does not have
homology to any known promoter
sequences (
5,
9-11). Consistent
with the observations
mentioned in this paper, the
sigI gene could
be
autoregulated, and this sequence could resemble a
I-dependent promoter.
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Autoradiograph from a primer extension experiment
mapping the 5' end of sigI mRNA. Equal amounts of RNA
isolated before (lane 37) and 5 min after (lane 52) heat shock were
used as templates for reverse transcription. The corresponding sequence
was obtained with the appropriate primer. The DNA sequence illustrated
in the central part is shown at the left side. Putative transcriptional
start sites are indicated by asterisks and by S1 and S2. (B) Sequence
of the upstream region of sigI. Putative transcriptional
start sites are marked by asterisks. The start codon is given in bold
letters. The putative promoter sequence ( 35 and 10 regions)
belonging to S1 is shown below the sequence line. Bases representing
the A consensus sequence are labeled in capital letters.
Above the sequence the potential 10 and 35 regions (underlined
bases) belonging to the heat-inducible putative transcriptional start
site are shown.
|
|
The sigI mutant shows a reduced level of GsiB under
heat shock conditions.
If SigI is active under heat shock
conditions, 2-D PAGE analyses of
[35S]methionine-pulse-labeled protein extracts of
wild-type and sigI mutant strains after heat shock should
lead to detection of the proteins which were controlled by SigI and
which could be responsible for the TS phenotype. Protein extract
preparation, 2-D PAGE conditions, and gel staining were performed as
described previously (12). To obtain an efficient uptake
and incorporation of the labeled methionine in pulse-labeling
experiments, cells have to be grown in minimal medium. Ironically, we
found a heat shock induction of the sigI gene only during
growth in rich medium, which could not be used for pulse-labeling
experiments with [35S]methionine. Comparisons of gels
derived from minimal medium extracts showed no relevant changes between
wild-type and sigI mutant strains. In addition, 2-D PAGE was
performed with cultures grown in DSM to an optical density at 540 nm of
0.5 with subsequent transfer from 37 to 50°C for 15 or 30 min.
Compared to the pulse-labeling experiments, which visualize changes in
the protein synthesis rate, these gels show the accumulated amount of
proteins. As a consequence, a putative SigI dependence will not be seen
as clearly as in pulse-labeling experiments.
Figure
3 presents a comparison of a part
of the silver-stained protein pattern of wild-type and BFA 251 strains.
Only the
GsiB protein spot showed a significant size reduction in the
mutant
in all repeated experiments, whereas the other
sigB-dependent
proteins showed the same heat-inducible
pattern as in the wild
type. Similar results were obtained with
Coomassie blue-stained
gels (data not shown).
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
2-D PAGE analysis of proteins present in the wild-type
B. subtilis 168 (A) and in BFA 251 (B) grown in LB medium
for 30 min after the heat shock. The GsiB spot was identified by
comparison with a B. subtilis master gel (1),
and the GsiB spot-containing sections of the gels are presented. For
generating the images, 80-µg portions of protein extracts were
fractionated by 2-D PAGE and the gels were stained with silver
(12).
|
|
It was suggested that GsiB is exclusively transcribed by SigB
(
14). In contrast to the
sigI mutant BFA 251,
sigB null mutants
can grow at high temperature; in these
mutants transcription of
gsiB does not occur and GsiB
protein is not visible in 2-D PAGE
under conditions where GsiB is
expressed in the
B. subtilis wild-type
strain. This may
indicate that GsiB is not essential for survival
at high temperature.
Therefore it is more likely that another
factor controlling the amount
of GsiB (e.g., a protease) is the
reason for the observed size
reduction of the GsiB spot and the
TS phenotype in the
sigI mutant.
To clarify whether
gsiB is transcribed in a SigI-dependent
manner, we used a
gsiB probe to hybridize a similar slot
blot to
that presented in Fig.
1. A similar heat shock induction
pattern
was observed in the wild-type and
sigI mutant
strains (data not
shown). This also argues against a SigI-dependent
transcription
of
gsiB.
The limitations of the 2-D PAGE system will be overcome by using the
DNA array technology as tool for monitoring global gene
regulation
(
2,
4,
20). Experiments are in progress to
define the
SigI-dependent regulon by hybridizing commercially
available genomic
DNA arrays on nylon filters with radiolabeled
cDNA, which was prepared
from the wild type and from the
sigI mutant under heat shock
conditions. Comparison of these images
should reveal directly or
indirectly
sigI-controlled genes, which
could be responsible
for the TS phenotype of the
sigI mutant strain
BFA251.
| |
ACKNOWLEDGMENTS |
This work was supported by the EU-funded project Systematic
Function Analysis of the Bacillus subtilis genes
(BIO4-CT95-0278). As part of this project, the mutant BFA 251 was
constructed and verified by Mathieu Simon and Patrick Stragier.
We are grateful to Mathieu Simon and Patrick Stragier for constructing
the mutant BFA 251, making the 
-galactosidase measurements, and
providing fruitful comments. We thank Elke Krüger, Susanne Engelmann and Britta Jürgen for useful discussions. We are
especially grateful to Karin Binder, Renate Gloger, Anita Harang, and
Annette Tschirner for excellent technical assistance.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Mikrobiologie, Ernst-Moritz-Arndt-Universität
Greifswald, Friedrich-Ludwig-Jahn-Strasse 15, D-17487 Greifswald,
Germany. Phone: 0049-3834-864200. Fax: 0049-3834-864202. E-mail:
hecker{at}microbio7.biologie.uni-greifswald.de.
| |
REFERENCES |
| 1.
|
Bernhard, J.,
U. Völker,
A. Völker,
H. Antelmann,
R. Schmid,
H. Mach, and M. Hecker.
1997.
Specific and general stress proteins in Bacillus subtilis a two-dimensional protein electrophoresis study.
Microbiology
143:999-1017[Abstract/Free Full Text].
|
| 2.
|
DeRisi, J. L.,
V. R. Iyer, and P. O. Brown.
1997.
Exploring the metabolic and genetic control of gene expression on a genomic scale.
Science
278:680-686[Abstract/Free Full Text].
|
| 3.
|
Derré, I.,
G. Rapoport, and T. Msadek.
1999.
CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in Gram-positive bacteria.
Mol. Microbiol.
31:117-131[CrossRef][Medline].
|
| 4.
|
Fawcett, P.,
P. Eichenberger,
R. Losick, and P. Youngman.
2000.
The transcriptional profile of early to middle sporulation in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
97:8063-8068[Abstract/Free Full Text].
|
| 5.
|
Haldenwang, W. G.
1995.
The sigma factors of Bacillus subtilis.
Microbiol. Rev.
59:1-30[Abstract/Free Full Text].
|
| 6.
|
Harwood, C. R., and S. M. Cutting (ed.).
1990.
Molecular biological methods for Bacillus.
John Wiley & Sons Ltd., Chichester, England.
|
| 7.
|
Hecker, M.,
W. Schumann, and U. Völker.
1996.
Heat-shock and general stress response in Bacillus subtilis.
Mol. Microbiol.
19:417-428[CrossRef][Medline].
|
| 8.
|
Hecker, M., and U. Völker.
1998.
Non-specific, general and multiple stress resistance of growth-restricted Bacillus subtilis cells by the expression of the B regulon.
Mol. Microbiol.
29:1129-1136[CrossRef][Medline].
|
| 9.
|
Horsburgh, M. J., and A. Moir.
1999.
M, an ECF RNA polymerase sigma factor of Bacillus subtilis 168, is essential for growth and survival in high concentrations of salt.
Mol. Microbiol.
32:41-50[CrossRef][Medline].
|
| 10.
|
Huang, X., and J. D. Helmann.
1998.
Identification of target promoters for the Bacillus subtilis X factor using a consensus-directed search.
J. Mol. Biol.
279:165-173[CrossRef][Medline].
|
| 11.
|
Huang, X.,
A. Gaballa,
M. Cao, and J. D. Helmann.
1999.
Identification of target promoters for the Bacillus subtilis extracytoplasmic function factor, W.
Mol. Microbiol.
31:361-371[CrossRef][Medline].
|
| 12.
|
Krüger, E., and M. Hecker.
1998.
The first gene of the Bacillus subtilis clpC operon, ctsR, encodes a negative regulator of its own operon and other class III heat shock genes.
J. Bacteriol.
180:6681-6688[Abstract/Free Full Text].
|
| 13.
|
Kunst, F.,
N. Ogasawara,
I. Moszer,
A. M. Albertini,
A. Danchin, et al.
1998.
The complete genome sequence of the gram-positive bacterium Bacillus subtilis.
Nature
390:249-256.
|
| 14.
|
Maul, B.,
U. Völker,
S. Riethdorf,
S. Engelmann, and M. Hecker.
1995.
B-dependent induction of gsiB by multiple stimuli in Bacillus subtilis.
Mol. Gen. Genet.
248:114-120[CrossRef][Medline].
|
| 15.
|
Mogk, A.,
G. Homuth,
C. Scholz,
L. Kim,
F. X. Schmid, and W. Schumann.
1997.
The GroE chaperonin machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis.
EMBO J.
16:4579-4590[CrossRef][Medline].
|
| 16.
|
Morita, M. T.,
Y. Tanaka,
T. S. Kodama,
Y. Kyogoku,
H. Yanagi, and T. Yura.
1999.
Translational induction of heat shock transcription factor sigma32: evidence for a built-in RNA thermosensor.
Genes Dev.
13:655-665[Abstract/Free Full Text].
|
| 17.
|
Noone, D.,
A. Howell, and K. M. Devine.
2000.
Expression of ykdA, encoding a Bacillus subtilis homologue of HtrA, is heat shock inducible and negatively autoregulated.
J. Bacteriol.
182:1592-1599[Abstract/Free Full Text].
|
| 18.
|
Petersohn, A.,
J. Bernhardt,
U. Gerth,
D. Höper,
T. Koburger,
U. Völker, and M. Hecker.
1999.
Identification of B-dependent genes in Bacillus subtilis using a promoter consensus-directed search and oligonucleotide hybridization.
J. Bacteriol.
181:5718-5724[Abstract/Free Full Text].
|
| 19.
|
Raina, S.,
D. Missiakas, and C. Georgopoulos.
1995.
The rpoE gene encoding the E (24) heat shock sigma factor of Escherichia coli.
EMBO
14:1043-1055[Medline].
|
| 20.
|
Richmond, C. R.,
J. D. Glasner,
R. Mau,
H. Jin, and F. R. Blattner.
1999.
Genome-wide expression profiling in Escherichia coli K-12.
Nucleic Acids Res.
27:3821-3835[Abstract/Free Full Text].
|
| 21.
|
Rouviere, P. E.,
A. De Las Penas,
J. Mecsas,
C. Z. Lu,
K. E. Rudd, and C. A. Gross.
1995.
rpoE, the gene encoding the second heat-shock sigma factor, E, in Escherichia coli.
EMBO
14:1032-1042[Medline].
|
| 22.
|
Schulz, A.,
S. Schwab,
G. Homuth,
S. Versteeg, and W. Schumann.
1997.
The htpG gene of Bacillus subtilis belongs to class III heat shock genes and is under negative control.
J. Bacteriol.
179:3103-3109[Abstract/Free Full Text].
|
| 23.
|
Vagner, V.,
E. Dervyn, and S. D. Ehrlich.
1998.
A vector for systematic gene inactivation in Bacillus subtilis.
Microbiology
144:3097-3104[Abstract/Free Full Text].
|
| 24.
|
Vijay, K.,
M. S. Brody,
E. Fredlund, and C. W. Price.
2000.
A PP2C phosphatase containing a PAS domain is required to convey signals of energy stress to the sigmaB transcription factor of Bacillus subtilis.
Mol. Microbiol.
35:180-188[CrossRef][Medline].
|
| 25.
|
Völker, U.,
B. Maul, and M. Hecker.
1999.
Expression of the B-dependent general stress regulon confers multiple stress resistance in Bacillus subtilis.
J. Bacteriol.
181:3942-3948[Abstract/Free Full Text].
|
| 26.
|
Yuan, G., and S. L. Wong.
1995.
Isolation and characterization of Bacillus subtilis groE regulatory mutants: evidence for orf39 in the dnaK operon as a repressor gene in regulating the expression of both groE and dnaK.
J. Bacteriol.
177:6462-6468[Abstract/Free Full Text].
|
| 27.
|
Zuber, U., and W. Schumann.
1994.
CIRCE, a novel heat shock element involved in regulation of the heat shock operon dnaK of Bacillus subtilis.
J. Bacteriol.
176:1359-1363[Abstract/Free Full Text].
|
Journal of Bacteriology, February 2001, p. 1472-1475, Vol. 183, No. 4
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.4.1472-1475.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Schirner, K., Errington, J.
(2009). The Cell Wall Regulator {sigma}I Specifically Suppresses the Lethal Phenotype of mbl Mutants in Bacillus subtilis. J. Bacteriol.
191: 1404-1413
[Abstract]
[Full Text]
-
Tseng, C.-L., Shaw, G.-C.
(2008). Genetic Evidence for the Actin Homolog Gene mreBH and the Bacitracin Resistance Gene bcrC as Targets of the Alternative Sigma Factor SigI of Bacillus subtilis. J. Bacteriol.
190: 1561-1567
[Abstract]
[Full Text]
-
Asai, K., Ootsuji, T., Obata, K., Matsumoto, T., Fujita, Y., Sadaie, Y.
(2007). Regulatory role of RsgI in sigI expression in Bacillus subtilis. Microbiology
153: 92-101
[Abstract]
[Full Text]
-
Horsburgh, M. J., Thackray, P. D., Moir, A.
(2001). Transcriptional responses during outgrowth of Bacillus subtilis endospores. Microbiology
147: 2933-2941
[Abstract]
[Full Text]
Top
Abstract
Text
