Previous Article | Next Article ![]()
Journal of Bacteriology, March 2001, p. 1577-1584, Vol. 183, No. 5
Department of Microbiology and Cell Science,
University of Florida, Gainesville, Florida 32611
Received 20 July 2000/Accepted 5 December 2000
Salmonella enterica degrades 1,2-propanediol by a
pathway dependent on coenzyme B12 (adenosylcobalamin
[AdoCb1]). Previous studies showed that 1,2-propanediol utilization
(pdu) genes include those for the conversion of inactive
cobalamins, such as vitamin B12, to AdoCbl. However, the
specific genes involved were not identified. Here we show that the
pduO gene encodes a protein with ATP:cob(I)alamin
adenosyltransferase activity. The main role of this protein is
apparently the conversion of inactive cobalamins to AdoCbl for
1,2-propanediol degradation. Genetic tests showed that the function of
the pduO gene was partially replaced by the cobA gene (a known ATP:corrinoid adenosyltransferase) but
that optimal growth of S. enterica on 1,2-propanediol
required a functional pduO gene. Growth studies showed that
cobA pduO double mutants were unable to grow on
1,2-propanediol minimal medium supplemented with vitamin
B12 but were capable of growth on similar medium supplemented with AdoCbl. The pduO gene was cloned into a
T7 expression vector. The PduO protein was overexpressed, partially
purified, and, using an improved assay procedure, shown to have
cob(I)alamin adenosyltransferase activity. Analysis of the genomic
context of genes encoding PduO and related proteins indicated that
particular adenosyltransferases tend to be specialized for particular
AdoCbl-dependent enzymes or for the de novo synthesis of AdoCbl. Such
analyses also indicated that PduO is a bifunctional enzyme. The
possibility that genes of unknown function proximal to
adenosyltransferase homologues represent previously unidentified
AdoCbl-dependent enzymes is discussed.
Salmonella enterica
catabolizes 1,2-propanediol via a pathway that is dependent upon
adenosyl cobalamin (AdoCbl), a metabolically active form of vitamin
B12 (18). Since 1,2-propanediol is formed by
the fermentation of the common plant sugars rhamnose and fucose, its
catabolism may provide a selective advantage in anaerobic environments
(20, 25). Studies employing in vivo expression technology
and competitive index assays have suggested that 1,2-propanediol degradation may also provide a growth advantage in host tissues (10, 15). A number of these aspects of
Salmonella biology have been reviewed recently
(27).
The genes for 1,2-propanediol utilization (pdu) are found at
centisome 44 of the S. enterica genetic map
(18). They are adjacent to and coregulated with 20 genes
for de novo AdoCbl synthesis (1, 5, 26, 28). These genes
are absent from Escherichia coli, and evidence indicates
they were acquired by S. enterica via a single horizontal
gene transfer (6, 28). Surprisingly, there are 23 pdu genes (6). Six of these probably encode
enzymes of the degradative pathway, and four are thought to be involved in regulation, transport, and diol dehydratase reactivation (5, 6, 9). Perhaps five to seven pdu genes are needed for
formation of a polyhedral body that is associated with the diol
dehydratase, and the remaining six are of unknown function
(6).
The proposed pathway of 1,2-propanediol degradation begins with its
conversion to propionaldehyde by AdoCbl-dependent diol dehydratase
(25, 33). Next, the aldehyde is disproportionated to
either propanol or propionic acid. Alcohol dehydrogenase, aldehyde dehydrogenase, phosphotransacylase, and propionate kinase are thought to catalyze this process. The pathway yields ATP, an electron sink, and an intermediate (propionyl-coenzyme A [CoA]), which can
feed into central metabolism via the methyl-citrate pathway (16).
The AdoCbl needed for 1,2-propanediol degradation can be obtained
either by de novo synthesis or by the assimilation of an exogenous
cobalamin (Cbl). In S. enterica, de novo synthesis occurs only under strictly anaerobic conditions (19). However,
Cbls, such as cyanocobalamin (vitamin B12 [CNCb]) and
hydroxycobalamin (HOCbl), can be assimilated both aerobically and
anaerobically (18). The conversion of CNCbl and HOCbl to
AdoCbl is thought to proceed as shown in Fig.
1: CNCbl is decyanated to HOCbl, reduced to cob(II)alamin, further reduced to cob(I)alamin, and finally adenosylated to AdoCbl (14, 17). The cobA gene
(which maps far from the pdu/cob locus at centisome 34)
encodes an ATP:corrinoid adenosyltransferase (32). This
enzyme participates in Cbl assimilation by adenosylation of
cob(I)alamin and also in de novo AdoCbl synthesis by the adenosylation
of an intermediate prior to Cbl (13). Genetic tests have
indicated that Cbl assimilation genes are also found in the
pdu operon, but the specific genes involved have not been identified (37; T. A. Bobik, unpublished results).
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.5.1577-1584.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Functional Genomic, Biochemical, and Genetic
Characterization of the Salmonella pduO Gene, an
ATP:Cob(I)alamin Adenosyltransferase Gene
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (24K):
[in a new window]
FIG. 1.
Proposed vitamin B12 adenosylation pathway.
Coenzyme B12 (a required cofactor for a number of enzymes)
is thought to be produced from vitamin B12 by the series of
reactions shown. The corrin ring of vitamin B12 is shown
lightly shaded, the nucleotide loop is darkly shaded, and the upper
ligand of the cobalt is indicated as follows: CN, cyano group; HO,
hydroxy group; Ado, 5'-deoxyadenosyl group.
Here we report that the pduO gene encodes an ATP:cob(I)alamin adenosyltransferase used in Cbl assimilation for 1,2-propanediol degradation by S. enterica. We also present the results of a functional genomic analysis of adenosyltransferases that indicates the following: (i) particular adenosyltransferases tend to be specialized for particular AdoCbl-dependent enzymes, (ii) the PduO adenosyltransferase is a bifunctional enzyme, and (iii) unknown genes proximal to adenosyltransferase homologues may represent previously unidentified AdoCbl-dependent enzymes.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Chemical and reagents.
Titanium(III) citrate was prepared as
previously described (7). Vitamin B12,
coenzyme B12, and HOCbl were from Sigma Chemical Company,
St. Louis, Mo. Isopropyl-
-D-thiogalactopyranoside
(IPTG), and
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
were from Diagnostic Chemicals Limited, Charlottetown, Canada.
Restriction enzymes and T4 DNA ligase were from New England Biolabs,
Beverly, Mass. Other chemicals were from Fisher Scientific, Norcross, Ga.
Bacterial strains, media, and growth conditions.
The
bacterial strains used in this study are listed in Table
1. The minimal medium used was NCE
(4, 36) supplemented with 0.4% 1,2-propanediol, 1 mM
MgSO4, and 3 mM (each) valine, isoleucine, leucine, and
threonine. LB (Luria-Bertani) medium was the rich medium used
(22). Ampicillin was used at 100 µg/ml unless otherwise
indicated. Kanamycin was used at 25 µg/ml, IPTG at was used at 1 mM
or as indicated, and X-Gal was used at 20 µg/ml.
MacConkey-1,2-propanediol-CNCbl indicator plates were composed of
MacConkey agar base (Difco, Detroit, Mich.) supplemented with 1%
1,2-propanediol and 200 ng of vitamin B12/ml. Aldehyde
indicator plates were prepared according to the method of Conway et al. (11) with the following modifications: pararosaniline was
added to sterile medium as a fine powder, 200 ng of CNCbl/µl was
included, and ethanol was replaced by 1% 1,2-propanediol.
|
General molecular methods.
Agarose gel electrophoresis was
performed as described previously (21). Plasmid DNA was
purified by the alkaline lysis procedure (21) or by using
Qiagen (Chatsworth, Calif.) products according to the manufacturer's
directions. Following restriction enzyme digestion or PCR
amplification, DNA was purified with Qiagen PCR purification and gel
extraction kits or by using phenol-chloroform extraction followed by
ethanol precipitation (21). Restriction digestions were
carried out using standard protocols (21). For ligation of
DNA fragments, T4 DNA ligase (New England Biolabs) was used according
to the manufacturer's directions. Electroporation was used for
bacterial transformation. A Gene Pulser (Bio-Rad, Richmond, Calif.) was
used according to the manufacturer's directions and at the following
settings: capacitance, 25 µF; capacitance extender, 250 µF; pulse
controller, 200
; and voltage, 2.5 kV. LB medium containing the
appropriate antibiotic(s) was used to select for transformed cells, and
prior to the analysis of transformants, pure cultures were prepared.
General protein methods. Polyacrylamide gel electrophoresis (PAGE) was performed using Bio-Rad Redigels and Mini-protean II electrophoresis cells. PAGE was run at 200 V for 45 min using a Bio-Rad Power Pac 300. Following gel electrophoresis, Coomassie brilliant blue R-250 was used to stain proteins. The protein concentrations of solutions were determined using Bio-Rad protein assay reagent according to the manufacturer's directions.
P22 transduction. Transductional crosses were performed as described previously (12) using P22 HT105/1 int-210, a mutant phage that has high transducing ability (29). For the preparation of P22 transducing lysates from strains having galE mutations, overnight cultures were grown on LB medium supplemented with 0.2% glucose and 0.2% galactose.
Cloning of the pduO gene for complementation studies. Vector placIqPO-BglII was used for cloning the pduO gene so that its expression could be induced by IPTG (8). The DNA used for cloning the pduO gene was obtained via PCR amplification of plasmid pMGS2 using the primers GGAATTCAGATCTTATGGCGATTTATACCCGAAC and GGAATTCAAGCTTGGTTTCGAGTTCAGAAGTATTC. Pfu DNA polymerase was employed for the amplification because of its high fidelity of replication. The amplified DNA was purified and ligated to placIqPO-BglII that had been digested with the same restriction enzymes and purified. The ligation mixture was used to transform S. enterica TR6579 by electroporation. Five of six transformants carried plasmids containing inserts of the expected size. Of these, four of five had identical DNA sequences. The majority consensus sequence was compared to the pduO DNA sequence we previously reported (6). There were three differences; however, reexamination of our prior data revealed errors in our previously published DNA sequence. Clones with a pduO gene having the majority consensus sequence were used for further study.
Construction of in-frame pduO deletions. PCR primers were designed to delete bases 19 to 981 of the pduO coding sequence. The first 18 and last 27 bases remained intact, as did all predicted translational start and stop sites of pdu genes. To improve fidelity, the PCRs employed Pfu polymerase and a high concentration of template (1 ng of pMGS2/µl) and were limited to 30 cycles. The following four primers were used to generate the deletions: primer 1, GCGCGCTCTAGATATTCACCGATGAGCACGGACTGC; primer 2, GATGAGTTCCCACGTTAATAGCCGCTCGGGTATAAATCGCCATAACCG; primer 3, GCGGCTATTAACGTGGGAACTCATC; and primer 4, GGAATTCAGGCTAATCAGCTTCAGAGAGACC. Primers 1 and 2 were used to amplify 480 bases of DNA upstream of the pduO gene. Primers 3 and 4 were used to amplify 430 bp of DNA downstream of the pduO gene. The upstream and downstream amplification products were purified and fused by a PCR that included 1 ng of each product/µl and primers 1 and 4. Fusion was possible because the 5' end of primer 2 was the reverse complement of primer 3. After the fusion product was obtained, it was restricted with XbaI and SphI (these sites were designed into primers 1 and 4) and ligated to pCVD442. The ligation reaction was used to transform E. coli S17/1 via electroporation. One clone (plasmid pAP6) containing an insert of the expected size (910 bp) was used to introduce the deletion into the S. enterica chromosome using the procedure of Miller and Mekalanos (23). For the conjugation step, BE47 was used as the recipient and Ampr and Camr were selected. Following the sucrose selection step, replica printing was used to identify Amps colonies. Deletion strains were identified by PCR using whole cells as a source of template.
Cloning the pduO gene for high-level expression.
For use in high-level expression of the PduO protein, a DNA linker was
used to modify the T7 expression vector pET41a (Novagen, Milwaukee,
Wis.). The DNA linker was prepared by annealing two oligonucleotides,
CTAGAATGCATAAATTTTGTTAACTTAAGAAGGAAGATCTCA and TATGAGATCTTCCTTCTTAAGTTAACAAAATTTATGCATT. A 1-ml solution of
50 µM (each) oligonucleotide, 100 mM Tris · HCl (pH 8), and 10 mM MgCl2 was placed in a 1.5-ml microcentrifuge tube,
heated in a boiling water bath for 5 min, removed to the bench top, and
allowed to cool to room temperature. Plasmid pET41a was restricted with XbaI and NdeI, purified, and ligated to the DNA
linker described above. A portion of the ligation reaction mixture was
used to transform E. coli DH5
. Restriction and DNA
sequence analyses of selected clones verified that the ligation
reaction produced the expected product. The pET41a derivative
containing the DNA linker described above was named pTA925.
was
used as the host. Following transformation, five of six isolates
contained plasmids that released the expected 1,046-bp fragment when
restricted with BglII and HindIII. DNA from
one such plasmid was used to transform the expression strain E. coli BL21 DE3 RIL (Stratagene, La Jolla, Calif.). Three isolates obtained from this transformation (BE116 to BE118) were used for high-level expression of the PduO protein.
Growth of PduO expression strains and preparation of cell
extracts.
PduO expression strains were grown in 50-ml cultures
prepared in 250-ml baffled Erlenmeyer flasks. The medium used was LB medium supplemented with 25 µg of kanamycin/ml, and the cultures were
incubated at 37°C with shaking at 275 rpm. The cells were grown to an
optical density of 0.6 to 0.8 at 600 nm. At that time, expression of
the PduO protein was induced by the addition of IPTG to a final
concentration of 1 mM. The cells were incubated at 37°C with shaking
at 275 rpm for an additional 3 h. The cultures were removed from
the shaker, placed on ice for 5 min, and collected by centrifugation
for 5 min at 7,740 × g (maximum) using a Beckman (Fullerton, Calif.) J2-HS centrifuge and a Beckman JA20 rotor. The
cells were then resuspended in 40 ml of ice-cold 20 mM Tris · HCl and again collected by centrifugation as described above. The cell
pellet was frozen at
80°C. Bacterial Protein Extraction Reagent II
(B-PERII; Pierce, Rockford, Ill.) was used to prepare extracts of
soluble proteins and inclusion bodies from cell pellets that had been
stored one to several days at
80°C. B-PERII was used according to
the "midi-prep" sample protocol provided by the supplier with the
following modifications. The B-PERII solution used for the first
extraction was supplemented with the protease inhibitor
phenylmethylsulfonylfluoride at a concentration of 100 µg/ml. The
B-PERII solution used for the second extraction was supplemented with
DNase at a concentration of 20 µg/ml. Inclusion bodies were washed
twice with 10 ml of a 1-to-20 dilution of B-PERII and then resuspended
in 20 mM Tris · HCl (pH 8.0).
Growth curves. Cells were grown in 125-ml baffled Erlenmeyer flasks containing 10 ml of the appropriate medium. The cultures were incubated at 37°C in a New Brunswick model C-24 water bath with the shaking speed set to 7. Cell growth was determined by measuring the optical density at 600 nm using a Beckman model DU640 spectrophotometer. The inoculum for growth curves was obtained as follows: bacterial strains were grown overnight at 37°C with shaking in LB medium or LB medium supplemented with 100 µg of ampicillin/ml for strains that carried plasmids; cells from 1.5 ml of overnight culture were pelleted by centrifugation and resuspended in 1 ml of growth curve medium, and 0.25 ml was used to inoculate 10-ml cultures.
ATP:cob(I)alamin adenosyltransferase assays.
Adenosyltransferase assays were carried out using a modification of a
previously published protocol (35). The assay mixtures were incubated at 37°C under strict anaerobic conditions in 1-cm-wide glass cuvettes modified for sealing with 13-mm-diameter gray butyl rubber stoppers and aluminum crimp seals. The total assay volume was 2 ml, and the assay mixtures contained the following components: 200 mM
Tris · HCl (pH 8), 0.4 mM ATP, 1.6 mM
KH2PO4, 2.8 mM MgCl2, 0.05 mM
HOCbl, and 1 mM titanium(III) citrate. The assay components [except
for titanium(III) citrate and the component used to initiate the
reaction] were combined within an anaerobic chamber (Coy Laboratory Products, Grass Lake, Mich.), dispensed into cuvettes, sealed, removed
from the chamber, and flushed with N2 for 30 s. The
cuvettes were placed in a 37°C water bath for 5 min, and then 20 µl
of Ti(III) citrate was added from a 100-mM stock solution. To allow reduction of the HOCb1 to cob(I)alamin, the reaction mixtures were kept
at 37°C for an additional 3 to 5 min. The reactions were initiated by
adding a source of enzyme or a particular assay component using the
following procedures to minimize the introduction of oxygen. The assay
component to be added was placed within a sealed serum vial and flushed
with N2 for 2 min. Additions were made using a Hamilton
syringe that had been flushed with anoxic H2O just prior to
use. Two methods were used to quantitate the AdoCbl formed: (i) the
decrease in absorbance at 388 nm was followed, and the equation

388 = 24.9 cm
1 mM
1
was used for calculations; (ii) the AdoCbl formed was photolyzed by
exposure of the assay mixtures to a 100-W incandescent light at a
distance of 15 cm for 20 min, and then the decrease in absorbance at
525 nm was measured; the equation 
525 = 4.9 cm
1 mM
1 was used for calculations. Prior
methods used the equation 
525 = 4.8 mM
1 Cm
1 for calculations following
photolysis (35). However, those assays employed
borohydride as a reductant, and cob(II)alamin was the product of
photolysis. When titanium(III) citrate is used as described here, the
cob(II)alamin formed by photolysis is reduced to cob(I)alamin.
Accordingly, the 
value used for calculation reflects the
difference in A525 between AdoCbl and
cob(I)alamin. One unit of ATP:cob(I)alamin adenosyltransferase activity
was defined as 1 nmol of AdoCbl formed per min per mg of protein.
DNA sequencing and analysis.
DNA sequencing was carried out
by the University of Florida Interdisciplinary Center for Biotechnology
Research DNA Sequencing Core Facility using Applied Biosystems Inc.
automated sequencing equipment (Perkin-Elmer, Norwalk, Conn.). The
template for DNA sequencing was plasmid DNA purified using Qiagen tip
100 columns. BlastP and
-Blast software were used to search the
nonredundant database of the National Center for Biotechnology
Information for homologous protein sequences (2, 3).
Electron microscopy. For electron microscopy, cells were grown on minimal succinate (1%) medium supplemented with 0.4% 1,2-propanediol. Cultures (100 ml) were incubated at 37°C with shaking at 275 rpm. The inoculum was 1 ml of an LB overnight culture. Fixation and staining were performed as previously described (6).
Nucluotide sequence accession number. The pduO sequence determined here has been submitted to GenBank for the update of accession number AF026270.
| |
RESULTS |
|---|
|
|
|---|
The cobA and pduO genes have similar functions. To examine the effects of cobA and pduO null mutations on 1,2-propanediol degradation, two qualitative tests were employed. MacConkey-1,2-propanediol medium was used to detect acids produced from the degradation of 1,2-propanediol, and aldehyde indicator medium was used to detect the production of propionaldehyde by AdoCbl-dependent diol dehydratase. For these experiments, both indicator media were supplemented with CNCbl. Thus, acid and aldehyde production relied not only on enzymes of the 1,2-propanediol degradative pathway but also on enzymes that convert CNCbl to AdoCbl. Strains BE111 (pduO) and BE83 (cobA) produced acid and aldehyde at levels similar to those of the wild-type strain; colonies were bright red on MacConkey indicator medium and dark red- brown on aldehyde indicator medium. However, under similar conditions, acid and aldehyde production by BE121 (pduO cobA), were undetectable. Except for the mutations under study, the strains used were isogenic, and two different pduO deletion mutations (in conjunction with a well-characterized cobA mutation) gave similar results in analogous tests.
Given that the pduO and cobA single mutants were essentially wild type in these tests but the pduO cobA double mutant was unable to degrade 1,2-propanediol, we infer that the cobA and pduO genes have similar functions. The cobA gene was previously shown to encode an ATP:corrinoid adenosyltransferase that functions in the assimilation of CNCbl to AdoCbl (13). Hence, the pduO gene is likely to have a similar function.Complementation of the
pduO651 mutation by plasmid
pDP1.
P22 transduction was used to move an expression plasmid
containing a pduO minimal clone (pDP1) from strain BE112 to
strain BE121 (cobA pduO). Transduction mixtures were plated
on aldehyde indicator medium supplemented with 1,2-propanediol, CNCbl,
and ampicillin. Fifty-six transductant colonies were observed, and all
were red-brown. This indicated complementation of the
pduO651 mutation by the pduO minimal clone
carried on plasmid pDP1. As a negative control, a similar experiment
was carried out using the vector lacking the pduO insert. In
this case, complementation was not observed; all 110 transductant
colonies were white. This confirmed that the loss of aldehyde
production in the double mutant was the consequence of the
pduO mutation and not a consequence of another mutation
inadvertently introduced during strain construction.
Effects of cobA and pduO null mutations on
the growth of S. enterica on minimal 1,2-propanediol
medium.
The effects of cobA and pduO null
mutations on the growth of S. enterica on minimal
1,2-propanediol-CNCbl medium were examined (Fig.
2). The wild-type strain and a
cobA mutant strain (BE83) both grew with generation times of
about 8.4 h, and both reached a maximum optical density at 600 nm
of about 1.4. The pduO mutant (BE111) showed a small growth
impairment. Its generation time was 12.2 h, and it reached a
maximum density of 1.45. However, BE121 (pduO cobA) was
unable to grow on 1,2-propanediol minimal medium supplemented with
CNCbl. These findings provided further evidence that the
pduO and cobA genes have similar functions. The
growth curves were repeated three times with similar results except
that the lag times varied by several hours.
|
AdoCbl supplementation partially corrects the phenotype of
cobA pduO double mutants.
Growth of the wild-type
strain was similar with either AdoCbl or CNCbl at concentrations
between 0.2 and 20 µM. Generation times were about 8.5 h, and
final cell densities reached about 1.5 at 600 nm. In contrast, strain
BE121 (pduO cobA) was unable to grow with CNCbl at
concentrations between 0.2 and 20 µM but was capable of growth with
AdoCbl (Fig. 3). At a concentration of 20 µM AdoCbl, BE121 had a generation time of 23 h, about three times longer than that of the wild-type strain. Thus, AdoCbl supported significant growth of the pduO cobA double mutant. This
indicates that the PduO protein is involved in the conversion of CNCbl
to AdoCbl, providing further evidence that it has ATP:corrinoid
adenosyltransferase activity. The reason AdoCbl did not restore growth
of the pduO cobA mutant to the full wild-type level is
likely the instability of AdoCbl (30). During catalysis,
AdoCbl breaks down to Cbls with one of several upper ligands (XCbl).
XCbls are both substrates for adenosylation and potent inhibitors of
diol dehydratase. Since, the pduO cobA double mutant is
incapable of the adenosylation of XCbl, these inhibitors are likely to
accumulate and slow growth.
|
High-level expression of the PduO protein.
Protein expression
from three E. coli strains (BE116 to BE118) constructed to
produce high levels of the PduO protein via a T7 expression system was
analyzed by sodium dodecyl sulfate (SDS)-PAGE. With or without
induction by IPTG, all three strains produced large amounts of a
protein with a molecular mass of approximately 37 kDa (data not shown);
this is close to the predicted mass of the protein encoded by the
entire pduO coding sequence (36.6 kDa). To confirm that the
observed 37-kDa protein was expressed from the pduO coding
sequence, protein expression by E. coli strains BE118
(pduO insert) and BE119 (no insert) was analyzed. Extracts of both soluble proteins and inclusion bodies were prepared and analyzed by SDS-PAGE (Fig. 4). Large
amounts of a 37-kDa protein were found only in the inclusion bodies
from cells containing the pduO T7 expression plasmid (Fig.
4, lane 5). Cells containing the T7 expression plasmid without an
insert did not express detectable amounts of a 37-kDa protein (lanes 1 and 4). This indicated that the observed 37-kDa protein expressed by
E. coli BE118 was the PduO protein.
|
The PduO protein has ATP:cob(I)alamin adenosyltransferase activity. The four extracts used for SDS-PAGE (Fig. 4) were also assayed for ATP:cob(I)alamin adenosyltransferase activity. Inclusion bodies from BE118 had very high specific activity (312 nmol/min/mg of protein), but the other cell extracts tested had no detectable activity. This indicated that the PduO protein has ATP:cob(I)alamin adenosyltransferase activity. ATP, HOCbl, titanium(III) citrate, and enzyme were all required for adenosyltransfer, indicating that ATP and cob(I)alamin were substrates for the reaction. The inclusion body preparations used for these assays were active without solubilization.
UV-visible (Vis) spectroscopy was used to follow the major corrinoids present during the course of adenosyltransferase assays (Fig. 5). The spectrum of the assay mixture prior to the addition of titanium(III) citrate and enzyme indicated that HOCbl was the major corrinoid present. The addition of titanium(III) citrate resulted in the quantitative reduction of HOCbl to cob(I)alamin. After a source of PduO protein (inclusion body extracts) was added to the reaction mixture, the UV-Vis spectrum changed over time to that of AdoCbl. The reaction mixtures were then exposed to a 100-W incandescent light at a distance of 15 cm for 20 min to photolyze the carbon-cobalt bond of AdoCbl. The UV-Vis spectrum taken after exposure to light was that of cob(I)alamin, indicating photolysis had occurred: the expected product of photolysis is cob(II)alamin, but in the presence of titanium(III) citrate, the reduction of cob(II)alamin to cob(I)alamin is expected. These results indicated that cob(I)alamin was a reaction substrate and that AdoCbl was a reaction product
|
An improved ATP:cob(I)alamin adenosyltransferase assay.
In
this study, adenosyltransferase activity was quantitated by determining
the disappearance of cob(I)alamin by continuous measurement of the
A388. The use of titanium(III) citrate as a reductant made this method possible. Previously reported
adenosyltransferase assays employed borohydride for the reduction of
HOCbl to cob(I)alamin (35). During such assays, oxidation
of cob(I)alamin to cob(II)alamin made quantitation based on the
disappearance of cob(I)alamin inaccurate (35). Therefore,
it was necessary to photolyze AdoCbl to cob(II)alamin and to base
quantitation on the difference in A525 between
AdoCbl and cob(II)alamin. Moreover, we found that the use of
borohydride in adenosyltransferase assays resulted in the formation of
gas bubbles that interfered with continuous spectrophotometric
measurements. When titanium(III) citrate was used as a reductant, no
gas bubbles were formed and no oxidation of cob(I)alamin to
cob(II)alamin was observed even after several hours of incubation at
37°C. To test the accuracy of continuous measurement at 388 nm, this
method was compared to the previously published method; the two assays gave similar results (data not shown). Additional tests showed that the
continuous assay was reproducible and that photolysis of AdoCbl by
light from the spectrophotometer beam was insignificant under the
conditions used (data not shown). The continuous method is faster and
about five times more sensitive than the previously reported method
(
388 = 24.9 cm
1
mM
1).
Functional genomic analysis of the pduO gene and its
homologues.
Database searches were used to analyze genes that
cluster with the pduO gene and its homologues (Table
2). Among proteins related to the
N-terminal portion of the PduO protein, the genes encoding 3 of 12 cluster with genes encoding enzymes known to use AdoCbl as a cofactor.
ORFW of Citrobacter freundii and ORF2c of Klebsiella
pneumoniae are found associated with genes for AdoCbl-dependent glycerol dehydratases. ORF AF1290 of Archaeoglobus fulgidus
is adjacent to sequences encoding an AdoCbl-dependent methylmalonyl CoA
mutase homologue. Among the seven amino acid sequences related to the
C-terminal portion of the PduO protein, the genes encoding two are
found clustered with genes for AdoCbl-dependent glycerol dehydratases.
These are ORFY of C. freundii and ORF2a of K. pneumoniae. The organization of pduO and related genes
with genes encoding Ado-Cbl-dependent enzymes is consistent with a role
in Cbl assimilation and has some further implications that are
addressed in Discussion below.
|
| |
DISCUSSION |
|---|
|
|
|---|
The experiments presented here show that the pduO gene encodes an enzyme with ATP:cob(I)alamin adenosyltransferase activity. Partially purified preparations of the PduO protein had ATP:cob(I)alamin adenosyltransferase activity higher than that reported for purified CobA enzyme: 312 nmol/min/mg of protein compared to 53 nmol/min/mg of protein (31). The primary role of the PduO enzyme is apparently the assimilation of exogenous corrinoids for 1,2-propanediol degradation. The function of the pduO gene was partially replaced by that of the cobA gene, which encodes a corrinoid adenosyltransferase that functions both in the assimilation of exogenous corrinoids and in the de novo synthesis of AdoCbl (13). However, the optimal growth of S. enterica on 1,2-propanediol required expression of the pduO gene.
Growth studies indicated that AdoCbl is limiting for growth on 1,2-propanediol. Overexpression of the PduO adenosyltransferase from a plasmid decreased the generation time of S. enterica on 1,2-propanediol from 8.4 to 5.8 h but did not affect the growth rate on glucose succinate, acetate, or propionate. In vitro studies have shown that AdoCbl breaks down during catalysis into inactive Cbls that are inhibitors of diol dehydratase (24, 34). Thus, it appears that the readenosylation of inactive Cbls generated during catalysis limits growth on 1,2-propanediol. This finding may be of importance in biotechnology, since overexpression of adenosyltransferase enzymes might be used to enhance AdoCbl-dependent processes of commercial importance.
Amino acid sequence similarity searching indicated that the PduO adenosyltransferase has two discrete domains. The N- and C-terminal regions of the PduO protein align with complete proteins encoded by different genes. The GenBank database currently contains 12 proteins homologous to the N-terminal region of PduO (Gene Identifiers [GIs] 940442, 1175767, 6459405, 2635812, 8568803, 3257079, 1722966, 699336, 5458793, 5103556, 6015885, and 2649297) and 7 proteins homologous to its C-terminal region (GIs 1175769, 940439, 4160465, 7672527, 4808412, 6624269, and 4235479). Among the C-terminal homologues, four of seven (GIs 4160465, 7672527, 6624269, and 4235479) are encoded by genes arranged with those for the degradation of aromatic compounds, suggesting an independent function. Hence, PduO could be a bifunctional enzyme. If so, it would likely catalyze sequential steps in the adenosylation pathway, namely, the reduction of cob(II)alamin to cob(I)alamin and the adenosylation of cob(I)alamin (Fig. 1).
Based on amino acid sequence similarity, adenosyltransferases and their homologues can be divided into three families: PduO type, CobA type, and EutT type. Analysis of the genomic context of the genes that encode each family suggests that particular types of adenosyltransferases are specialized for particular AdoCbl-dependent enzymes or for the de novo synthesis of AdoCbl. At present, in the GenBank nonredundant database there are two EutT proteins (GIs 3885914 and 6685444). The corresponding eutT genes are both organized with genes encoding AdoCbl-dependent ethanolamine ammonia lyases. In the CobA group, 12 proteins were identified in GenBank (GIs 399274, 115148, 78899, 7469288, 7469130, 231830, 3724050, 7471252, 7477928, 6117894, 7518352, and 7520977). Of these, seven are encoded by genes organized with genes predicted to function in the de novo synthesis of AdoCbl. Thus, the main role for the CobA-type of proteins is apparently as ATP:corrinoid adenosyltransferases that function in the de novo synthesis of AdoCbl. The PduO-type adenosyltransferases include 20 members (PduO, 12 proteins with homology to the N-terminal region of PduO, and 7 proteins with homology to the C-terminal region of PduO). In this group, the genes for six members are arranged with genes for AdoCbl-dependent diol or glycerol dehydratases, and the gene for one member is organized together with sequences similar to those encoding AdoCbl-dependent methylmalonyl CoA mutases (Table 2). The genes for the remaining 13 PduO group members are arranged with genes encoding proteins of unknown function or proteins not known to employ AdoCbl as a cofactor. It seems likely that PduO-type adenosyltransferases primarily support AdoCbl-dependent diol and glycerol dehydratases (two very closely related enzymes) and that some PduO group members have divergent functions. The preferential use of CobA-type adenosyltransferases for de novo AdoCbl synthesis might reflect the substrate specificity. De novo synthesis requires adenosylation of an early biosynthetic intermediate, whereas assimilation involves adenosylation of intact cobamides, such as CNCbl (13). The apparent preferential use of PduO-type adenosyltransferases with diol and glycerol dehydratases and EutT-type adenosyltransferases with ethanolamine ammonia lyases suggests protein-protein interactions between adenosyltransferases and the AdoCbl-dependent enzymes they support. Such interactions would be helpful if AdoCbl is limiting, and this appears to be the case during growth on 1,2-propanediol (see above).
Although particular groups of adenosyltransferases tend to be specific for certain AdoCbl-dependent enzymes, it is interesting that pduO group members are organized with both diol and glycerol dehydratase genes and, in one case, with sequences similar to those encoding methylmalonyl CoA mutases (Table 2). This suggests that adenosyltransferases within a given group can sometimes support AdoCbl-dependent enzymes that are unrelated in amino acid sequence and that have different substrate specificities. This raises the possibility of identifying previously unknown AdoCbl-dependent enzymes based on analysis of genes clustering with adenosyltransferase homologues. In this regard, we note that a number of PduO and CobA homologues cluster with genes of unknown function.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grant GM59486 from the National Institutes of Health and by the Florida Agricultural Experiment Station.
We thank M. Rasche, K. T. Shanmugam, and J. Maupin-Furlow for their invaluable assistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Cell Science, University of Florida, Building 981, Room 1220, Gainesville, FL 32611. Phone: (352) 846-0957. Fax: (352) 392-5922. E-mail: bobik{at}ufl.edu.
Florida Agricultural Experiment Station Journal Series no. RO7931.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ailion, M.,
T. A. Bobik, and J. R. Roth.
1993.
Two global regulatory systems (Crp and Arc) control the cobalamin/propanediol regulon of Salmonella typhimurium.
J. Bacteriol.
175:7200-7208 |
| 2. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[CrossRef][Medline]. |
| 3. |
Altschul, S. F.,
T. L. Madden,
A. A. Schäffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 4. |
Berkowitz, D.,
J. Hushon,
H. Whitfield, Jr.,
J. Roth, and B. Ames.
1968.
Procedure for identifying nonsense mutations.
J. Bacteriol.
96:215-220 |
| 5. |
Bobik, T. A.,
M. E. Ailion, and J. R. Roth.
1992.
A single regulatory gene integrates control of vitamin B12 synthesis and propanediol degradation.
J. Bacteriol.
174:2253-2266 |
| 6. |
Bobik, T. A.,
G. D. Havemann,
R. J. Busch,
D. S. Williams, and J. C. Aldrich.
1999.
The propanediol utilization (pdu) operon of Salmonella enterica serovar Typhimurium LT2 includes genes necessary for the formation of polyhedral organelles involved in coenzyme B12-dependent 1,2-propanediol degradation.
J. Bacteriol.
181:5967-5975 |
| 7. |
Bobik, T. A., and R. S. Wolfe.
1989.
Activation of formylmethanofuran synthesis in cell extracts of Methanobacterium thermoautotrophicum.
J. Bacteriol.
171:1423-1427 |
| 8. |
Bobik, T. A.,
Y. Xu,
R. M. Jeter,
K. E. Otto, and J. R. Roth.
1997.
Propanediol utilization genes (pdu) of Salmonella typhimurium: three genes for the propanediol dehydratase.
J. Bacteriol.
179:6633-6639 |
| 9. |
Chen, P.,
D. Andersson, and J. R. Roth.
1994.
The control region of the pdu/cob regulon in Salmonella typhimurium.
J. Bacteriol.
176:5474-5482 |
| 10. |
Conner, C. P.,
D. M. Heithoff,
S. M. Julio,
R. L. Sinsheimer, and M. J. Mahan.
1998.
Differential patterns of acquired virulence genes distinguish Salmonella strains.
Proc. Natl. Acad. Sci. USA
95:4641-4645 |
| 11. |
Conway, T.,
G. W. Sewell,
Y. A. Osman, and L. O. Ingram.
1987.
Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis.
J. Bacteriol.
169:2591-2597 |
| 12. | Davis, R. W., D. Botstein, and J. R. Roth. 1980. Advanced bacterial genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 13. | Escalante-Semerena, J. C., S. J. Suh, and J. R. Roth. 1989. cobA function is required for both de novo cobalamin biosynthesis and assimilation of exogenous corrinoids in Salmonella typhimurium. J. Bacteriol. 72:273-280. |
| 14. | Friedmann, H. C. 1975. Biosynthesis of corrinoids, p. 75-103. In B. M. Babior (ed.), Cobalamin John Wiley and Sons, New York, N.Y. |
| 15. |
Heithoff, D. M.,
C. P. Conner,
U. Hentschel,
F. Govantes,
P. C. Hanna, and M. J. Mahan.
1999.
Coordinate intracellular expression of Salmonella genes induced during infection.
J. Bacteriol.
181:799-807 |
| 16. |
Horswill, A., and J. Escalante-Semerena.
1997.
Propionate catabolism in Salmonella typhimurium LT2: two divergently transcribed units comprise the prp locus at 8.5 centisomes, prpR encodes a member of the sigma-54 family of activators, and the prpBCDE genes constitute an operon.
J. Bacteriol.
179:928-940 |
| 17. | Huennekens, F. M., K. S. Viktols, K. Fujii, and D. W. Jacobsen. 1982. Biosynthesis of the cobalamin coenzymes, p. 145-167. In D. Dolophin (ed.), B12. John Wiley and Sons, New York, N.Y. |
| 18. |
Jeter, R. M.
1990.
Cobalamin-dependent 1,2-propanediol utilization by Salmonella typhimurium.
J. Gen. Microbiol.
136:887-896 |
| 19. |
Jeter, R. M.,
B. M. Olivera, and J. R. Roth.
1984.
Salmonella typhimurium synthesizes cobalamin (vitamin B12) de novo under anaerobic growth conditions.
J. Bacteriol.
159:206-213 |
| 20. | Lin, E. C. C. 1987. Dissimilatory pathways for sugars, polyols, and carboxylates, p. 244-284. In F. D. Niedhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C. |
| 21. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning; a laboratory manual Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 22. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 23. |
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583 |
| 24. |
Mori, K.,
T. Tobimatsu,
T. Hara, and T. Toraya.
1997.
Characterization, sequencing, and expression of the genes encoding a reactivating factor for glycerol-inactivated adenosylcobalamin-dependent diol dehydratase.
J. Biol. Chem.
272:32034-32041 |
| 25. |
Obradors, N.,
J. Badía,
L. Baldomà, and J. Aguilar.
1988.
Anaerobic metabolism of the L-rhamnose fermentation product 1,2-propanediol in Salmonella typhimurium.
J. Bacteriol.
170:2159-2162 |
| 26. |
Rondon, M. R., and J. Escalante-Semerena.
1992.
The poc locus is required for 1,2-propanediol-dependent transcription of the cobalamin biosynthetic (cob) and propanediol utilization (pdu) genes of Salmonella typhimurium.
J. Bacteriol.
174:2267-2272 |
| 27. | Roth, J. R., J. G. Lawrence, and T. A. Bobik. 1996. Cobalamin (coenzyme B12): synthesis and biological significance. Annu. Rev. Microbiol. 50:137-181[CrossRef][Medline]. |
| 28. |
Roth, J. R.,
J. G. Lawrence,
M. Rubenfield,
S. Kieffer-Higgins, and G. M. Church.
1993.
Characterization of the cobalamin (vitamin B12) biosynthetic genes of Salmonella typhimurium.
J. Bacteriol.
175:3303-3316 |
| 29. | Schmieger, H. 1971. A method for detection of phage mutants with altered transducing ability. Mol. Gen. Genet. 110:378-381[CrossRef][Medline]. |
| 30. | Schneider, Z., and A. Stroinski (ed.). 1987. Comprehensive B12. Walter de Gruyter, Berlin, Germany. |
| 31. |
Suh, S.-J., and J. C. Escalante-Semerena.
1995.
Purification and initial characterization of the ATP:corrinoid adenosyltransferase encoded by the cobA gene of Salmonella typhimurium.
J. Bacteriol.
177:921-925 |
| 32. | Suh, S. J., and J. C. Escalante-Semerena. 1993. Cloning, sequencing and overexpression of cobA which encodes ATP:corrinoid adenosyltransferase in Salmonella typhimurium. Gene 129:93-97[CrossRef][Medline]. |
| 33. |
Toraya, T.,
S. Honda, and S. Fukui.
1979.
Fermentation of 1,2-propanediol and 1,2-ethanediol by some genera of Enterobacteriaceae, involving coenzyme B12-dependent diol dehydratase.
J. Bacteriol.
139:39-47 |
| 34. |
Toraya, T., and K. Mori.
1999.
A reactivating factor for coenzyme B12-dependent diol dehydratase.
J. Biol. Chem.
274:3372-3377 |
| 35. |
Vitols, E.,
G. A. Walker, and R. M. Huennekens.
1965.
Enzymatic conversion of vitamin B12s to a cobamide coenzyme, -(5,6-dimethylbenzimidazolyl)deoxyadenosylcobamide (adenosyl-B12).
J. Biol. Chem.
241:1455-1461 |
| 36. |
Vogel, H. J., and D. M. Bonner.
1956.
Acetylornithase of Escherichia coli: partial purification and some properties.
J. Biol. Chem.
218:97-106 |
| 37. |
Walter, D.,
M. Ailion, and J. Roth.
1997.
Genetic characterization of the pdu operon: use of 1,2-propanediol in Salmonella typhimurium.
J. Bacteriol.
179:1013-1022 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»