Previous Article | Next Article ![]()
Journal of Bacteriology, March 2001, p. 1595-1599, Vol. 183, No. 5
Centre d'Ingénierie des Protéines and
Laboratoire d'Enzymologie, Institut de Chimie, Université de
Liège, B-4000 Liège,1 and
Laboratoire de Biophysique Moléculaire Numérique,
Faculté Universitaire des Sciences Agronomiques, B-5030
Gembloux,2 Belgium
Received 22 June 2000/Accepted 4 December 2000
Penicillin-binding protein 4a (PBP4a) from Bacillus
subtilis was overproduced and purified to homogeneity. It clearly
exhibits DD-carboxypeptidase and thiolesterase activities
in vitro. Although highly isologous to the Actinomadura sp.
strain R39 DD-peptidase (B. Granier, C. Duez, S. Lepage, S. Englebert,
J. Dusart, O. Dideberg, J. van Beeumen, J. M. Frère, and
J. M. Ghuysen, Biochem. J. 282:781-788, 1992), which is rapidly
inactivated by many The Bacillus subtilis
genome (16) contains a gene that encodes a putative
491-residue protein with sequence similarities to low-molecular-weight
penicillin-binding proteins (PBPs). Successively referred to as
pbp (25) and dacC (19),
this gene was overexpressed in Escherichia coli by Pedersen
et al. (19), who showed that dacC does indeed
encode a membrane-bound PBP migrating between PBP4 and PBP5 of B. subtilis on sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE). This protein is now referred to as PBP4a.
The phenotypic effect of dacC mutations and the role of
PBP4a in the synthesis of the B. subtilis spore
peptidoglycan and its influence on the properties of the spore were
investigated, but no physiological role or enzymatic activity could be
assigned to the protein (20).
As already reported for Actinomadura sp. strain R39 PBP4 (in
short, the R39 DD-peptidase) (14), E. coli PBP4 (17), and a Haemophilus
influenzae putative PBP (4), the B. subtilis PBP4a possesses a large insert (175 residues) between the
first and second active-site-defining motifs, and it can therefore be classified as a class C low-molecular-weight PBP (14).
Importantly, although preliminary X-ray data for E. coli
PBP4 are available (24), no three-dimensional structure of
a protein belonging to this class of proteins has been presently established.
In this work, we describe the overexpression of PBP4a in E. coli, its purification, and its kinetic characterization as an in
vitro DD-carboxypeptidase. Values for the parameter of
inactivation (k2/K, the second-order
rate constant characterizing the acylation reaction) by some
penicillins and cephalosporins were also determined and compared to
those for the R39 DD-peptidase, to which PBP4a has the
highest degree of sequence similarity (46% identity and 61%
similarity) (8, 14).
Recombinant DNA techniques, bacterial strains, plasmids, and
growth conditions.
B. subtilis 168 1A1 (Genetic Stock
Center) was grown at 37°C in Luria-Bertani (LB) medium, and its
genomic DNA was extracted with the Qiagen genomic tip 20/G kit.
(Westburg, Leusden, The Netherlands).
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.5.1595-1599.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Purification and Characterization of PBP4a, a New
Low-Molecular-Weight Penicillin-Binding Protein from
Bacillus subtilis
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-lactams, PBP4a is only moderately sensitive to
these compounds. The second-order rate constant
(k2/K) for the acylation of the
essential serine by benzylpenicillin is 300,000 M
1
s
1 for the Actinomadura sp. strain R39
peptidase, 1,400 M
1 s
1 for B. subtilis PBP4a, and 7,000 M
1 s
1 for
Escherichia coli PBP4, the third member of this class of PBPs. Cephaloridine, however, efficiently inactivates PBP4a
(k2/K = 46,000 M
1 s
1). PBP4a is also much more
thermostable than the R39 enzyme.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1. Cultures
of E. coli TG1, JM109, or JM110 transformed by the recombinant plasmid derived from pMK4 were grown at 30°C in LB medium
supplemented with 10 µg of chloramphenicol ml
1.
E. coli LMG194 cells transformed with the plasmid derived
from pBAD/Myc-HisAKr were grown in minimal RM medium
(Invitrogen) supplemented with 0.2% glucose and 50 µg/of kanamycin
ml
1.
The oligonucleotides were purchased from Eurogentec (Seraing, Belgium)
or from Amersham Pharmacia Biotech.
PCR amplifications were carried out with a DNA thermal cycler
(Biometra-Trio Thermoblock; Westburg, Leusden, The Netherlands) using
Vent DNA polymerase (New England Biolabs, Beverly, Mass.) or Platinum
DNA polymerase (Gibco BRL, Merelbeke, Belgium). The PCR products were
cloned into pUCBM20 (Boehringer, Mannheim, Germany), and their
sequences were completely verified before insertion in the expression vectors.
Purification of PBP4a.
E. coli JM110 cells
transformed with the expression vector derived from pMK4 were grown
overnight at 30°C in 1 liter of LB medium. The cells were collected
by centrifugation and resuspended in 30 mM Tris-HCl, pH 8.0, containing
27% (wt/vol) sucrose. The periplasmic content was isolated as
described previously (9), dialyzed against 100 mM
Tris-HCl, pH 7.8, and loaded onto a DEAE-cellulose column equilibrated
with the same buffer. The PBP4a was eluted with a curvilinear gradient
of NaCl (the mixing flask held a constant volume of 300 ml; the added
solution was 175 mM NaCl in the same buffer). The fractions exhibiting
the highest activity against N
-acetyl-L-Lys-D-Ala-D-Ala
(AcKAA) were concentrated by ultrafiltration on an Amicon PM-30
membrane and loaded onto a molecular-sieve Sephacryl S100 column
equilibrated in 50 mM Tris-HCl, pH 7.8-300 mM KCl-10%
ethyleneglycol. The latter step was repeated to obtain homogeneous
PBP4a. The active fractions were collected and concentrated by
centrifugation in a Millipore Ultrafree-15 filter.
20°C
in 100 mM Tris, pH 7.8, containing 20% ethyleneglycol or 30% glycerol.
Substrates.
AcKAA was a gift from UCB Bioproducts
(Braine-l'Alleud, Belgium).
N
-Acetyl-L-Lys-D-Ala-D-thiolactate
(AcKAThl) was a gift from Hoechst Marion Roussel (Romainville, France).
The thiolesters benzoyl-Gly-thioglycolate (Bz-Gly-Thg) and
benzoyl-D-Ala-thioglycolate (Bz-D-Ala-Thg) were obtained as previously described (1, 2). Benzylpenicillin, ampicillin, and cephaloridin were from Sigma (Bornem, Belgium). Cefuroxime was a gift from Glaxo Wellcome (Verona, Italy).
-Iodopenicillanate was obtained as described previously (6,
11). Ceftiofur (also named Exenel) was from Upjohn (Crawley,
United Kingdom).
Kinetic measurements.
Hydrolysis of AcKAA was followed by
monitoring the amount of D-alanine released using the
D-amino acid oxidase method (12). Hydrolysis
of Bz-Gly-Thg and Bz-D-Ala-Thg was monitored at 250 nm on a
Uvikon 860 apparatus using a 
value of
2,000 M
1
cm
1. kcat and
Km values were derived from the complete time
courses of hydrolysis of the substrate as described by De Meester et
al. (7). Hydrolysis of AcKAThl was monitored at 412 nm in
the presence of 1.2 mM 5,5'-dithiobis(2-nitrobenzoic acid) using a

value of 13,600 M
1 cm
1.
kcat/Km was obtained from
initial rates of hydrolysis at substrate concentrations
[S] <Km. For the R39 enzyme,
kinetic parameters for AcKAThl were derived from the complete
hydrolysis time course. Unless otherwise stated, all experiments were
performed at 30°C in 0.1 M HEPES pH 7.5.
-lactam
compounds (C) was analyzed on the basis of the following model:
|
-lactam, and
k3 is a first-order rate constant characterizing
the deacylation reaction. Hydrolysis of E-C* to restore the active
enzyme (k3) was slow and was thus neglected. The
apparent first-order acylation rate constant
(ka) was measured at different
-lactam
concentrations by recording the progressive decrease in the rate of
hydrolysis of 100 µM AcKAThl. In all cases, the
-lactam
concentration was at least 10 times greater than that of the enzyme. In
the presence of the substrate, ka is given by
|
(1) |
-lactam concentration.
In equation 1, Km refers to the substrate, and
under our experimental conditions [S] was well below
Km. In addition, the direct proportionality between ka and [C] showed that
[C] was negligible compared to K(1 + [S]/Km). Therefore equation 1 could
be simplified to give ka = k2[C]/K. Values for
k2/K were obtained from the slope of the linear plots of ka versus [C].
The intrinsic fluorescence of the R39 DD-peptidase
decreases as a result of its interaction with various cephalosporins.
This property was used to determine
k2/K for cephaloridine. Fluorescence quenching caused by cephaloridine was monitored at 20°C in 0.1 M
Tris-HCl buffer, pH 7.8, containing 5 mM MgCl2 with the
help of a Bio-Logic SFM-3 stopped-flow apparatus (excitation
wavelength = 280 nm; emission wavelength > 320 nm), and
k2/K was calculated from the slope of
the linear plot of the apparent rate constant for acylation versus the
-lactam concentration, as previously described (13).
pH dependence of the activity. Hydrolysis of AcKAA was measured at 37°C at different pHs ranging from 3 to 12. The universal buffer system described by Teorell and Stenhagen (23) was used at all pHs.
Thermal unfolding curves. Thermal-denaturation melting curves were obtained as described by Vanhove et al. (26). The sample was heated at 1°C/min using a thermostatically regulated circulating water bath. Excitation wavelength was 284 nm and emission wavelengths were 335 and 330 nm for the R39 enzyme and PBP4a, respectively. Experiments were performed in 0.1 M Tris buffer, pH 7.8, using an SLM-AMINCO 8100 spectrofluorometer (Spectronic Instruments).
N-terminal sequencing. The N-terminal sequence was determined with 160 pmol of protein with the help of an Applied Biosystems Procise sequencer (PE Biosystems, Nieuwerkerk a/d Ijssel, The Netherlands).
| |
RESULTS |
|---|
|
|
|---|
Expression of dacC from the B. subtilis-E.
coli shuttle plasmid pMK4 and purification of PBP4a.
The
portion of the gene encoding the mature PBP4a was cloned in phase with
the signal sequence of the Bacillus licheniformis 749i
-lactamase under the control of the B. licheniformis blaP promoter (15, 18). The resulting vector was first cloned
in E. coli TG1, isolated, and used to transform B. subtilis 1A751, which was grown in LB medium for 16 h at
37°C. Under these conditions, the expected secretion of PBP4a into
the culture medium was not observed. An SDS-PAGE analysis of the
culture supernatant also did not reveal the presence of the target
protein after staining with Coomassie brilliant blue, and no hydrolysis
of AcKAA was detected. The reasons of the latter failure to express
PBP4a remain unclear, although protease degradation of the PBP4a and
inefficient processing by the signal peptidase are possible
explanations. This was not further investigated since the same
recombinant plasmid led to periplasmic production of PBP4a in E. coli TG1. Among the other transformed E. coli strains,
DH5
, JM109, and JM110, the last yielded the best production of
PBP4a. Although not highly overproduced, PBP4a was highly toxic when
secreted into the periplasm of E. coli, and the significant
cell lysis observed resulted in the detection of 50% of the total
PBP4a in the culture supernatant. Pedersen et al. (19)
also mentioned the toxicity of this protein for E. coli, at
least when produced in a soluble processed form.
-lactamase was also obtained, even in the absence of ampicillin in
the culture medium. The proteins exhibit similar isoelectric pH values
(pIs of 5.14 for PBP4a and 5.9 for the TEM enzyme), giving rise to
overlapping elution profiles during the DEAE-cellulose purification
step (see Materials and Methods). Other ion exchanger (DEAE- and
Q-Sepharose) and hydrophobic-interaction (RESSOURCE ISO and RESSOURCE
PHE; Pharmacia Biotech) columns did not allow the recovery of active
PBP4a. The Ni2+-nitrilotriacetic acid agarose, on which the
TEM enzyme is naturally retained, was also tested, but PBP4a could not
be eluted in an active form.
Homogeneous,
-lactamase-free PBP4a was eventually obtained by
loading the sample obtained after the DEAE-cellulose purification step
onto a molecular-sieve Sephacryl S100 column. This step had to be
repeated in order to obtain the desired purity. Active enzyme could
only be recovered when 10% ethyleneglycol was added to the buffer,
suggesting that the protein interacts with the matrix in the absence of ethyleneglycol.
PBP4a exhibits an apparent molecular mass of 59 kDa on SDS-PAGE; the
theoretical mass deduced from the protein sequence was 49.7 kDa.
Cloning of the dacC gene into pBAD/Myc-HisAKr. The dacC gene without its signal sequence was amplified from genomic DNA by PCR using the following primers: 5' CATGCCATGGCTGAAAAACAAGATGCACTTTCCGG3' (the underlined sequence corresponds to an NcoI restriction site and contains a translation initiation codon in phase with the triplet coding for the first residue of the mature PBP4a) and 5'CGGAATTCGGTTCGACAAAGCGTTATTACAG3' (the underlined sequence corresponds to an EcoRI site, and the last 23 bases are complementary to nucleotides 1683 to 1705 in the sequence with accession no. Z34883 in the EMBL database). Therefore, the amplified fragment contains the sequence encoding the mature PBP4a with an additional N-terminal methionine as well as the endogenous stop codons and putative terminator sequence (25).
After verification of the sequence, the amplified fragment was inserted into expression plasmid pBAD/Myc-HisAKr between the NcoI and EcoRI restriction sites without fusion to the polyhistidine coding region since preliminary assays of purification by affinity chromatography on Ni2+-nitrilotriacetic acid agarose were unsuccessful. Overproduction of PBP4a is detrimental to the viability of E. coli when the enzyme is secreted into the periplasm (our first expression system and reference 19). Therefore, a maximal repression of arabinose promoter pBAD was obtained by growing the transformed LMG194 cells in minimal RM medium containing 0.2% glucose. Different inducer concentrations were tested, and the best production was obtained with 0.2% arabinose and 4 h of culture at 37°C. The cells from 25 ml of culture were treated as described previously (9), and the different cellular contents were analyzed by SDS-PAGE; as expected from the genetic construction, the cytoplasm contained a significantly overproduced soluble protein (data not shown). Moreover, the cytoplasmic extract exhibited a clear hydrolytic activity on AcKAA, which indicated a correct folding of PBP4a. The enzyme was purified as described above from 1 liter of culture after breaking the cells in cell disruption equipment (Constant Systems Ltd., Warwick, United Kingdom). The final yield was 8 mg of pure enzyme per liter of culture. The N-terminal sequence, AEKQDALS, confirmed the identity of the purified enzyme as PBP4a, with the loss of the first theoretical methionine residue. The enzyme produced with the help of the second expression system (pBAD/Myc-HisAKr) was used for the biochemical characterization.Kinetic characterization of PBP4a. (i) DD-peptidase
activity and interaction with thiolester substrates.
PBP4a clearly
exhibits a DD-carboxypeptidase activity on AcKAA.
Surprisingly, however, the enzyme is inhibited by an excess of
substrate (data not shown) and the Km value
could not be determined. By contrast,
kcat/Km could be
determined by measuring the initial rate of hydrolysis at low
concentrations of AcKAA (Table 1). Thiolesters are also efficiently hydrolyzed by PBP4a (Table 1). Km values for AcKAThl, Bz-Gly-Thg, and
Bz-D-Ala-Thg are, however, much higher that those reported
for the R39 DD-peptidase.
|
(ii) Transpeptidase activity. The kinetic parameters for the hydrolysis of Bz-D-Ala-Thg in the presence of 10 and 50 mM D-alanine are included in Table 1. If D-alanine can be used as an acceptor in a transpeptidation reaction, and assuming that the deacylation step is rate limiting, increases in both kcat and Km are expected. This was indeed observed, although the increases in kcat and Km are relatively modest. In addition, similar to what was reported for the R39 enzyme (27), a slight but significant increase in kcat/Km was also measured.
(iii) Inactivation by
-lactam antibiotics.
Table
2 shows values of
k2/K determined with various
-lactam compounds. Despite a very high similarity to the R39
DD-peptidase, which is extremely sensitive to
-lactams,
B. subtilis PBP4a is significantly more resistant to these
compounds with the exception of cephaloridine, by which it is
efficiently inactivated.
|
pH dependence of the activity of PBP4a. The rate of hydrolysis of AcKAA was measured at 37°C between pH 3 and 12. The activity of PBP4a was undetectable between pH 3 and 5.5. From pH 6 to 12, however, the activity increased linearly (not shown). Despite a maximum of activity at pH 12, all the kinetic measurements were performed at physiological pH values.
Thermostability of PBP4a.
Thermal unfolding curves for PBP4a
and the R39 DD-peptidase are shown in Fig.
1. Activity measurements at the end of
the transition indicated that unfolding was not reversible, and
therefore only apparent melting temperatures
(Tm) could be computed. Apparent Tms were 47.9 and 67.9°C for the R39 and PBP4a
DD-peptidases, respectively, highlighting a very
significantly higher stability for the latter enzyme.
|
| |
DISCUSSION |
|---|
|
|
|---|
PBP4a from B. subtilis, a new member of the class C low-molecular-weight PBP family, was overexpressed in a soluble and active form in E. coli. The first expression system using the B. subtilis-E. coli shuttle vector directed the PBP4a to the periplasm of E. coli. This resulted in significant lysis of the different strains tested, indicating a high toxicity of the protein. By contrast, the expression of PBP4a from the pBAD/Myc-HisAKr plasmid resulted in cytoplasmic production without any observable cell lysis in E. coli LMG194.
The purification of PBP4a was particularly difficult since the protein was rapidly inactivated on several ion exchangers and was not eluted from molecular-sieve columns in the absence of ethyleneglycol. However, PBP4a was successfully purified to homogeneity by chromatography on a weak ion exchanger (DEAE-cellulose) followed by filtration on Sephacryl S100 in a buffer supplemented with 10% ethyleneglycol. The final yield was 8 mg per liter of culture.
In vitro, the protein clearly exhibited DD-carboxypeptidase
and thiolesterase activities on short compounds exhibiting
D-Ala-D-Ala and D-Ala-thiolactate
or D-Ala-thioglycolate C termini. Interestingly, the enzyme
is inhibited by an excess of AcKAA, but inhibition occurs at relatively
high substrate concentrations (>10 mM), and it is not clear whether
this observation has any physiological relevance. Kinetic parameters
for Bz-D-Ala-Thg measured in the presence of
D-alanine indicate that the PBP4a can use the latter as an
acceptor in a transpeptidation reaction. By contrast to the R39
DD-peptidase, which is very sensitive to inactivation by
-lactams, the B. subtilis PBP4a is only weakly inhibited
by many of these compounds, although the two proteins exhibit a high degree of homology (61% similarity and 46% strict identity). This low
affinity of PBP4a for penicillin explains the observation of Pedersen
et al. (19), who failed to visualize the protein in
membranes of B. subtilis incubated with
fluorescein-hexanoic-6-aminopenicillanic acid.
We also show here that the B. subtilis PBP4a is much more
thermostable than the related R39 enzyme (
Tm = 20°C). Many analyses to relate the protein conformational
characteristics to thermostability have been carried out (for a review,
see reference 21); however, no unambiguous rules can be established to
predict how substituted amino acids improve the thermostability of a
protein, particularly in the absence of three-dimensional structures.
The prolyl contents and the percentages of hydrophobic residues are
quite similar for the two enzymes. The only significant difference is
in the percentage of positively charged residues (mainly due to the
number of lysine residues): 8.4% in PBP4a versus 1% in the R39
DD-peptidase. The percentage of negatively charged residues
being almost similar in both proteins, there is an unfavorable balance
of charged amino acids in the R39 enzyme (ratio of positive to negative
charges: 0.31 versus 0.79 for PBP4a), resulting in a particularly low
isoelectric pH value for the R39 enzyme (<3.6). As pointed out by
Vanhove et al. (26), this unfavorable balance might
contribute to the particularly low stability of the R39
DD-peptidase.
In B. subtilis, PBP4a expression is initiated at the end of the stationary phase. The data from Pedersen et al. (19) and Popham et al. (20) indicate that the PBP4a product has no significant role in spore peptidoglycan production. Data for insertional dacC mutants indicate also that this gene is dispensable under normal growth conditions.
Although a DD-carboxypeptidase activity was clearly assigned in vitro to the PBP4a product, the physiological role of the whole protein and the function of the additional domain remain to be determined.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by the Belgian program on Interuniversity Poles of Attraction initiated by the Belgian State, Prime Minister's Office, Services fédéraux des affaires scientifiques, techniques et culturelles (PAI no. P4/03). C.D. and M.V. are respectively Chercheur qualifié and Chargé de Recherche of the Fonds National de la Recherche Scientifique (Brussels, Belgium).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Centre d'Ingénierie des Protéines and Laboratoire d'Enzymologie, Université de Liège, Institut de Chimie, B6, Sart Tilman, B-4000 Liège, Belgium. Phone: 32-4-366.33.98. Fax: 32-4-366.33.64. E-mail: jmfrere{at}ulg.ac.be.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Adam, M.,
C. Damblon,
B. Plaitin,
L. Christiaens, and J. M. Frère.
1990.
Chromogenic depsipeptide substrates for -lactamases and penicillin-sensitive DD-peptidases.
Biochem. J.
270:525-529[Medline].
|
| 2. | Adam, M., C. Damblon, M. Jamin, W. Zorzi, J. Dusart, M. Galleni, A. El Kharroubi, G. Piras, B. Spratt, W. Keck, J. Coyette, J. M. Ghuysen, M. Nguyen-Distèche, and J. M. Frère. 1991. Acyltransferase activities of the high-molecular-mass essential penicillin-binding proteins. Biochem. J. 279:601-604. |
| 3. |
Broome-Smith, J. K.,
M. Tadayyon, and Y. Zhang.
1990.
-Lactamase as a probe of membrane protein assembly and protein export.
Mol. Microbiol.
4:1637-1644[Medline].
|
| 4. |
Cotton, M. D.,
T. R. Utterback,
M. C. Hanna,
D. T. Nguyen,
D. M. Saudek,
R. C. Brandon,
L. D. Fine,
J. L. Fritchman,
J. L. Fuhrmann,
N. S. M. Geoghagen,
C. L. Gnehm,
L. A. McDonald,
K. V. Small,
C. M. Fraser,
H. O. Smith, and J. C. Venter.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae.
Science
269:496-512 |
| 5. |
Damblon, C.,
G. H. Zhao,
M. Jamin,
P. Ledent,
A. Dubus,
M. Vanhove,
X. Raquet,
L. Christiaens, and J. M. Frère.
1995.
Breakdown of the stereospecificity of DD-peptidases and -lactamases with thiolester substrates.
Biochem. J.
309:431-436.
|
| 6. |
De Meester, F.,
J. M. Frère,
J. L. Piette, and H. Vanderhaeghe.
1985.
Synthesis of ( -methyl 3H)-6- -iodopenicillanic acid.
J. Label. Compd Radiopharm.
22:415-425[CrossRef].
|
| 7. |
De Meester, F.,
B. Joris,
G. Reckinger,
C. Bellefroid-Bourguignon,
J. M. Frère, and S. G. Waley.
1987.
Automated analysis of enzyme inactivation phenomena. Application to -lactamases and DD-peptidases.
Biochem. Pharmacol.
36:2393-2403[CrossRef][Medline].
|
| 8. | Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. |
| 9. | Fraipont, C., M. Adam, M. Nguyen-Distèche, W. Keck, J. van Beeumen, J. A. Ayala, B. Granier, H. Hara, and J. M. Ghuysen. 1994. Engineering and overexpression of periplasmic forms of the penicillin-binding protein 3 of Escherichia coli. Biochem. J. 298:189-195. |
| 10. | Frère, J. M., and B. Joris. 1985. Penicillin-sensitive enzymes in peptidoglycan biosynthesis. Crit. Rev. Microbiol. 11:299-396[Medline]. |
| 11. |
Frère, J. M.,
C. Dormans,
C. Duyckaerts, and J. De Graeve.
1982.
Interaction of -iodopenicillanate with the -lactamases of Streptomyces albus G and Actinomadura R39.
Biochem. J.
207:437-444[Medline].
|
| 12. | Frère, J. M., M. Leyh-Bouille, J. M. Ghuysen, M. Nieto, and H. R. Perkins. 1976. Exocellular DD-peptidases-transpeptidases from Streptomyces. Methods Enzymol. 45:610-636[Medline]. |
| 13. |
Fuad, N.,
J. M. Frère,
J. M. Ghuysen, and C. Duez.
1976.
Mode of interaction between -lactam antibiotics and the exocellular DD-carboxypeptidase from Streptomyces R39.
Biochem. J.
155:623-629[Medline].
|
| 14. | Granier, B., C. Duez, S. Lepage, S. Englebert, J. Dusart, O. Dideberg, J. van Beeumen, J. M. Frère, and J. M. Ghuysen. 1992. Primary and predicted secondary structures of the Actinomadura R39 extracellular DD-peptidase, a penicillin-binding protein (PBP) related to the Escherichia coli PBP4. Biochem. J. 282:781-788. |
| 15. |
Kobayashi, T.,
Y. F. Zhu,
N. J. Nicholls, and J. O. Lampen.
1987.
A second regulatory gene, blaRI, encoding a potential penicillin-binding protein required for induction of -lactamase in Bacillus licheniformis.
J. Bacteriol.
169:3873-3878 |
| 16. | Kunst, F., et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256[CrossRef][Medline]. |
| 17. | Mottl, H., P. Terpstra, and W. Keck. 1991. Penicillin-binding protein 4 of Escherichia coli shows a novel type of primary structure among penicillin-interacting proteins. FEMS Microbiol. Lett. 78:213-220[CrossRef]. |
| 18. |
Neugebauer, K.,
R. Sprengel, and H. Schaller.
1981.
Penicillinase from Bacillus licheniformis: nucleotide sequence of the gene and implications for the biosynthesis of a secretory protein in a gram-positive bacterium.
Nucleic Acids Res.
9:2577-2588 |
| 19. |
Pedersen, L. B.,
T. Murray,
D. L. Popham, and P. Setlow.
1998.
Characterization of dacC, which encodes a low-molecular-weight penicillin-binding protein in Bacillus subtilis.
J. Bacteriol.
180:4967-4973 |
| 20. |
Popham, D. L.,
M. E. Gilmore, and P. Setlow.
1999.
Roles of low-molecular-weight penicillin-binding proteins in Bacillus subtilis spore peptidoglycan synthesis and spore properties.
J. Bacteriol.
181:126-132 |
| 21. |
Querol, E.,
J. A. Perez-Pons, and A. Mozo-Villarias.
1996.
Analysis of protein conformational characteristics related to thermostability.
Protein Eng.
9:265-271 |
| 22. | Sullivan, M. A., R. E. Yasbin, and F. E. Young. 1984. New shuttle vectors for Bacillus subtilis and Escherichia coli which allow rapid detection of inserted fragments. Gene 29:21-26[CrossRef][Medline]. |
| 23. | Teorell, T., and E. Stenhagen. 1938. Ein universalpuffer für den pH-Bereich 2,0 bis 12,0. Biochem. Z. 299:416-419. |
| 24. |
Thunnissen, M. M. G. M.,
F. Fusetti,
B. de Boer, and B. W. Dijkstra.
1995.
Purification, crystallization and preliminary X-ray analysis of penicillin-binding protein 4 from Escherichia coli, a protein related to class A -lactamases.
J. Mol. Biol.
247:149-153[CrossRef][Medline].
|
| 25. |
Tognoni, A.,
E. Franchi,
C. Magistrelli,
E. Colombo,
P. Cosmina, and G. Grandi.
1995.
A putative new peptide synthase operon in Bacillus subtilis: partial characterization.
Microbiology
141:645-648 |
| 26. |
Vanhove, M.,
S. Houba,
J. Lamotte-Brasseur, and J. M. Frère.
1995.
Probing the determinants of protein stability: comparison of class A -lactamases.
Biochem. J.
308:859-864.
|
| 27. | Zhao, G., C. Duez, S. Lepage, C. Forceille, N. Rhazi, D. Klein, J. M. Ghuysen, and J. M. Frère. 1998. Site-directed mutagenesis of the Actinomadura R39 DD-peptidase. Biochem. J. 327:377-381. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»