Previous Article | Next Article 
Journal of Bacteriology, March 2001, p. 1621-1630, Vol. 183, No. 5
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.5.1621-1630.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Visualization of the Attachment Organelle and
Cytadherence Proteins of Mycoplasma pneumoniae by
Immunofluorescence Microscopy
Shintaro
Seto,1
Gerlinde
Layh-Schmitt,2,
Tsuyoshi
Kenri,3 and
Makoto
Miyata1,*
Department of Biology, Graduate School of
Science, Osaka City University, Sumiyoshi-ku, Osaka
558-8585,1 and Department of Safety
Research on Biologics, National Institute of Infectious Diseases, 4-7-1 Gakuen, Musashimurayama, Tokyo, 208-0011,3
Japan, and Hygiene-Institut, Abt. Hygiene und Medizinische
Mikrobiologie, Universität Heidelberg, 69120 Heidelberg,
Germany2
Received 28 September 2000/Accepted 14 November 2000
 |
ABSTRACT |
A method was developed for protein localization in Mycoplasma
pneumoniae by immunofluorescence microscopy. The P1 adhesin protein was revealed to be located at least at one cell pole in all
adhesive cells, as has been observed by immunoelectron microscopy. Cell
images were classified according to P1 localization and assigned by DNA
content. Cells with a single P1 focus at one cell pole had a lower DNA
content than cells with two foci, at least one of which was positioned
at a cell pole. Those with one focus at each cell pole had the highest
DNA content, suggesting that the nascent attachment organelle is formed
next to the old one and migrates to the opposite cell pole before cell
division. Double staining revealed that the accessory proteins for
cytadherence
HMW1, HMW3, P30, P90, P40, and P65
colocalized
with the P1 adhesin in all cells. The localization of
cytadherence proteins was also examined in
cytadherence-deficient mutant cells with a branched morphology. In
M5 mutant cells, which lack the P90 and P40 proteins, HMW1, HMW3,
P1, and P30 were focused at the cell poles of short branches, and P65
showed no signal. In M7 mutant cells, which produce a truncated P30
protein, HMW1, HMW3, P1, P90, and P40 were focused, and P65 showed no
signal. In M6 mutant cells, which express no HMW1 and a truncated P30
protein, the P1 adhesin was distributed throughout the entire cell
body, and no signal was detected for the other proteins. These results
suggest that the cytadherence proteins are sequentially
assembled to the attachment organelle with HMW1 first, HMW3, P1, P30,
P90, and P40 next, and P65 last.
 |
INTRODUCTION |
Mycoplasmas are parasitic bacteria
with a small genome size and no peptidoglycan layer (36).
Several mycoplasmas have terminal structures which enable them to
adhere to the host cell surface for colonization and nutrient
acquisition. The terminal structure of Mycoplasma
pneumoniae, designated the attachment organelle, has been well
described (19, 20). It is a membrane protrusion supported
by a cytoskeleton-like structure and characterized by a dense cluster
of the adhesin protein known as P1 (35).
Electron microscopic images have suggested that M. pneumoniae cells divide by binary fission and that the formation
and migration of the attachment organelle are coordinated with the cell
division process (6). However, the actual order of cell
images relative to the cell cycle must be known, and information about
the timing of DNA replication is required, in order to substantiate
this model. In previous works we quantified and localized the
chromosomal DNA through the observation of
4',6'-diamidino-2-phenylindole (DAPI)-stained cells of Mycoplasma
capricolum by fluorescence microscopy (40, 41). This
technique may also be useful for examining the cell division process of
M. pneumoniae, although it does not provide the required
information about the position of the attachment organelle. Recently,
immunofluorescence microscopy was used to study the subcellular
localization of bacterial proteins (27). This
technique, combined with DAPI staining, may provide the crucial
information for elucidating the cell reproduction scheme of mycoplasmas.
Several proteins including P1 adhesin, are thought to be essential for
cytadherence, and some of them have been observed by immunoelectron
microscopy to localize at the attachment organelle (19, 20,
35). However, we have little information about the localizing
order and hierarchy of these proteins. The use of immunofluorescence
microscopy in addition to electron microscopy might contribute to the
study of this area, because fluorescence microscopy provides quick,
sensitive, and quantitative analyses, including double staining.
We have developed a method for immunofluorescence microscopy of
M. pneumoniae with staining of the cytadherence proteins and the chromosomal DNA. We demonstrated that the formation and migration of the attachment organelle were coordinated with the cell division process; furthermore, we describe the order of assembly of the cytadherence proteins into the attachment organelle.
 |
MATERIALS AND METHODS |
Cultivation.
To begin, 1-ml volumes of frozen stocks of
M. pneumoniae M129 and its mutants were grown in 10 ml of
Aluotto medium (2) for 2 or 3 days at 37°C, using
plastic petri dishes and glass flasks, until about 107 to
108 CFU/ml was reached.
Preparation of antisera.
A mouse monoclonal antibody against
P1 and rabbit polyclonal antibodies against other cytadherence proteins
were kindly provided by P.-C. Hu and R. Herrmann, respectively
(15, 22, 23, 32, 33). A mouse polyclonal antibody against
the HU protein of M. pneumoniae was prepared by the
following method. A fragment encoding the HU gene of M. pneumoniae (G12_orf109) was amplified by PCR from the chromosomal
DNA with primers GGCCATGGAAAAAACAACAACATCG and
CCAAGCTTAGTCTGCGTATTTCCAGCGT. This fragment codes for all 109 amino acid residues of the putative HU protein. The PCR product was
digested with NcoI and HindIII and then
inserted into the expression vector pET-30c(+) (Novagen, Madison,
Wis.). The resulting plasmid, pET-HMp, was transformed into
Escherichia coli BL21 (DE3) and induced with
isopropyl-
-D-thiogalactopyranoside (IPTG). The histidine-tagged HU protein was purified with a
Ni2+-nitrilotriacetic acid column under denaturing
conditions according to the manufacturer's instructions. An antiserum
against the HU protein was prepared in mice as described previously,
(39). The specificity of serum was checked by immunoblot
analysis (data not shown) (T. Kenri, T. Sasaki, and Y. Kano, Abstr.
12th Int. Cong. Int. Org. Mycoplasmol., abstr. D33, p. 137 [IOM Lett., vol. 5], 1998).
Immunofluorescence staining.
An immunofluorescence staining
method was developed by modifying an approach designed for E. coli (1). At mid-log phase, liquid medium was
replaced with fresh medium. The cells adhering to the bottom of the
petri dishes were scraped into the fresh medium, recovered with the
medium, passed through a 25-gauge needle several times, and filtered
through a nitrocellulose membrane (pore size, 0.45 µm) to disperse
cell aggregates (37). Cell suspensions were placed on
coverslips for 1 to 4 h at 37°C. For cytadherence-deficient
mutants, mid-log-phase cultures were suspended and filtered, and cell
suspensions were placed on poly-L-lysine coated coverslips,
because the mutant cells used in this study cannot bind to the glass
surface and poly-L-lysine allows their attachment
(14, 22, 24, 25). The medium was removed, and the cells
bound to the coverslips were washed three times with phosphate-buffered
saline (PBS). A fixation solution of 500 µl containing 3.0%
paraformaldehyde (wt/vol) and 0.1% glutaraldehyde (vol/vol) in PBS was
placed on the coverslip, and the cells were then incubated first for 10 min at room temperature and then for 50 min at 4°C. The cells were
washed three times with PBS, overlaid with a permeabilizing solution
containing 0.1% Triton X-100 (vol/vol) in PBS, and then incubated for
5 min at room temperature. The cells were again washed three times with
PBS and were allowed to dry completely. Rehydration with PBS was
carried out at room temperature for 5 min; then the PBS was replaced by
a blocking solution containing 2% bovine serum albumin (BSA) (wt/vol)
in PBS (PBS-BSA), and the cells were incubated for 10 min at room temperature. The PBS-BSA was removed, and the coverslips were incubated
with antibodies and antisera diluted in PBS-BSA. A 2,000-fold dilution
was used for the anti-P1 monoclonal antibody; a 200-fold dilution was
used for the anti-HMW1, anti-HMW3, and anti-P30 antisera; a 100-fold
dilution was used for the anti-P90, anti-P40, and anti-P65 antisera;
and a 50-fold dilution was used for the anti-HU antiserum. After
incubation for 60 min at room temperature, the cells were washed 10 times with PBS and then incubated with 1,000-fold-diluted goat
anti-mouse or anti-rabbit antibodies labeled with Alexa 488 or Alexa
546 (Molecular Probes, Eugene, Oreg.) in PBS-BSA. After incubation for
60 min at room temperature in the dark, the cells were washed 10 times
with PBS. For double staining, fixation of antibodies was carried out
by incubation with 3.0% paraformaldehyde in PBS for 30 min at 4°C,
and then the cells were washed five times with PBS before the second
staining. The coverslips were mounted onto glass slides with 40%
glycerol (vol/vol) containing 10 µg of DAPI/ml and were stored at
20°C if necessary. The cells were observed and photographed with an
Olympus BX50 microscope using Fuji Super G400 (ISO 400) 35-mm film.
Image files were produced by a personal computer equipped with a
GT-9000 (Epson, Tokyo, Japan) flatbed scanner and a QuickScan 35 (Minolta, Osaka, Japan) film scanner.
Measurement of DNA content.
Cells stained with DAPI and an
anti-P1 antibody were observed with the fluorescence microscope
equipped with a charge-coupled device camera (WV-BP510; Panasonic,
Osaka, Japan). The cell images were recorded with a digital
videocassette recorder (WV-D9000; SONY, Tokyo, Japan), transferred to
computer image files through an image capture card (DVRapter; Canopus,
Kobe, Japan), and then analyzed by Scion Image PC beta 3 software. The
fluorescence intensities of DAPI were measured by using the command
"analyze particles" and taken as measurements of the DNA contents
of individual cells. The fluorescence intensities of actual DAPI images
were confirmed to be in the range of linearity of measurement by using
Inspeck Microscope Image Intensity Calibration Kits (Molecular Probes).
 |
RESULTS |
Subcellular localization of the attachment organelle.
Immunofluorescence microscopy was used to localize the attachment
organelle in M. pneumoniae cells. Since the attachment
organelle is characterized by dense clusters of the P1 adhesin
(35), we used P1 protein as a marker for the attachment
organelle (Fig. 1A to E). Cells were
fixed, permeabilized, stained with an anti-P1 antibody and DAPI, and
then observed by fluorescence microscopy. A filamentous cell morphology
was observed, as described previously (6, 19), while a
small population of cells showed a flask shape. Immunofluorescence
staining with an anti-P1 antibody revealed that at least one
fluorescent focus was located at the end of a cell pole in all cells,
with a slight distribution along the lateral cell extension, as has
been reported in immunoelectron microscopic studies (3, 10,
15). DAPI staining occurred throughout the whole cell body. We
tried phase-combined fluorescence microscopy to reduce the fluorescence
intensity and localize the nucleoid as was done for M. capricolum (41), but the nucleoid was found to occupy
almost the entire cell body (data not shown).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 1.
Subcellular localization of P1 adhesin (A to E) and HU
protein (F to H) in M. pneumoniae. Cells were fixed,
permeabilized, and stained with antibodies and DAPI. (A) DAPI-stained
image; (B) anti-P1 antibody-stained image; (C) phase-contrast image;
(D) merge of P1 and DAPI staining; (E) merge of P1 staining and
phase-contrast image; (F) anti-HU antibody-staining image; (G)
DAPI-staining image; (H) merge of HU and DAPI staining. Bar, 2 µm.
|
|
HU is a histone-like protein associated with the bacterial chromosome
(
9,
16,
18). As a control experiment, the localization
of
HU was examined (Fig.
1F to H). The fluorescent signal of the
anti-HU
protein antibody was located at the same position as the
nucleoid
stained with DAPI, which was different from that of the
P1 adhesin.
These results suggest that the subcellular localization
of mycoplasma
proteins can be visualized by immunofluorescence
microscopy.
Cell typing based on the attachment organelle localization.
The images of cells stained for the P1 adhesin and DNA were classified
into four types based on P1 localization (Fig.
2). The first type is a cell with a
single P1 focus at one cell pole. The second has two P1 foci at one
cell pole. The third has two P1 foci, only one of which is positioned
at a cell pole. The fourth has one P1 focus at each cell pole. All cell
images were classified as one of these four types; the proportions were
67.0, 5.5, 11.2, and 16.3%, respectively. The cells with two foci,
only one of which was positioned at a cell pole, appeared to possess a
bifurcated cell pole or a short branch along the lateral cell body, as
described previously (6, 19). All cell images except the
fourth type contained a single nucleoid, while three-quarters of the
cells with one focus at each cell pole had two partitioned nucleoids. To address the question of subcellular positioning of the attachment organelle during the cell division process, the DNA contents of the
individual cells were examined (Fig. 3).
Assuming that the DNA content increases continuously during the cell
division process (40, 41), cell images can be placed in
the actual order of the process according to their DNA contents. The
DNA contents of individual cell images showed a relationship with the
cell types, i.e., those with one P1 focus at one cell pole, two P1 foci
but not at both cell poles, and one P1 focus at each cell pole had
0.84, 1.04, and 1.48 times the average of total DNA content, respectively. The DNA content did not differ between cells with two
foci at one cell pole and those with two foci, only one of which was
positioned at a cell pole (data not shown). These results suggest that
the nascent attachment organelle is formed next to the old one and that
one organelle migrates to the opposite end before chromosome
partitioning and cell division.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 2.
Cell image typing based on P1 localization. The upper
and lower sections of each block show merges of P1 and DAPI staining
and of P1 staining and phase-contrast images, respectively. Shown are
cell images with a single focus at one cell pole (A), with two foci at
one of the cell poles (B), with two foci, one of which is positioned at
a distance from the cell poles (C), and with one focus at each cell
pole (D). Bar, 1 µm.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3.
DNA contents in individual cells of each type. (A) Cells
with one P1 focus; (B) cells with two P1 foci, which are not positioned
at both cell poles; (C) cells with one focus at each cell pole.
Arrowhead indicates the average DNA content in the respective cell
type. The average total DNA content of all cells was normalized to 1 U.
|
|
Subcellular localization of cytadherence accessory proteins.
Several proteins, including the P1 adhesin, are thought to be essential
for cytadherence, and HMW1, HMW3, P30, and P90 have been observed by
immunoelectron microscopy to localize around the attachment organelle
(4, 12, 44). However, we do not have adequate information
on whether these proteins are always found at the attachment organelle,
which is needed to address the order and hierarchy of assembly of
cytadherence proteins. We used the immunofluorescence microscopic
procedure described here to localize the cytadherence accessory
proteins, i.e., the HMW1, HMW3, P30, P90, P40, and P65 proteins (Fig.
4). All the proteins involved were
localized as one or two fluorescent foci at cell poles, a pattern
similar to that seen with the P1 adhesin. The fluorescent foci of the
HMW1, HMW3, and P30 proteins were obviously more condensed than those
of P1. Those of P90, P40, and P65 were primarily located at cell poles,
with some distribution along the cell extension. To examine the
subcellular localization of these cytadherence accessory proteins, a
double-staining procedure for the cytadherence accessory proteins and
the P1 adhesin was carried out (Fig. 4). Most of the protein foci were
found at the position where P1 adhesin was densely localized,
suggesting that the localization of accessory proteins to the
attachment organelle occurs in a short period in the cell reproduction
cycle.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Subcellular localization of cytadherence accessory
proteins. The left and middle columns in each panel show the same cells
stained for accessory proteins and P1 adhesin, respectively. The right
columns show these images merged. Bar, 2 µm.
|
|
Subcellular localization of cytadherence proteins in
cytadherence-deficient mutants.
To examine the localization
dependence of cytadherence proteins, their subcellular localization was
analyzed in cytadherence-deficient mutants. One
cytadherence-deficient mutant, M5, does not express either the
P90 or the P40 protein (22). Phase-contrast microscopy showed that most mutant cells had branched shapes. DAPI staining of
mutant cells revealed that the nucleoids were distributed
throughout the entire cell body, including the branches (Fig.
5). Staining of the P90 and P40 proteins
produced no signal, as expected (data not shown). Fluorescent foci of
the HMW1, HMW3, P1, and P30 proteins were found at the poles of short
branches. Staining of P65 resulted in faint fluorescence, while no
change was detected in the protein expression level of P65 by
immunoblot analysis (data not shown). These results suggest that P65
requires the function of P90 and/or P40 for subcellular localization
but that the HMW1, HMW3, and P1 proteins do not.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 5.
Subcellular localization of cytadherence proteins in M5
mutant cells. Cells were stained with antibodies to the cytadherence
proteins indicated (upper panels), and these images were then overlaid
with DAPI staining images (lower panels). Bar, 1 µm.
|
|
In the M7 mutant, which expresses a truncated 22-kDa product of the
p30 gene (
25), most cells displayed a branched
morphology.
The nucleoid was distributed throughout the entire cell
body,
including the branches, as observed in the M5 mutant (Fig.
6).
In the M7 mutant, the cytadherence
proteins HMW1, HMW3, P1, P90,
and P40 were recognized as fluorescent
foci located at short branch
poles. Staining of P65 produced no signal,
while the level of
the P65 protein observed by immunoblot analysis was
similar to
that of the wild-type strain (data not shown). The anti-P30
antibody
we used has been reported to recognize the truncated 22-kDa
protein
of M7 mutant cells (
25), and the truncated protein
band was
detected by immunoblotting, with an intensity similar to that
of P30 in the wild-type strain, but no fluorescent signals were
detected for the truncated P30 proteins (data not shown). These
results
suggest that the subcellular localization of the P65 and
P30 proteins
requires the proline-rich repeat sequences in the
C-terminal part of
the P30 protein missing in the M7 mutant but
that the HMW1, HMW3, P1,
P90, and P40 proteins can localize and
assemble without them.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 6.
Subcellular localization of cytadherence proteins in M7
mutant cells. Cells were stained with antibodies to the cytadherence
proteins indicated (upper panels), and these images were then overlaid
with DAPI-staining images (lower panels). Bar, 1 µm.
|
|
The M6 mutant cannot synthesize HMW1 protein because of a frameshift
mutation, and it produces a 25-kDa protein product of
the truncated
p30 gene (
24). Phase-contrast microscopy showed
branched cells, as has been reported previously (
14), and
DAPI
staining showed that the nucleoids occupied the entire cell body,
including the branches (Fig.
7).
Immunofluorescence staining for
the HMW3, P90, P40, and P65 proteins
did not produce signals while
the P1 adhesin was distributed throughout
the entire cell body.
Staining of P30 yielded no signal, although the
antibody can detect
the truncated protein by immunoblot analysis
(
24), and the truncated
protein band was detected by
immunoblotting, with an intensity
similar to that of P30 in the
wild-type strain (data not shown).
The steady-state levels of
cytadherence proteins were not affected
in the M6 mutant in comparison
to the wild-type strain (data not
shown), indicating that the loss of
function of HMW1 and P30 has
no effect on the stability of these
proteins. Considering the
results for the M7 mutant, where the
truncation of P30 had no
effect on the localization of
cytadherence-associated proteins
(Fig.
6 and Table
1) the results for the M6 mutant suggest
that
the HMW1 protein is essential for the subcellular localization
of
HMW3, P1, P90, P40, and P65.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 7.
Subcellular localization of cytadherence proteins in M6
mutant cells. Cells were stained with antibodies to the cytadherence
proteins indicated (upper panels), and these images were then overlaid
with DAPI-staining images (lower panels). Bar, 1 µm.
|
|
To address the possibility that the missing of some protein signals in
mutants was caused by loss of proteins in the staining
process, we
examined whether the proteins were removed in the
procedure. The
wild-type and mutant cells were collected, suspended
in PBS, and
subjected to the same procedure as that for fluorescence
staining
except that the cells were treated in suspensions and
were not
incubated with antibodies. The fixed cells, Triton extracts,
and final
cell suspensions were analyzed by indirect enzyme-linked
immunosorbent
assay (ELISA) for the detection of all the cytadherence
proteins that
we studied except P90 and P40 in the M5 mutant and
HMW1 in the M6
mutant. The results did not depend on the protein
or the strains. The
final cell suspensions showed ELISA signals
with levels equivalent to
those for the fixed cells, and the Triton
extracts showed negligible
signals (data not shown). We also analyzed
the content of P65 by
immunoblotting. The cells fixed with 3%
paraformaldehyde were treated
in suspension by the same procedure
as that for immunofluorescence
staining but without the addition
of antibodies. The cross-linking was
removed as previously reported
(
26), and immunoblotting
was performed. The final cell suspensions
showed bands with intensities
more than 90% of those for the fixed
cell suspensions in all strains
(data not
shown).
 |
DISCUSSION |
In this study, we developed an immunofluorescence microscopy
technique for the visualization of the M. pneumoniae
attachment organelle during cell division and for the subcellular
localization of individual cytadherence-associated proteins.
Fluorescent foci of the P1 adhesin were recognized by an
immunofluorescence staining method described by Feldner et al.
(10). We applied this procedure to the other
cytadherence-associated proteins by using specific antibodies but
failed to stain the cells. Presumably, the topology of the P1 adhesin,
which projects from the cell membrane, confers an advantage for this
type of assay. Therefore, we had to develop a method applicable to all
kinds of mycoplasma proteins. Basically, we used the staining procedure
for walled bacteria and modified it so as to avoid breakage of the cell
structure, which might be caused by centrifugation. Mycoplasma cells
were allowed to adhere to coverslips and fixed. Permeabilization was
done with Triton X-100 without pretreatment by lysozyme because of the
complete lack of the peptidoglycan layer in mycoplasmas. The
permeabilization step is indispensable for efficient staining, because
some of the cytadherence-associated proteins were not detected
reproducibly without it (data not shown).
Previously, we demonstrated that M. capricolum cells divide
into two daughter cells by binary fission with accurate partition of
the replicated chromosomes (29, 40, 41). In this study, we
observed that M. pneumoniae nucleoids could be stained with DAPI (Fig. 1). The nucleoids occupied the whole cell interior, and no
condensation was observed, even when phase-combined fluorescence microscopy, which can reduce the fluorescence intensity and localize the nucleoid, was used. However, the nucleoid images suggest that the
daughter cells receive an equal amount of DNA at binary fission in
M. pneumoniae, because the standard deviation of DNA content was 0.35 of the average, indicating that the highest content was close
to twice that of the lowest.
The electron microscopic images of M. pneumoniae suggest
that the formation and migration of the attachment organelle are coordinated with cell division (6). However, more
information is needed for the models to be substantiated adequately. We
classified the cell images by the position of the attachment organelle
and assigned them by their DNA contents (Fig. 2 and 3). This ordering can provide a model for the coupling of the attachment organelle formation and cell division (Fig. 8). At
the first stage, the nascent attachment organelle is formed next to the
old one. Next, one of the attachment organelles migrates to the
opposite end along the lateral cell body, and then nucleoid
partitioning and cell division occur. Boatman observed cells possessing
two attachment organelles adjacent to one another at one cell pole and
cells possessing one attachment organelle at each cell pole by electron microscopy of M. pneumoniae (6). Bredt observed
that bifurcation of one cell pole occurred at the first step of cell
division in living cells (7). Our present model of the
formation and migration of the attachment organelle in M. pneumoniae is consistent with Bredt's observations.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 8.
Model for cell division scheme in M. pneumoniae in relation to the formation and migration of
attachment organelles.
|
|
What motive force propels the attachment organelle? One possibility is
gliding motility, by which some mycoplasmas, including M. pneumoniae, slide on solid surfaces towards the attachment organelle (17, 38). Considering that the attachment
organelle is the leading end for gliding motility, gliding motility
might be involved in the migration of the attachment organelle.
Actually, Bredt observed that gliding cells of M. pneumoniae
showed binary fission and that the bifurcation of the cell pole
occurred during gliding motility (7). Another possibility
might be the involvement of filamentous structures in the division
process. These structures, which are composed of protein, can be
observed in detergent-treated M. pneumoniae cells (13,
28, 30). They may maintain the extension of the attachment
organelle and promote its migration by polymerization and
depolymerization of the protein monomers.
A phenomenon analogous to the behavior of the attachment organelle
(Fig. 8) is reported for the origin of replication of the chromosome in
walled bacteria (27). The origin is replicated near a cell
pole, after which one copy migrates to the opposite pole in a stage of
chromosome partitioning. Movement from one pole to the other during
cell reproduction may be a common phenomenon in a wide variety of
bacteria. The attachment organelle of Mycoplasma gallisepticum has been suggested to bind chromosomal DNA
(34). It is possible that the attachment organelle also
works for chromosome partitioning in mycoplasmas.
In addition to the P1 adhesin, several other proteins are thought to be
essential for cytadherence activity, and for most of them, subcellular
localization has been examined by immunoelectron microscopy (19,
20). In this study, we examined the subcellular localization of
cytadherence proteins HMW1, HMW3, P30, P90, P40, and P65 by
immunofluorescence microscopy (Fig. 4). Although the intensity and
condensation of fluorescence were not uniform, all proteins involved
were localized to regions overlapping the P1 adhesin. The results
suggest that these proteins are components of the attachment organelle
and that localization is characteristic for each individual protein.
Our results concerning the location of the HMW3, P30, and P90 proteins
are consistent with those described previously (4, 12,
44). Stevens and Krause reported that the HMW1 protein is
sometimes found at the cell extension of the other pole as well as at
the cell extension of the attachment organelle (20, 43).
However, our observation by immunofluorescence microscopy revealed that
all fluorescent foci of the HMW1 protein were found at the attachment
organelle (Fig. 4). The subcellular localizations of P40 and P65 have
not yet been precisely elucidated, although chemical cross-linking
studies suggest that they are associated with the attachment organelle
(23, 26). Our observations support the results obtained by
cross-linking studies.
Most cells of the M6 mutant demonstrated branched structures, as
observed previously (14, 37). A similar morphology was observed for most M5 and M7 mutant cells (Fig. 5 and 6). The branched structure of the M7 mutant is consistent with a previous report that
disruption of the p30 gene induces branch formation
(14, 37). Assuming that the branch is a form of
incorrectly located cell extension of the attachment organelle, these
observations suggest that P30, P90, and P40 are not involved in the
cell extension formation. In the M6 mutant, the clustering of all
cytadherence-associated proteins in a certain region of the cell was
completely lost, but branches were formed (Fig. 6), suggesting that the
other cytadherence proteins, including HMW1, HMW3, P1, or P65, are not
necessary for cell extension formation, either.
Aberrant cell morphology coupled with cell adhesion deficiency is also
reported for Mycoplasma mobile (30). Four of 10 mutants isolated based on gliding motility were revealed to have
deficiencies in both adhesion and normal formation of a "head-like
structure" which is believed to have a function similar to that of
the attachment organelle of M. pneumoniae. Abnormal
formation of the cell shape may cause incorrect assignment of
cytadherence proteins, resulting in adherence deficiency in these types
of mutants.
What mechanism is involved in multibranching? Previously, we
demonstrated that multibranched cell morphology is induced by nucleoside starvation in M.capricolum (40). We
proposed a branching scheme whereby nucleoids which remain at the
division site inhibit constriction and division potential: cytoskeleton
and lipid synthesis, for instance, induce the development of new
branches (29, 40, 41). It is possible that the abnormal
formation of the attachment organelle affects the process of cell
division in the cytadherence mutants and causes branching. Another
possibility is that P30, P90, and P40 participate directly in the
inhibition of branch formation. Detergent-treated and sectioned images
of M. pneumoniae suggest that the extended structure of the
attachment organelle is supported by an electron-dense core anchoring
to the end of the attachment organelle, which has been designated the
terminal button (5, 13, 28, 45) and suggested to include
HMW3 as a component (44). The electron-dense core may be
anchored to the terminal button by the functions of the P30, P90, and
P40 proteins in wild-type cells. According to this model, the loss of
these proteins induces the release and abnormal arrangement of the
electron-dense cores in the mutants.
To investigate the effect of the loss of particular cytadherence
proteins on the location of other proteins involved in the attachment
process, their localization was examined in cytadherence-deficient mutants by the same staining procedure that was used for wild-type cells, and it was found that the signals of some proteins could not be
detected in the mutants (Fig. 5, 6, and 7). Titration of these proteins
using an indirect ELISA and immunoblotting showed that the
disappearance of fluorescent signals for cytadherence-associated proteins was not caused by loss of proteins in the staining process. Presumably, it was caused by the dispersion of protein molecules, i.e.,
the signals were detectable only when they were concentrated at small
spots over the detection threshold. P1 adhesin signals were detected in
the entire cell bodies of the M6 mutant and did not depend on the
source of the antibody, i.e., mouse monoclonal or rabbit polyclonal
antibodies (data not shown), suggesting that these signals are far more
intense than those of other proteins, a fact which is related to the
antigenic character of the P1 adhesin.
As summarized in Table 1, HMW1 protein is essential for the
localization of the other cytadherence proteins, while P65 requires all
other proteins. This is consistent with a previous report showing a
requirement of HMW1 for P1 localization (14). Baseman et
al. examined P1 adhesin localization in a class III mutant possessing a
genetic background similar to that of the M5 mutant, but they could not
find a P1 adhesin cluster (3), unlike our result (Fig. 5).
Possibly, this discrepancy is due to the increased sensitivity of
immunofluorescence microscopy compared to that of immunoelectron
microscopy. An analogous phenomenon has been reported for the
localization of FtsZ protein, a bacterial cytoskeletal protein
(1). Alternatively, genetic difference may exist between the M5 mutant and the strain used by Baseman et al. which apparently have very similar backgrounds. P40 and P90 have been reported to be
essential for the association of P1 with the Triton shell (22). Considering this observation, our results may
suggest that the P1 protein can assemble independently from the
association of P1 with the Triton shell.
Our results show that proteins HMW3, P1, P30, P90, and P40 can assemble
independently of each other. Focusing on protein assembly, our results
suggest the sequential assembly of cytadherence proteins to form the
attachment organelle (Fig. 9). During the
formation of the attachment organelle, the HMW1 protein may be
translocated first, followed by assembly of the HMW3 protein, P1, P30,
P90, and P40. P65 might be the last component which localizes to the attachment organelle. This assembly sequence may be related to the
observations made by electron microscopy that the cell poles of
hmw1 mutants are round and different from those of wild-type and p30 mutant strains (14, 37). The control
mechanism of the HMW1 protein is not known, but phosphorylation
(8, 21) and degradation dependent on HMW2 (11,
31) have been reported. Caulobacter crescentus, which
presents a distinct cell cycle, controls the function of CtrA, the key
protein for cell differentiation, by protein phosphorylation and
degradation (42). It is possible that M. pneumoniae has a similar mechanism to control HMW1 protein.
 |
ACKNOWLEDGMENTS |
We are grateful to P.-C.Hu of the University of North Carolina
and to R. Herrmann of the Universität Heidelberg for the
antibodies to mycoplasma proteins.
This work was partly supported by a Sasakawa Scientific Research Grant
to S.S., a Grant-in-Aid for Scientific Research (A) from the Ministry
of Education, Science, Sports, and Culture to M.M., and a Grant-in-Aid
for Scientific Research (C) from the Japan Society for the Promotion of
Science to M.M.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, Graduate School of Science, Osaka City University,
Sumiyoshi-ku, Osaka 558-8585, Japan. Phone 81(6)6605 3157. Fax:
81(6)6605 2522. E-mail: miyata{at}sci.osaka-cu.ac.jp.
Present address: Procter & Gamble Pharmaceuticals, Health Care
Research Center, Mason, OH 45040.
 |
REFERENCES |
| 1.
|
Addinall, S. G.,
E. Bi, and J. Lutkenhaus.
1996.
FtsZ ring formation in fts mutants.
J. Bacteriol.
178:3877-3884[Abstract/Free Full Text].
|
| 2.
|
Aluotto, B. B.,
R. G. Wittler,
C. O. Williams, and J. E. Faber.
1970.
Standardized bacteriologic techniques for the characterization of mycoplasma species.
Int. J. Syst. Bacteriol.
20:35-58[Abstract/Free Full Text].
|
| 3.
|
Baseman, J. B.,
R. M. Cole,
D. C. Krause, and D. K. Leith.
1982.
Molecular basis for cytadsorption of Mycoplasma pneumoniae.
J. Bacteriol.
151:1514-1522[Abstract/Free Full Text].
|
| 4.
|
Baseman, J. B.,
J. Morrison-Plummer,
D. Drouillard,
B. Puleo-Scheppke,
V. V. Tryon, and S. C. Holt.
1987.
Identification of a 32-kilodalton protein of Mycoplasma pneumoniae associated with hemadsorption.
Isr. J. Med. Sci.
23:474-479[Medline].
|
| 5.
|
Biberfeld, G., and P. Biberfeld.
1970.
Ultrastructural features of Mycoplasma pneumoniae.
J. Bacteriol.
102:855-861[Abstract/Free Full Text].
|
| 6.
|
Boatman, E. S.
1979.
Morphology and ultrastructure of the mycoplasmatales, p. 63-102.
In
M. F. Barile, and S. Razin (ed.), The mycoplasmas, vol. I. Academic Press, New York, N.Y.
|
| 7.
|
Bredt, W.
1968.
Motility and multiplication of Mycoplasma pneumoniae. A phase contrast study.
Pathol. Microbiol.
32:321-326[CrossRef].
|
| 8.
|
Dirksen, L. B.,
K. A. Krebes, and D. C. Krause.
1994.
Phosphorylation of cytadherence-accessory proteins in Mycoplasma pneumoniae.
J. Bacteriol.
176:7499-7505[Abstract/Free Full Text].
|
| 9.
|
Drlica, K., and J. Rouviere-Yaniv.
1987.
Histone-like proteins of bacteria.
Microbiol. Rev.
51:301-319[Free Full Text].
|
| 10.
|
Feldner, J.,
U. Göbel, and W. Bredt.
1982.
Mycoplasma pneumoniae adhesin localized to tip structure by monoclonal antibody.
Nature
298:765-767[CrossRef][Medline].
|
| 11.
|
Fisseha, M.,
H. W. Göhlmann,
R. Herrmann, and D. C. Krause.
1999.
Identification and complementation of frameshift mutations associated with loss of cytadherence in Mycoplasma pneumoniae.
J. Bacteriol.
181:4404-4410[Abstract/Free Full Text].
|
| 12.
|
Franzoso, G.,
P. C. Hu,
G. A. Meloni, and M. F. Barile.
1993.
The immunodominant 90-kilodalton protein is localized on the terminal tip structure of Mycoplasma pneumoniae.
Infect. Immun.
61:1523-1530[Abstract/Free Full Text].
|
| 13.
|
Göbel, U.,
V. Speth, and W. Bredt.
1981.
Filamentous structures in adherent Mycoplasma pneumoniae cells treated with nonionic detergents.
J. Cell Biol.
91:537-543[Abstract/Free Full Text].
|
| 14.
|
Hahn, T. W.,
M. J. Willby, and D. C. Krause.
1998.
HMW1 is required for cytadhesin P1 trafficking to the attachment organelle in Mycoplasma pneumoniae.
J. Bacteriol.
180:1270-1276[Abstract/Free Full Text].
|
| 15.
|
Hu, P. C.,
R. M. Cole,
Y. S. Huang,
J. A. Graham,
D. E. Gardner,
A. M. Collier, and W. A. Clyde, Jr.
1982.
Mycoplasma pneumoniae infection: role of a surface protein in the attachment organelle.
Science
216:313-315[Abstract/Free Full Text].
|
| 16.
|
Kenri, T.,
T. Sasaki, and Y. Kano.
1998.
Identification and characterization of HU protein from Mycoplasma gallisepticum.
Biochem. Biophys. Res. Commun.
249:48-52[CrossRef][Medline].
|
| 17.
|
Kirchhoff, H.
1992.
Motility, p. 289-306.
In
J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas molecular biology and pathogenesis. American Society for Microbiology, Washington, D.C.
|
| 18.
|
Köhler, P., and M. A. Marahiel.
1997.
Association of the histone-like protein HBsu with the nucleoid of Bacillus subtilis.
J. Bacteriol.
179:2060-2064[Abstract/Free Full Text].
|
| 19.
|
Krause, D. C.
1998.
Mycoplasma pneumoniae cytadherence: organization and assembly of the attachment organelle.
Trends Microbiol.
6:15-18[CrossRef][Medline].
|
| 20.
|
Krause, D. C.
1996.
Mycoplasma pneumoniae cytadherence: unraveling the tie that binds.
Mol. Microbiol.
20:247-253[CrossRef][Medline].
|
| 21.
|
Krebes, K. A.,
L. B. Dirksen, and D. C. Krause.
1995.
Phosphorylation of Mycoplasma pneumoniae cytadherence-accessory proteins in cell extracts.
J. Bacteriol.
177:4571-4574[Abstract/Free Full Text].
|
| 22.
|
Layh-Schmitt, G., and M. Harkenthal.
1999.
The 40- and 90-kDa membrane proteins (ORF6 gene product) of Mycoplasma pneumoniae are responsible for the tip structure formation and P1 (adhesin) association with the Triton shell.
FEMS Microbiol. Lett.
174:143-149[CrossRef][Medline].
|
| 23.
|
Layh-Schmitt, G., and R. Herrmann.
1994.
Spatial arrangement of gene products of the P1 operon in the membrane of Mycoplasma pneumoniae.
Infect. Immun.
62:974-979[Abstract/Free Full Text].
|
| 24.
|
Layh-Schmitt, G.,
H. Hilbert, and E. Pirkl.
1995.
A spontaneous hemadsorption-negative mutant of Mycoplasma pneumoniae exhibits a truncated adhesin-related 30-kilodalton protein and lacks the cytadherence-accessory protein HMW1.
J. Bacteriol.
177:843-846[Abstract/Free Full Text].
|
| 25.
|
Layh-Schmitt, G.,
R. Himmelreich, and U. Leibfried.
1997.
The adhesin related 30-kDa protein of Mycoplasma pneumoniae exhibits size and antigen variability.
FEMS Microbiol. Lett.
152:101-108[CrossRef][Medline].
|
| 26.
|
Layh-Schmitt, G.,
A. Podtelejnikov, and M. Mann.
2000.
Proteins complexed to the P1 adhesin of Mycoplasma pneumoniae.
Microbiology
146:741-747[Abstract/Free Full Text].
|
| 27.
|
Margolin, W.
1998.
A green light for the bacterial cytoskeleton.
Trends Microbiol.
6:233-238[CrossRef][Medline].
|
| 28.
|
Meng, K. E., and R. M. Pfister.
1980.
Intracellular structures of Mycoplasma pneumoniae revealed after membrane removal.
J. Bacteriol.
144:390-399[Abstract/Free Full Text].
|
| 29.
|
Miyata, M., and S. Seto.
1999.
Cell reproduction cycle of mycoplasma.
Biochimie
81:873-878[Medline].
|
| 30.
|
Miyata, M.,
H. Yamamoto,
T. Shimizu,
A. Uenoyama,
C. Citti, and R. Rosengarten.
2000.
Gliding mutants of Mycoplasma mobile: relationships between motility and cell morphology, cell adhesion and microcolony formation.
Microbiology
146:1311-1320[Abstract/Free Full Text].
|
| 31.
|
Popham, P. L.,
T. W. Hahn,
K. A. Krebes, and D. C. Krause.
1997.
Loss of HMW1 and HMW3 in noncytadhering mutants of Mycoplasma pneumoniae occurs post-translationally.
Proc. Natl. Acad. Sci. USA
94:13979-13984[Abstract/Free Full Text].
|
| 32.
|
Proft, T., and R. Herrmann.
1994.
Identification and characterization of hitherto unknown Mycoplasma pneumoniae proteins.
Mol. Microbiol.
13:337-348[Medline].
|
| 33.
|
Proft, T.,
H. Hilbert,
G. Layh-Schmitt, and R. Herrmann.
1995.
The proline-rich P65 protein of Mycoplasma pneumoniae is a component of the Triton X-100-insoluble fraction and exhibits size polymorphism in the strains M129 and FH.
J. Bacteriol.
177:3370-3378[Abstract/Free Full Text].
|
| 34.
|
Quinlan, D. C., and J. Maniloff.
1972.
Membrane association of the deoxyribonucleic acid growing-point region in Mycoplasma gallisepticum.
J. Bacteriol.
112:1375-1379[Abstract/Free Full Text].
|
| 35.
|
Razin, S., and E. Jacobs.
1992.
Mycoplasma adhesion.
J. Gen. Microbiol.
138:407-422[Free Full Text].
|
| 36.
|
Razin, S.,
D. Yogev, and Y. Naot.
1998.
Molecular biology and pathogenicity of mycoplasmas.
Microbiol. Mol. Biol. Rev.
62:1094-1156[Abstract/Free Full Text].
|
| 37.
|
Romero-Arroyo, C. E.,
J. Jordan,
S. J. Peacock,
M. J. Willby,
M. A. Farmer, and D. C. Krause.
1999.
Mycoplasma pneumoniae protein P30 is required for cytadherence and associated with proper cell development.
J. Bacteriol.
181:1079-1087[Abstract/Free Full Text].
|
| 38.
|
Rosengarten, R., and H. Kirchhoff.
1987.
Gliding motility of Mycoplasma sp. nov. strain 163K.
J. Bacteriol.
169:1891-1898[Abstract/Free Full Text].
|
| 39.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 40.
|
Seto, S., and M. Miyata.
1998.
Cell reproduction and morphological changes in Mycoplasma capricolum.
J. Bacteriol.
180:256-264[Abstract/Free Full Text].
|
| 41.
|
Seto, S., and M. Miyata.
1999.
Partitioning, movement, and positioning of nucleoids in Mycoplasma capricolum.
J. Bacteriol.
181:6073-6080[Abstract/Free Full Text].
|
| 42.
|
Shapiro, L., and R. Losick.
1997.
Protein localization and cell fate in bacteria.
Science
276:712-718[Abstract/Free Full Text].
|
| 43.
|
Stevens, M. K., and D. C. Krause.
1991.
Localization of the Mycoplasma pneumoniae cytadherence-accessory proteins HMW1 and HMW4 in the cytoskeletonlike Triton shell.
J. Bacteriol.
173:1041-1050[Abstract/Free Full Text].
|
| 44.
|
Stevens, M. K., and D. C. Krause.
1992.
Mycoplasma pneumoniae cytadherence phase-variable protein HMW3 is a component of the attachment organelle.
J. Bacteriol.
174:4265-4274[Abstract/Free Full Text].
|
| 45.
|
Wilson, M. H., and A. M. Collier.
1976.
Ultrastructural study of Mycoplasma pneumoniae in organ culture.
J. Bacteriol.
125:332-339[Abstract/Free Full Text].
|
Journal of Bacteriology, March 2001, p. 1621-1630, Vol. 183, No. 5
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.5.1621-1630.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nonaka, T., Adan-Kubo, J., Miyata, M.
(2010). Triskelion Structure of the Gli521 Protein, Involved in the Gliding Mechanism of Mycoplasma mobile. J. Bacteriol.
192: 636-642
[Abstract]
[Full Text]
-
Kuhner, S., van Noort, V., Betts, M. J., Leo-Macias, A., Batisse, C., Rode, M., Yamada, T., Maier, T., Bader, S., Beltran-Alvarez, P., Castano-Diez, D., Chen, W.-H., Devos, D., Guell, M., Norambuena, T., Racke, I., Rybin, V., Schmidt, A., Yus, E., Aebersold, R., Herrmann, R., Bottcher, B., Frangakis, A. S., Russell, R. B., Serrano, L., Bork, P., Gavin, A.-C.
(2009). Proteome Organization in a Genome-Reduced Bacterium. Science
326: 1235-1240
[Abstract]
[Full Text]
-
Bose, S. R., Balish, M. F., Krause, D. C.
(2009). Mycoplasma pneumoniae Cytoskeletal Protein HMW2 and the Architecture of the Terminal Organelle. J. Bacteriol.
191: 6741-6748
[Abstract]
[Full Text]
-
Nakane, D., Miyata, M.
(2009). Cytoskeletal Asymmetrical Dumbbell Structure of a Gliding Mycoplasma, Mycoplasma gallisepticum, Revealed by Negative-Staining Electron Microscopy. J. Bacteriol.
191: 3256-3264
[Abstract]
[Full Text]
-
Hatchel, J. M., Balish, M. F.
(2008). Attachment organelle ultrastructure correlates with phylogeny, not gliding motility properties, in Mycoplasma pneumoniae relatives. Microbiology
154: 286-295
[Abstract]
[Full Text]
-
Nakane, D., Miyata, M.
(2007). Cytoskeletal "jellyfish" structure of Mycoplasma mobile. Proc. Natl. Acad. Sci. USA
104: 19518-19523
[Abstract]
[Full Text]
-
Hasselbring, B. M., Krause, D. C.
(2007). Proteins P24 and P41 Function in the Regulation of Terminal-Organelle Development and Gliding Motility in Mycoplasma pneumoniae. J. Bacteriol.
189: 7442-7449
[Abstract]
[Full Text]
-
Burgos, R., Pich, O. Q., Querol, E., Pinol, J.
(2007). Functional Analysis of the Mycoplasma genitalium MG312 Protein Reveals a Specific Requirement of the MG312 N-Terminal Domain for Gliding Motility. J. Bacteriol.
189: 7014-7023
[Abstract]
[Full Text]
-
Hasselbring, B. M., Jordan, J. L., Krause, R. W., Krause, D. C.
(2006). Terminal organelle development in the cell wall-less bacterium Mycoplasma pneumoniae. Proc. Natl. Acad. Sci. USA
103: 16478-16483
[Abstract]
[Full Text]
-
Hasselbring, B. M., Page, C. A., Sheppard, E. S., Krause, D. C.
(2006). Transposon Mutagenesis Identifies Genes Associated with Mycoplasma pneumoniae Gliding Motility.. J. Bacteriol.
188: 6335-6345
[Abstract]
[Full Text]
-
Nagai, R., Miyata, M.
(2006). Gliding Motility of Mycoplasma mobile Can Occur by Repeated Binding to N-Acetylneuraminyllactose (Sialyllactose) Fixed on Solid Surfaces.. J. Bacteriol.
188: 6469-6475
[Abstract]
[Full Text]
-
Hatchel, J. M., Balish, R. S., Duley, M. L., Balish, M. F.
(2006). Ultrastructure and gliding motility of Mycoplasma amphoriforme, a possible human respiratory pathogen. Microbiology
152: 2181-2189
[Abstract]
[Full Text]
-
Adan-Kubo, J., Uenoyama, A., Arata, T., Miyata, M.
(2006). Morphology of Isolated Gli349, a Leg Protein Responsible for Mycoplasma mobile Gliding via Glass Binding, Revealed by Rotary Shadowing Electron Microscopy.. J. Bacteriol.
188: 2821-2828
[Abstract]
[Full Text]
-
May, M., Papazisi, L., Gorton, T. S., Geary, S. J.
(2006). Identification of Fibronectin-Binding Proteins in Mycoplasma gallisepticum Strain R. Infect. Immun.
74: 1777-1785
[Abstract]
[Full Text]
-
Waldo, R. H. III, Krause, D. C.
(2006). Synthesis, Stability, and Function of Cytadhesin P1 and Accessory Protein B/C Complex of Mycoplasma pneumoniae. J. Bacteriol.
188: 569-575
[Abstract]
[Full Text]
-
Agladze, K., Wang, X., Romeo, T.
(2005). Spatial Periodicity of Escherichia coli K-12 Biofilm Microstructure Initiates during a Reversible, Polar Attachment Phase of Development and Requires the Polysaccharide Adhesin PGA. J. Bacteriol.
187: 8237-8246
[Abstract]
[Full Text]
-
Hasselbring, B. M., Jordan, J. L., Krause, D. C.
(2005). Mutant Analysis Reveals a Specific Requirement for Protein P30 in Mycoplasma pneumoniae Gliding Motility. J. Bacteriol.
187: 6281-6289
[Abstract]
[Full Text]
-
Uenoyama, A., Miyata, M.
(2005). Identification of a 123-Kilodalton Protein (Gli123) Involved in Machinery for Gliding Motility of Mycoplasma mobile. J. Bacteriol.
187: 5578-5584
[Abstract]
[Full Text]
-
Seto, S., Uenoyama, A., Miyata, M.
(2005). Identification of a 521-Kilodalton Protein (Gli521) Involved in Force Generation or Force Transmission for Mycoplasma mobile Gliding. J. Bacteriol.
187: 3502-3510
[Abstract]
[Full Text]
-
Seto, S., Kenri, T., Tomiyama, T., Miyata, M.
(2005). Involvement of P1 Adhesin in Gliding Motility of Mycoplasma pneumoniae as Revealed by the Inhibitory Effects of Antibody under Optimized Gliding Conditions. J. Bacteriol.
187: 1875-1877
[Abstract]
[Full Text]
-
Waldo, R. H. III, Jordan, J. L., Krause, D. C.
(2005). Identification and Complementation of a Mutation Associated with Loss of Mycoplasma pneumoniae Virulence-Specific Proteins B and C. J. Bacteriol.
187: 747-751
[Abstract]
[Full Text]
-
Willby, M. J., Balish, M. F., Ross, S. M., Lee, K. K., Jordan, J. L., Krause, D. C.
(2004). HMW1 Is Required for Stability and Localization of HMW2 to the Attachment Organelle of Mycoplasma pneumoniae. J. Bacteriol.
186: 8221-8228
[Abstract]
[Full Text]
-
Kusumoto, A., Seto, S., Jaffe, J. D., Miyata, M.
(2004). Cell surface differentiation of Mycoplasma mobile visualized by surface protein localization. Microbiology
150: 4001-4008
[Abstract]
[Full Text]
-
Kenri, T., Seto, S., Horino, A., Sasaki, Y., Sasaki, T., Miyata, M.
(2004). Use of Fluorescent-Protein Tagging To Determine the Subcellular Localization of Mycoplasma pneumoniae Proteins Encoded by the Cytadherence Regulatory Locus. J. Bacteriol.
186: 6944-6955
[Abstract]
[Full Text]
-
Waites, K. B., Talkington, D. F.
(2004). Mycoplasma pneumoniae and Its Role as a Human Pathogen. Clin. Microbiol. Rev.
17: 697-728
[Abstract]
[Full Text]
-
Uenoyama, A., Kusumoto, A., Miyata, M.
(2004). Identification of a 349-Kilodalton Protein (Gli349) Responsible for Cytadherence and Glass Binding during Gliding of Mycoplasma mobile. J. Bacteriol.
186: 1537-1545
[Abstract]
[Full Text]
-
Papazisi, L., Gorton, T. S., Kutish, G., Markham, P. F., Browning, G. F., Nguyen, D. K., Swartzell, S., Madan, A., Mahairas, G., Geary, S. J.
(2003). The complete genome sequence of the avian pathogen Mycoplasma gallisepticum strain Rlow. Microbiology
149: 2307-2316
[Abstract]
[Full Text]
-
Seto, S., Miyata, M.
(2003). Attachment Organelle Formation Represented by Localization of Cytadherence Proteins and Formation of the Electron-Dense Core in Wild-Type and Mutant Strains of Mycoplasma pneumoniae. J. Bacteriol.
185: 1082-1091
[Abstract]
[Full Text]
-
Belloy, L., Vilei, E. M., Giacometti, M., Frey, J.
(2003). Characterization of LppS, an adhesin of Mycoplasma conjunctivae. Microbiology
149: 185-193
[Abstract]
[Full Text]
-
Papazisi, L., Frasca, S. Jr., Gladd, M., Liao, X., Yogev, D., Geary, S. J.
(2002). GapA and CrmA Coexpression Is Essential for Mycoplasma gallisepticum Cytadherence and Virulence. Infect. Immun.
70: 6839-6845
[Abstract]
[Full Text]
-
Fleury, B., Bergonier, D., Berthelot, X., Peterhans, E., Frey, J., Vilei, E. M.
(2002). Characterization of P40, a Cytadhesin of Mycoplasma agalactiae. Infect. Immun.
70: 5612-5621
[Abstract]
[Full Text]
-
Leigh, S. A., Wise, K. S.
(2002). Identification and Functional Mapping of the Mycoplasma fermentans P29 Adhesin. Infect. Immun.
70: 4925-4935
[Abstract]
[Full Text]
-
SVENSTRUP, H. F., NIELSEN, P. K., DRASBEK, M., BIRKELUND, S., CHRISTIANSEN, G.
(2002). Adhesion and inhibition assay of Mycoplasma genitalium and M. pneumoniae by immunofluorescence microscopy. J Med Microbiol
51: 361-373
[Abstract]
[Full Text]
-
Miyata, M., Ryu, W. S., Berg, H. C.
(2002). Force and Velocity of Mycoplasma mobile Gliding. J. Bacteriol.
184: 1827-1831
[Abstract]
[Full Text]
-
Bourret, R. B., Charon, N. W., Stock, A. M., West, A. H.
(2002). Bright Lights, Abundant Operons--Fluorescence and Genomic Technologies Advance Studies of Bacterial Locomotion and Signal Transduction: Review of the BLAST Meeting, Cuernavaca, Mexico, 14 to 19 January 2001. J. Bacteriol.
184: 1-17
[Full Text]
-
Jordan, J. L., Berry, K. M., Balish, M. F., Krause, D. C.
(2001). Stability and Subcellular Localization of Cytadherence-Associated Protein P65 in Mycoplasma pneumoniae. J. Bacteriol.
183: 7387-7391
[Abstract]
[Full Text]
-
Balish, M. F., Hahn, T.-W., Popham, P. L., Krause, D. C.
(2001). Stability of Mycoplasma pneumoniae Cytadherence-Accessory Protein HMW1 Correlates with Its Association with the Triton Shell. J. Bacteriol.
183: 3680-3688
[Abstract]
[Full Text]