Previous Article | Next Article 
Journal of Bacteriology, March 2001, p. 1716-1726, Vol. 183, No. 5
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.5.1716-1726.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
VpsR, a Member of the Response Regulators of the
Two-Component Regulatory Systems, Is Required for Expression of
vps Biosynthesis Genes and
EPSETr-Associated Phenotypes in Vibrio
cholerae O1 El Tor
Fitnat H.
Yildiz,*
Nadia A.
Dolganov, and
Gary
K.
Schoolnik
Department of Medicine, Division of
Infectious Diseases and Geographic Medicine, and Department of
Microbiology and Immunology, Stanford University Medical School,
Stanford, California 94305
Received 31 July 2000/Accepted 29 November 2000
 |
ABSTRACT |
The rugose colonial variant of Vibrio cholerae O1 El
Tor produces an exopolysaccharide (EPSETr) that enables the
organism to form a biofilm and to resist oxidative stress and the
bactericidal action of chlorine. Transposon mutagenesis of the rugose
variant led to the identification of vpsR, which codes for
a homologue of the NtrC subclass of response regulators. Targeted
disruption of vpsR in the rugose colony genetic background yielded a nonreverting smooth-colony morphotype that produced no
detectable EPSETr and did not form an architecturally
mature biofilm. Analysis of two genes, vpsA and
vpsL, within the vps cluster of
EPSETr biosynthesis genes revealed that their expression is
induced above basal levels in the rugose variant, compared to the
smooth colonial variant, and requires vpsR. These results
show that VpsR functions as a positive regulator of vpsA
and vpsL and thus acts to positively regulate
EPSETr production and biofilm formation.
 |
INTRODUCTION |
Vibrio cholerae O1, the
causative agent of Asiatic cholera, has been isolated from coastal and
estuarine environmental samples, both as free-living bacteria and in
association with phytoplankton, zooplankton, crustacea, and mollusks
(15-17). These distribution studies and its capacity to
adaptively respond to changes in salinity, temperature, and the
availability of nutrients (30, 31) have led to the idea
that V. cholerae O1 can successfully occupy one or more
ecological niches in a variety of aquatic habitats.
Laboratory microcosm studies conducted with V. cholerae O1
have shown that the duration of its survival in seawater is decreased if particulate matter is removed by filtration before inoculation of
the filtrate with the organism. One interpretation of this result is
that attachment to surfaces is important for long-term survival of the
organism in marine environments. Growth on surfaces is believed to be
advantageous because surfaces adsorb and thus concentrate scarce
nutrients in the fluid phase. In addition, biotic surfaces, such as
chitin, can be degraded by attached bacteria releasing assimilable
sources of carbon and nitrogen (9). Thus, the surface
mode-of-growth is likely to be preferred by V. cholerae in
natural aquatic habitats.
Biofilms are a specialized and highly adapted form of surface growth
characterized by assemblages of bacteria that form pillars or
mushroom-like structures separated by fluid-filled channels. Pillars,
in turn, consist of an extracellular polysaccharide (EPS) matrix and
the bacteria that secrete it. Since EPS accounts for about 85% of
biofilm depth, the production of EPS is critical for the development of
a mature biofilm (4, 21). V. cholerae O1,
biotype El Tor, in common with many aquatic bacterial species, forms a
typical three-dimensional biofilm on a variety of abiotic surfaces
(36, 39). Investigation of this phenotype showed that the
rugose colonial variant forms a thicker and more differentiated biofilm
than the smooth colonial variant (39). This capacity was
found to be associated with production of a glucose- and galactose-rich EPS by the rugose form. Designated EPSETr, this compound
was also shown to inactivate chlorine (39) and protect the
organism from the bactericidal action of hydrogen peroxide
(35). Open reading frames (ORFs) required for
EPSETr synthesis are clustered in a 30.7-kb segment on the
V. cholerae O1 chromosome. Because their putative protein
products are homologous to capsular or EPS biosynthetic enzymes of
other species, the corresponding Vibrio genes were
designated vps, for Vibrio polysaccharide (39).
Phase transition occurs between the rugose and smooth colonial variants
of V. cholerae O1 El Tor. Unlike the rugose form, the
smooth-colony type of the strain A1552 does not produce EPS, forms only
low-profile biofilms, and is rapidly killed by chlorine (39). Phenotype differences of this kind between the two
colonial variants suggest that the rugose form may be better adapted
for growth and survival in natural aquatic habitats and that transition frequencies between the two types may be governed by environmental signals.
Here we describe the identification, cloning, and characterization of
vpsR, a gene that regulates the expression of the
vps biosynthetic gene cluster. VpsR exhibits homology to the
response element of two-component regulatory systems, which are
involved in responding to environmental stimuli. Construction of a
vpsR knockout mutation in a V. cholerae O1 El Tor
rugose genetic background disclosed the role of this gene in colony
morphology, EPS production, and biofilm formation. Studies of the
smooth-colony type of a second strain of V. cholerae O1 El
Tor (N16961) showed that the expression of vpsR and the
genes it controls within the vps biosynthetic cluster
exhibit interstrain differences that correspond to differences in
biofilm forming capacity.
 |
MATERIALS AND METHODS |
Media and growth conditions.
All strains were maintained at
80°C in Luria-Bertani (LB) broth supplemented with glycerol (15%,
vol/vol). For the experiments described below, the cells were grown
aerobically at 30°C in LB broth, unless specified otherwise. The
following antibiotics were added as appropriate: ampicillin (100 µg/ml) and chloramphenicol (5 µg/ml).
Bacterial strains.
Escherichia coli strains
DH5
and S17-1 were used for standard DNA manipulations and mating,
respectively. The V. cholerae strains used were smooth and
rugose variants of 92A1552 (wild type, El Tor, Inaba, and
Rifr) and vpsR and rpoN mutants of
these strains, as well as strain N16961 (wild type, El Tor, and Inaba).
Scanning electron microscopy.
Pieces of agar containing a
number of colonies were excised and processed sequentially as follows:
3% glutaraldehyde in 0.1 M sodium cacodylate for 60 min, 0.1 M sodium
cacodylate for 5 min, 2% osmium tetroxide in 0.1 M sodium cacodylate
for 45 min, and 0.1 M sodium cacodylate for 5 min. These samples were
incubated with increasing concentrations of ethanol (15, 30, 50, 70, 90, and 100%) each for 15 min and then subjected to critical point drying, sputter coated, and analyzed by scanning electron microscopy (Philips XL40).
Transmission electron microscopy.
Bacterial cells were grown
on a sterile dialysis membrane placed on the surface of LB plates, and
the plates were incubated at 30°C for 24 h. Membrane-attached
bacteria were processed sequentially as follows: 1% glutaraldehyde in
0.05 M sodium cacodylate containing 0.375% ruthenium red for 60 min,
0.05 M sodium cacodylate for 15 min, 2% osmium tetroxide in 0.2 M
sodium cacodylate containing 1.5% ruthenium red for 60 min, and 0.2 M
sodium cacodylate for 5 min. The cells were then incubated with
ascending concentrations of ethanol (15, 30, 50, 70, 90, and 100%)
each for 15 min and embedded according to standard procedures. The thin
sections were stained with 1% uranyl acetate and then with lead
citrate and then visualized using a Philips CM12 electron microscope.
CSLM.
Biofilms were formed by incubating 200 µl of a 1/100
dilution of an overnight LB broth culture grown on borosilicate cover chambers. The chambers were then incubated at 30°C for 24 h, rinsed with phosphate-buffered saline and analyzed by confocal scanning laser
microscopy (CSLM) (MultiProbe 2010; Molecular Dynamics) using 488- and
510-nm excitation and emission wavelengths, respectively. The
horizontal (xy) sections were obtained and the images were reconstructed using a maximum intensity algorithm.
Quantitative biofilm assay.
Biofilm formation was
quantitatively monitored by incubating 200 µl of a 1/100 dilution of
an overnight LB broth culture in microtiter plates (Falcon 3911). The
microtiter plates were then incubated at 30°C for 24 h, and
biofilm formation was quantified by crystal violet staining and ethanol
solubilization as described elsewhere (27).
Transposon mutagenesis.
Tn5 mutagenesis of
V. cholerae O1 El Tor, strain 92A1552, was performed by
conjugation between the donor E. coli S-17
pir containing
a pool of ~40,000 signature-tagged Tn5Km2 DNAs on plasmids encoding resistance to ampicillin and the recipient, a
rifampin-resistant V. cholerae O1 El Tor 92A1552 rugose
variant. Conjugation was performed by mixing equal volumes of the donor
and recipient, followed by filtration through a 0.45-µm-pore-size
filter (Nalgene). The filters were then placed on LB agar plates,
incubated for 5 h at 37°C, and suspended in LB, and the bacteria
were recovered by vortexing. The exconjugants were selected by plating
the suspension onto LB plates supplemented with 100 µg of rifampin
and 150 µg of kanamycin per ml. A total of 15,000 exconjugants were
screened visually to isolate mutants exhibiting smooth colonial morphology.
DNA manipulation and analysis.
Plasmid DNA and chromosomal
DNA preparation, DNA ligation, bacterial transformation, agarose gel
electrophoresis, PCR, and Southern blotting were carried out by the
standard techniques described by Sambrook et al. (29).
Restriction enzymes and DNA modification enzymes were purchased from
New England Biolabs, Inc.
Cloning of the transposon insertion site.
Chromosomal DNA
was isolated from the mutants using standard procedures; digested
singly with EcoRI, SalI, KpnI, and
PstI, the fragments resolved on an agarose gel; transferred
to Hybond N membranes; and hybridized to the kanamycin-resistance gene
of pUT mini-Tn5-Km2. Restriction enzymes that yielded
hybridizing fragments of between 3 and 8 kb were used to digest
chromosomal DNA, the resulting fragments were ligated into pBluescript
KS that had been digested with the corresponding enzyme, and the plasmids were transformed into DH5
, followed by selection for kanamycin- and ampicillin-resistant transformants.
Construction of cosmid library.
A V. cholerae O1
El Tor 92A1552 gene bank was constructed by partially digesting
wild-type genomic DNA with 0.016 U of Sau3A per µg for 5 min, which yielded mainly 25- to 40-kb fragments. These partially
digested, dephosphorylated fragments were ligated into the vector
SuperCos/Mob-II that had been digested with XbaI and
BamHI. This vector had been constructed by introducing a
1,700-bp BamHI mobilization fragment (Mob) from GP704 into
the BglII site of pSuperCos (Strategene). The ligation
mixture was packaged into bacteriophage lambda particles using the
Gigapack III gold packaging extract (Stratagene). The titer of the
library was determined, and the library was amplified using E. coli XL1-Blue MR as a host cell and stored at
80°C in 25% glycerol.
PCR amplification of vpsR.
A 2,890-bp fragment
containing vpsR was amplified using the following primers:
VpsR2-F (GTTCTATGATGCCGACTACA) and
VpsR2-R (ACGCTTCTCACGCTACTTT). The amplified
fragment includes 431 nucleotides of upstream sequence, the entire
vpsR coding sequence, and 1,130 nucleotides of sequence
downstream of vpsR. BamHI and SalI
restriction sites were added to forward and reverse primers,
respectively, to facilitate cloning into pACYC184. The PCR products
were generated using a high-fidelity PCR kit (Clontech), digested with
BamHI and SalI, and the resulting fragment was
ligated into pACYC184 that had been digested with the corresponding
enzymes to generate p1. The ligation mix was then transformed into
DH5
, and the transformants were selected on LB plates supplemented
with chloramphenicol. The plasmids were introduced into V. cholerae mutant strains by electroporation. The ability of the
plasmid to complement the mutations was initially tested by a change in
the colony morphology from smooth to rugose and then tested by
expression analysis.
Generation of null mutants.
Mutants with insertions into the
vpsR and rpoN genes were regenerated in a new
rugose strain background. For rpoN, primers rpoN1-F (CCCTTTAGCGATGTGGAT) and
rpoN1-R (CAGCCATTTTGCCTCTTG) were used to amplify
an internal 558-nucleotide region of rpoN corresponding to
amino acids 144 to 339. For vpsR, primers vpsR1-F (GGGGAATCTATGCCTATGAAG) and vpsR1-R
(CGTCTCCACAGTCCCTTCTTG) were utilized to generate a
351-nucleotide internal fragment corresponding to amino acids 148 to
264. XbaI and EcoRI restriction sites were added
to forward and reverse primers, respectively, to facilitate the cloning
into pGP704. The plasmids were introduced to V. cholerae O1
El Tor wild-type rugose and smooth colonial variants by biparental mating, and exconjugants were selected on LB plates supplemented with
100 µg of ampicillin and rifampin per ml. Insertion into the correct
site was confirmed by Southern and PCR analysis.
RNA preparation.
Overnight cultures of V. cholerae in LB medium at 37°C were diluted 1:100 in fresh LB
medium. At the mid-log-phase growth point, 10-ml aliquots of culture
were collected. Cell pellets were frozen with liquid nitrogen and
stored at
80°C. RNA was isolated from frozen pellets using Trizol
reagent (Gibco-BRL). For biofilm RNA isolation, overnight LB culture
was diluted 1:100, and 25 ml of this culture was incubated in petri
plates at 30°C for 24 h. The plates were rinsed with LB three
times, the attached bacteria were resuspended in 2 ml of Trizol
reagent, and the total RNA was isolated according to the
manufacturer's instructions. To remove contaminating DNA, 50 µg of
total RNA was incubated with 4 U of RNase-free DNase I (Ambion) for 30 min at 37°C. The RNeasy Mini Kit (Qiagen) was used to clean up RNA
after DNase digestion, and the RNA was stored at
80°C.
cDNA synthesis.
Reverse transcription (RT) of RNA was
performed with TaqMan RT reagents (Perkin-Elmer) and nuclease-free
water (Ambion). Five hundred nanograms of total RNA was used for RT in
a final volume of 50 µl containing 50 mM KCl, 10 mM Tris-HCl (pH
8.3), 5.5 mM MgCl2, 500 µM concentrations of each
deoxynucleotide triphosphate (dNTP), 2.5 µM concentrations of random
hexamers, 20 U of RNase inhibitor, and 62.5 U of Multiscribe Reverse
Transcriptase. The RT-negative control reactions (without RT) were
performed to determine how much contaminating genomic DNA was present
in each total RNA sample. The reactions were incubated in GeneAmp PCR
System 9700 (Perkin-Elmer) by using parameters of 25°C for 10 min,
48°C for 30 min, 95°C for 5 min, and cooling at 4°C. The cDNA
samples were stored at
20°C.
Primers and probes for real-time RT-PCR.
Primers and probes
for the three genes of interest, vpsR, vpsA, and
vpsL, and for rRNA were chosen using Primer Express software (Perkin-Elmer). Fluorogenic probes were used to monitor PCR product formation continuously during PCR. The probe is an oligonucleotide, dually labeled with a reporter dye (FAM; 6-carboxyfluorescein) covalently attached at the 5' end and a quencher dye (TAMRA;
6-carboxytetramethylrhodamine) covalently attached at the 3' end.
Primers and probes were synthesized and purified by Biosearch
Technologies. The primers and probes used for real-time PCR were
as follows: vpsR-F (21-mer),
GTCTCAGCTCGATCTTCCCAA; vpsR-R (20-mer),
CGTTCCCGAATGCTTTTCAG; vpsA-F
(19-mer), TTCCCCTTGGCCTGAAGAG; vpsA-R (21-mer)
AGGTGCAAAGTGGTACTGCGT; vpsL-F (21-mer),
ATCGCACCATAGTGAATCGCT; vpsL-R (21-mer),
TCTGTGCCCATCCAGTAATGC; rDNA-F (ribosomal DNA [rDNA];
18-mer), GAGCGGCAGCACAGAGGA; rDNA-R (21-mer),
TTTCCCAGGCATTACTCACCC; vpsR TaqMan probe
(20-mer), 5'FAM-CTGCGACGGCCATCACTGCG-TAMRAp3'; vpsA TaqMan probe (20-mer),
5'FAM-CCGCAAACTCACGGCCGCAC-TAMRAp3'; vpsL TaqMan
probe (25-mer), 5'FAM-CATGCTGCGTCACAAAGTGAAGCCC-TAMRAp3'; and rDNA TaqMan probe (22-mer),
5'FAM-CGCTCGCCACCCAAGGAACAAG-TAMRAp3'. The amplicon
lengths generated using these primers were 67, 69, 63, and 67 bp for
vpsA, vpsL, vpsR, and rDNA, respectively.
PCR amplification conditions for RT-PCR analysis.
PCR
conditions were identical for all reactions. For each PCR run, a master
mix was prepared on ice with the following components: 1× TaqMan
Universal Master Mix containing AmpliTaq Gold DNA polymerase, Amp Erase
UNG, dNTPs with UTP, passive reference dye, and optimized buffer
components (Perkin-Elmer). To this were added 200 nM of the fluorogenic
probe and 900 nM of the forward and reverse primers. Then, 5 µl of
each appropriately diluted (250 pg, unless specified) RT sample was
added to 20 µl of the PCR master mix. Experiments were performed with
three replicas for each datum point, and negative-RT and no-template
controls were run for each reaction. Reactions were performed in sealed
MicroAmp Optical 96-well reaction plates (Perkin-Elmer) using an ABI
Prism 7700 Sequence Detection System (Perkin-Elmer) for PCR
amplification and the following cycle parameters: 2 min for 50°C and
10 min for 95°C, followed by 40 cycles of 15 s for 95°C and 1 min for 60°C.
Quantitative analysis of RT-PCR data.
Real-time PCR measures
the degradation of a fluorescent oligonucleotide probe in real time
concurrent with PCR amplification. The method uses a dually labeled
probe with a reporter dye FAM at the 5' end and the quencher dye TAMRA
at the 3' end. During PCR the 5' nucleolytic activity of Taq
polymerase separates the 5' reporter dye from the 3' quencher dye,
resulting in an increase in the fluorescence of the reporter dye, which
can be detected by the laser detector. In real-time PCR analysis,
quantitation is based on cycle threshold (Ct) calculations (10,
12). Ct is defined as the number of cycles required for reporter
dye fluorescence, resulting from the synthesis of PCR products, to
become significantly higher than background fluorescence. There is an
inverse exponential relationship between the logarithm of initial
target copy number in the reaction and the corresponding Ct
determinations by the model 7700 instrument. Validation experiments
were performed for each PCR primer-probe set, and these yielded a
linear relationship when Ct was plotted against the logarithm of a
varying amount of cDNA reverse-transcribed from total RNA in the range
of 10 pg to 1 ng. Twofold serial dilutions of cesium chloride-purified chromosomal DNA of V. cholerae, corresponding to
101 to 106 theoretical copies (the molecular
weight of V. cholerae genomic DNA was estimated to be 4.1 Mbp), were used in real-time PCR. For each set of TaqMan amplicons, the
standard curve was constructed by using the equation y = a + b log x, where x
is the starting DNA copy number, y is the Ct obtained by
amplifying x copies, a is the y
intercept of the standard curve line, and b is the slope of
the standard curve line. The results of this calculation were used to
estimate the number of cDNA copies present in the different samples.
 |
RESULTS |
Isolation of the vpsR regulatory mutant and
cloning of the corresponding gene.
To identify genes required for
the rugose colony type, EPS production, and biofilm formation, the
rugose colonial variant of V. cholerae O1 El Tor was
subjected to transposon mutagenesis; transconjugants that exhibited
smooth colonial morphology were selected for subsequent analysis.
Chromosomal genes interrupted by transposon insertion were isolated by
marker rescue, and DNA sequences flanking these insertion sites were
determined. The majority of genes identified by this method were
located within the aforementioned 30.7-kb segment of the chromosome
that contains the vps biosynthetic cluster. However,
sequence analysis of other tagged genes also disclosed two independent
insertions in another locus situated elsewhere on the chromosome;
analysis of these sequences revealed an ORF predicted to encode a
protein homologous to the NtrC subclass of response regulators. This
ORF was denoted VpsR. A sequence tag corresponding to this locus was
used as a probe to isolate a complete copy of vpsR
from a cosmid library of the smooth colonial variant. Two such clones
were obtained, returned to the mutant, and found to cause conversion
from the smooth colonial morphology of the mutant to the rugose
colonial morphology of the original wild-type parent.
DNA sequence analysis of the vpsR region.
Sequence
analysis of the vpsR region was undertaken with specifically
designed oligonucleotides using pCos-vpsR as a template. A
2.897-kb region encompassing the insertion site and the flanking regions was sequenced and revealed an apparently full-length
vpsR spanning 1,335 nucleotides and located between
nucleotides 431 and 1765 of the cloned segment (Fig.
1A). An incomplete ORF was identified 274 bp upstream of the vpsR start codon, in the same orientation, that would specify the carboxy-terminal 51 amino acids of
a protein with 87.7% identity and 91.8% similarity to lysS, which encodes an E. coli lysyl-tRNA
synthetase (23). Downstream of vpsR and in the
same orientation, a third ORF was found between nucleotides 2343 and
2594 of the cloned sequence; it is predicted to encode an 83-amino-acid
protein without identifiable homologous sequences in the protein
database. Directly downstream of the third ORF, in the opposite
orientation, an incomplete ORF was identified; it is predicted to
encode the carboxy-terminal 87 amino acids of a protein that exhibits
47.6% identity and 58.1% similarity to the E. coli TAS
(tyrosine auxotrophy suppressor) protein (34).

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 1.
VpsR homologues and functional motifs. (A) Map of the
vpsR region on the V. cholerae O1 El Tor
chromosome. (B) Amino acid sequence alignment of VpsR from V. cholerae O1, NtrC from serovar Typhimurium (P41789), HydG from
serovar Typhimurium (P25852), and AlgB from P. aeruginosa
(P23747). Amino acids identical in all four sequences are shaded in
black. The star denotes a conserved aspartate residue and a putative
phosphorylation site. Predicted RpoN interaction sites are indicated by
heavy lines, and a C-terminally located helix-turn-helix (HTH) motif is
shown by the thin line.
|
|
vpsR is predicted to encode a 444-amino-acid, 49.76-kDa
protein homologous to HydG (51% similarity, 35.7% identity) from
Salmonella enterica serovar Typhimurium (
3),
AlgB (43.2% similarity, 34.3%
identity) from
Pseudomonas
aeruginosa (
11,
37), and NtrC (55.8%
similarity,
44.1% identity) from serovar Typhimurium (
8) (Fig.
1B).
Each of these proteins belongs to the response regulator
component of
two-component signal transduction systems and possesses
an N-terminal
domain that can be phosphorylated by a sensor kinase,
the other
component of this signal transduction system (
33).
The
conserved aspartate residue of VpsR (Asp-59) that is postulated
to be
phosphorylated is indicated by a star (Fig.
1B). Two other
conserved
residues, Asp and Lys, typically present within the
N-terminal domain
of response regulators, are not present in the
corresponding region of
VpsR.
The central region of VpsR harbors the following consensus sequences
shown or postulated to be important for interaction with
the
alternative sigma-54 factor (Fig.
1B): 1, (L,I,V,M,F,Y) 3xG(D,E,Q)(S,T,E)G(S,T,A,V)GKx2(L,I,V,M,F,Y);
and 2, (G,S)
x(L,I,V,M,F)x2A(D,N,E,Q,A,S,H)(G,N,E,K)G(S,T,I,M)(L,I,V,
M,F,Y)3(D,E)(E,K)(L,I,V,M) (
7).
These are ATP binding motifs
and are located in the N-terminal segment
of the central domain.
ATP binding promotes open complex formation by a
sigma-54 containing
RNA polymerase (
22,
26). A segment of
the
vpsR sequence, which
would code for amino acids 214 to
356, had been previously identified
by Klose et al. as a
sigma-54-dependent transcriptional activator
(
s54act5)
through their use of degenerate primers designed to
amplify genes
coding for this class of transcriptional activators.
However, these
investigators did not determine the function of
the
s54act5
gene product (
20).
Like other response regulators, VpsR harbors a helix-turn-helix
DNA-binding domain (
28), located between amino acids
415
and 434 near the carboxy terminus of the protein (Fig.
1B).
Generation and analysis of vpsR knockout
mutants.
To test if vpsR is required for rugose
colonial morphology, EPS production, and biofilm formation, it was
independently inactivated in the rugose genetic background by using
pGP704 harboring a 351-nucleotide internal fragment, which
corresponds to the coding sequence for amino acids 148 to 264. Knockouts carrying this mutation, designated vpsR::pGP704, were examined for colonial
morphology, EPS production and localization, and biofilm formation.
The capacity of
V. cholerae O1 to naturally oscillate
between two distinctive colony morphotypes

the rugose and smooth
colonial
variants

led to the identification of the rugose-associated
phenotypes
described above (
39). If
vpsR is
required for the rugose colonial
morphotype, then disruption of this
gene in the rugose background
should yield phenotypically "smooth"
colonies that do not revert
to the rugose colonial variant. The
nonreverting nature of the
mutation was tested by cultivating
vpsR::pGP704 under conditions
of nutrient
limitation that favor reversion of the wild-type smooth
variant to the
rugose variant (
35,
39). This growth condition
did not
yield any rugose colonies of
vpsR::pGP704,
indicating
that the smooth colonial phenotype of this mutant is stable.
To
determine if disruption of
vpsR in the rugose genetic
background
resulted in the same colonial morphology as the wild-type
smooth
variant, colonies formed by
vpsR::pGP704
and by the original smooth
and rugose colonial variants of the
wild-type parent strain were
compared by scanning electron microscopy.
Figure
2A depicts such
a comparison. The
colonial morphology of
vpsR::pGP704 (denoted
R-vpsR in this figure) is dramatically different from the corrugated
colonial morphology of the wild-type rugose parent, even though
this
mutation was made in the genetic background of the wild-type
rugose
variant. Instead, colonies formed by
vspR::pGP704
resemble
the featureless, flat colonies of the wild-type smooth
variant.

View larger version (113K):
[in this window]
[in a new window]
|
FIG. 2.
Colonial morphology and EPS production by the
vpsR mutant. (A) The appearance of agar grown colonies was
determined by scanning electron microscopy for the wild-type rugose and
smooth variants of V. cholerae O1 El Tor and for the
vpsR mutant of the rugose variant (designated R-vpsR).
Disruption of vpsR is associated with a change from the
rugose to the smooth-colony type. Bars, 1 mm. (B) EPS production by
bacteria growing on a cellulose membrane atop nutrient agar was
determined by transmission electron microscopic examination of thin
sections stained with ruthenium red. A stained matrix, evident between
rugose-type bacteria (arrow), is not produced by the vpsR
mutant of the rugose variant (designated R-vpsR) or by the wild-type
smooth variant. Bars, 1 µm.
|
|
One explanation for differences between the colony types depicted in
Fig.
2A might be qualitative or quantitative differences
in the
EPS
ETr produced by each. To compare the abundance,
distribution, and
tinctorial qualities of EPS produced by
vpsR::pGP704 and the wild-type
rugose and smooth
variants of the same strain, each bacterial
type was grown on a
cellophane dialysis membrane placed on the
surface of LB agar plates,
and the resulting bacterial lawn was
subjected to thin-section
transmission electron microscopy of
ruthenium red-stained samples, a
method that preferentially stains
acidic polysaccharides. This method
led to the comparative features
depicted in Fig.
2B. The wild-type
rugose variant produces a ruthenium
red-positive matrix between
well-separated bacteria. In contrast,
the wild-type smooth variant and
the
vpsR::pGP704 mutant were
identical; neither
produces the ruthenium red-staining interbacterial
matrix typical of
the rugose variant. EPS
ETr production by
vpsR::pGP704 was also tested by enzyme-linked
immunosorbent
assay using an EPS
ETr-specific antiserum, and
the result showed that vpsR::pGP704 was
EPS
ETr
antigen negative (data not shown). Taken together, these results
provide compelling evidence that
vpsR is required for
EPS
ETr production.
Biofilm formation by vpsR::pGP704.
The
capacity of the rugose colonial variant to form high-profile biofilms
is the rugose-associated property most likely to be important for the
environmental persistence of this species in natural aquatic habitats.
To determine if biofilm formation by the rugose variant is affected by
the vpsR::pGP704 mutation of the rugose parent
strain, two assays were performed that monitor different aspects of the
biofilm-forming phenotype. Quantitative differences in biofilm-forming
capacity were measured by monitoring the intensity of crystal
violet staining of a biofilm that formed on the surface of a
polyvinyl chloride microtiter well during 24 h of growth in LB
medium (27). This assay was used to examine the wild-type
rugose and smooth colonial variant, the
vpsR::pGP704 mutant, and this mutant complemented
with pACYC184 containing a cloned copy of vpsR. To control
for possible plasmid effects, each of the other tested strains also
contained pACYC184 without the vpsR insert. The
biofilm-forming capacity of the wild-type rugose variant was found to
be 17-fold greater than the wild-type smooth variant (Fig.
3A). In contrast, the
biofilm-forming capacity of the noncomplemented
vpsR::pGP704 mutant of the rugose variant was
intermediate between the wild-type rugose and smooth variants, being
3-fold less than that of the rugose variant but 5.5-fold greater than
that of the smooth variant (Fig. 3A). Furthermore, a time course of
biofilm development by the vpsR::pGP704 mutant also exhibited an intermediate biofilm formation phenotype, where the
biofilm-forming capability of the vpsR mutant is less than that of the wild-type rugose and more than that of the wild-type smooth strain (data not shown).

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 3.
Biofilm-forming phenotype of the vpsR
mutant. (A) Quantitative comparison of biofilm-forming capacity by the
wild-type rugose and smooth colonial variants of V. cholerae
O1 El Tor and by the vpsR mutant of the rugose variant.
Biofilms were quantified for the following four variants of the same
strain: the wild-type rugose and smooth colonial morphotypes, each
carrying the control plasmid pACYA184 (pC), and the vpsR
mutant of the rugose morphotype (R-vpsR) harboring either the control
plasmid (pC) or a complementing plasmid (p1), which contains a
wild-type copy of vpsR on pACYC184. Biofilm quantification
was carried out by growing these variants overnight in LB broth at
30°C in polyvinyl chloride microtiter plates. The wells were washed,
the attached bacteria were stained with crystal violet, the stained
film was solubilized in 95% ethanol, and the intensity of crystal
violet staining was then monitored by absorbance spectroscopy at 595 nm. Disruption of vpsR in the rugose variant, denoted
R-vpsR, caused a threefold reduction in biofilm-forming capacity
compared to the wild-type rugose parent strain. Complementation of
R-vpsR with p1 restored most of the wild-type biofilm phenotype of the
rugose variant. The biofilm-forming capacity of R-vpsR was
significantly greater than that of the wild-type smooth variant,
indicating that biofilm-forming genes, which do not require
vpsR, are expressed by the rugose variant. (B) Topographical
features of biofilm development by the rugose and smooth wild-type
colonial morphotypes and by the vpsR mutant of the rugose
variant (denoted R-vpsR). Each of the three tested strains, carrying a
plasmid that constitutively expresses the green fluorescent protein,
was incubated for 24 h in borosilicate glass-bottom chambers
containing LB broth. The chambers were then emptied, and the glass
surface was examined with a scanning confocal microscope using 488- and
510-nm excitation and emission wavelengths, respectively. Horizontal
(xy) projected images of each of the strains are shown at
low and high magnification in rows A and B, respectively. Biofilms
formed by the rugose variant contain large circumscribed aggregates of
adherent bacteria. In contrast, only individual bacteria of the smooth
variant interact with the glass surface. The adherence pattern of
R-vpsR is intermediate between the rugose and smooth patterns, showing
both small aggregates and individual glass-bound bacteria. Image
reconstruction led to the sagittal (xz) view of the same
biofilms shown in row C. The high-profile biofilm (>10 µm) produced
by the rugose variant contains a mushroom-shaped pillar that is not
present in the low-profile biofilms (<10 µm) produced by the
wild-type smooth variant or the R-vpsR mutant of the rugose variant.
Bars: 50 µm, row A; 10 µm, rows B and C.
|
|
Complementation of this mutant with an intact copy of
vpsR
increased its biofilm-forming capacity to nearly the same level
as the
wild-type rugose parent strain (Fig.
3A). These results
demonstrated
that
vpsR is required for some but not all of the
biofilm-forming capacity of the rugose variant. However, to determine
if differences in the biofilm-forming capacity of the
vpsR::pGP704
and the wild-type strains were due to
differences in the growth
rate, both were cultivated in liquid medium.
No differences in
the growth rate or final cell density were observed
(data not
shown). Thus, the decreased capacity of
vpsR::pGP704 strain to
form a biofilm is not due
to an altered growth
rate.
The same strains were studied by a second assay that provided
comparative information about the topographic and architectural
features of the biofilms produced by these variants on a glass
surface.
To this end, a plasmid carrying a gene that constitutively
expresses
the green fluorescent protein (GFP) was introduced into
each of these
variants. The biofilms they formed after 24 h of
incubation at
30°C were compared using scanning confocal laser
microscopy to obtain
horizontal (
xy) and sagittal (
xz) images
(Fig.
3B). Under these conditions, the rugose variant produces
a
well-developed biofilm containing multicellular, 75-µm high
pillars
and fluid-filled columns. Horizontal projections of the
rugose strain
showed prominent islands of bacterial aggregates.
In contrast, the
smooth variant produces a low-profile, 6-µm biofilm
lacking pillars,
columns, or islands of bacterial aggregates.
The
vpsR::pGP704 mutant of the rugose variant also
formed a low-profile
7- to 10-µm biofilm, similar in depth to the
biofilm formed by
the wild-type smooth colonial variant. However, in
contrast to
the smooth variant, the
vpsR::pGP704
biofilm contained more bacteria
per unit area, and in some areas the
bacteria coalesced into poorly
developed or temporally delayed islands
(Fig.
3B). Taken together,
these results show that
vpsR is
required for normal biofilm development
by the rugose colonial variant,
but they also point to the probable
existence of genes that are
independent of
vpsR which contribute
to the complete biofilm
phenotype by this colonial
variant.
Transcriptional regulation of vps biosynthesis genes
vpsA and vpsL by vpsR.
Sequence analysis of the 30.7-kb region that contains vps
biosynthesis genes showed that these genes are organized into two clusters of 11.4 and 6.6 kb harboring 11 and 6 vps genes,
respectively (unpublished data). Because VpsR was found to be
homologous to several previously described response regulators (Fig.
1B), we reasoned that it might control the expression of vps
biosynthesis genes within one or both of these clusters. To investigate
this possibility, the first gene of each cluster was selected for gene expression analysis, since each had been shown to be required for
EPSETr production by transposon insertion mutagenesis
(39). These genes are described below.
vpsA, the first gene in the first
vps region, is
predicted to encode a 356-amino-acid, 39.2-kDa protein with 73.8%
similarity
and 66.0% identity to
E. coli WecB, which is
required for bacteriophage
N4 adsorption and encodes
UDP-
N-acetylglucosamine 2-epimerase
function
(
19). It is also highly homologous (71.2% similarity
and
64.6% identity) to EpsC of
Pseudomonas solanacearum, which
is required for the production of the exopolysaccharide 1 (EPS1)
virulence factor (
14).
vpsL, the first gene in
the second
vps cluster, is predicted to encode a
464-amino-acid, 52.9-kDa protein
that is homologous to members of a
large enzyme family that catalyze
the transfer of glucosyl-1-phosphate
from UDP glucose to polyprenolphosphate

the
first step in the
biosynthesis of lipid intermediates for polysaccharide
synthesis.
Homologous family members of VpsL include: WcaJ of
E. coli (
32) (56.0% similarity and 45.6% identity),
AmsG (
2)
of
Erwinia amylovora (39.7 and
30.5%), RfbP (
18) of serovar
Typhimurium (39.5 and
28.5%), and ExoY (
25) of
Rhizobium meliloti (48.5 and 38.8%).
To estimate the abundance of
vpsA, vpsL, and
vpsR
mRNA in smooth and rugose colonial variants, total RNA was isolated
from
exponentially growing smooth and rugose cultures and reverse
transcribed
using random hexamers, and the resulting cDNAs were used
for real-time
PCR using the corresponding TaqMan PCR primer-probe set.
A standard
curve for each of the genes was generated using different
amounts
of chromosomal DNA and the respective TaqMan PCR primer-probe
set; this standard curve was then used to measure message abundance
by
reference to the Ct value for each gene. Figure
4A, which depicts
the calculated message
abundance for the each of the three tested
genes in exponentially
growing rugose and smooth variants, shows
low levels of
vpsA
mRNA (1.5 × 10
3 cDNA copies/250 pg of RNA) and
vpsL mRNA (2.3 × 10
3 cDNA copies/250 pg of
RNA) in the smooth colonial variant. Even
though these levels were low,
samples subjected to RT contained
higher amounts of template molecules
than the untreated samples.
Thus,
vpsA and
vpsL
are transcribed during exponential growth
of the smooth variant,
although at low "basal levels." In comparison,
the message
abundances of
vpsA and
vpsL in the rugose variant
were dramatically greater, 2.3 × 10
5 and 1.3 × 10
5 copies/250 pg of RNA, respectively. Therefore, high
levels of
vpsA and
vpsL mRNA are correlated with
the rugose colonial morphotype
and accordingly with EPS
ETr
production and biofilm formation. In contrast, the abundance
of the
vpsR message was similar in both colonial variants (Fig.
4A).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4.
Transcriptional activity of vpsR and of the
EPSETr biosynthetic gene cluster. (A) vpsR,
vpsA, and vpsL mRNA abundance in wild-type smooth and
rugose colonial variants. Standard curves for the vpsR,
vpsA, and vpsL genes were generated by plotting the Ct
value against the input DNA concentration, as described in Materials
and Methods. Message abundance in exponentially growing wild-type
smooth and rugose strains was calculated using the corresponding
equations from the standard curves and the Ct values obtained after RT
of total RNA, followed by real-time PCR amplification. vpsA
and vpsL of the EPSETr biosynthetic gene cluster
are strongly expressed in the rugose variant, but they are also
expressed at low, basal levels in the smooth variant. Smooth and rugose
variants expressed vpsR at equivalent levels. (B)
Complementation of the vpsR mutant restores vpsA
and vpsL expression. The vpsR mutant of the
rugose colonial variant (denoted R-vpsR) was complemented with either a
control plasmid (pC) or the control plasmid containing a wild-type copy
of vpsR (p1). vpsA and vpsL mRNA
abundances were determined during exponential growth for the
complemented (R-vpsR/p1) and noncomplemented (R-vpsR/pC) mutant.
Message abundance is expressed as the number of cDNA copies detected in
250 pg of total RNA.
|
|
These results show that changes in
vpsR expression, at the
transcriptional level, are not involved in the regulated expression
of
vpsA and
vpsL. However, this finding is still
compatible with
the possibility that
vpsR is required for
the expression of these
genes because this class of response regulators
is activated by
a posttranslational event, namely, phosphorylation of a
critical
Asp residue by the sensor kinase. Therefore, to further test
if
vpsR is required for the transcriptional regulation of
the EPS
ETr biosynthetic gene cluster, the abundance of
vpsA mRNA and
vpsL mRNA was determined for the
vpsR mutant of the rugose colonial
variant. As shown in Fig.
4B, the expression of
vpsA and
vpsL is
dramatically lower in the
vpsR regulatory mutant. However,
expression levels were partially restored upon complementation.
The
partial complementation could be due to the fact that the
expression of
the normal chromosomal copy of
vpsR might differ
from the
expression of an episomal copy of the same gene. These
results indicate
that
vpsR likely functions as a positive transcriptional
regulator of
vpsA and
vpsL and therefore acts to
positively regulate
EPS
ETr production and biofilm formation
as
well.
Comparison of vps gene expression by V. cholerae O1 El Tor strains A1552 and N16961 during biofilm
formation.
Transposon mutagenesis of V. cholerae O1
N16961 by Watnick and Kolter led to the identification of three classes
of genes (pili, flagella, and some of the EPSETr
biosynthesis genes previously identified by Yildiz and Schoolnik [39] that contribute to the biofilm phenotype
[36]). However, Watnick and colleagues used only the
smooth colonial variant in their studies, yet their mutational strategy
and biofilm-forming screen were able to identify genes in the EPS
biosynthetic cluster. In contrast, the experiments we report here,
which were conducted with strain A1552 in a liquid medium, show that
vpsR-regulated genes of the EPS biosynthetic cluster are
highly expressed in the rugose colonial variant (Fig. 4A). Three
possible reasons might account for this apparent discrepancy: first,
the expression levels of the vps genes may exhibit
strain-specific differences under the same condition of growth; second,
the biofilm environment, including contact with the glass or plastic
surface, might induce transcription of the vps biosynthetic
gene cluster, even in the smooth variant, when compared to growth in a
liquid medium; and third, the biofilm microenvironment might induce
phase transition from the smooth to the rugose morphotype. To address
these issues, biofilms formed by the smooth colonial variants of the
two strains after 24 h of incubation at 30°C were quantitatively
compared using the crystal violet-based method described for Fig. 3.
The results (Fig. 5A) indicate that
N16961 forms an approximately twofold-greater biofilm than A1552. To
determine if differences between the biofilm phenotype of the two
strains are correlated with differences in the expression of
vps biosynthesis genes, the abundance of vpsR,
vpsA, and vpsL mRNA in biofilms formed in polystyrene
petri plates after 24 h of incubation at 30°C was quantified for
each of the two strains using real-time PCR. As shown in Fig. 5B, the
amounts of vpsR, vpsA, and vpsL message were
5.2-, 12.6-, and 44.7-fold higher, respectively, in N16961 biofilms
compared to A1552 biofilms. The differences in expression data are
therefore consistent with the differences in biofilm magnitude for the
smooth variants of the two strains.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison of V. cholerae O1 El Tor strains
A1552 and N16961 for biofilm phenotype and vps gene
expression. (A) Biofilm-forming phenotypes of the smooth strains A1552
and N16961. Biofilm formation was analyzed by growing the strains in LB
broth at 30°C for 24 h in polyvinyl chloride microtiter plates,
and then the biofilms were quantified by crystal violet staining. The
biofilm-forming capacity of the N16961 strain after 24 h of growth
in polyvinyl chloride microtiter plates is twofold higher than that of
the A1552 strain. (B) Expression analysis of vps genes in
the strains A1552 and N16961. The abundance of vpsR, vpsA,
and vpsL messages was quantified by copy number
determination using real-time PCR. All three genes were expressed at a
higher level in N16961 than in A1552.
|
|
To determine if the differences could be due to a possible effect of
the biofilm microenvironment that might induce transition
from the
smooth to the rugose morphotype and thereby be associated
with
increased expression of the
vps genes, cells from the same
biofilms were removed, serially diluted, and plated onto LB agar
plates. We recovered 10
8 to 10
9 cells per
biofilm and observed that neither of the strains exhibited
conversion
from the smooth to the rugose morphotype under the
conditions tested.
Thus, the difference between the biofilm phenotypes
of
V. cholerae O1 El Tor A1552 and
N16961 depicted in Fig.
5A is most
likely due in part to strain-specific variation in
the expression of
vps genes.
 |
DISCUSSION |
We have identified vpsR, a gene encoding a positive
transcriptional regulator of EPSETr biosynthetic gene
expression and the biofilm-forming phenotype by the rugose colonial
variant of V. cholerae O1 El Tor. When mutation of
vpsR was undertaken in a rugose background, the colony formed by the resulting mutant resembled the smooth colonial variant. However, the quantitative biofilm assay results depicted in Fig. 3
showed that this mutant exhibits a biofilm-forming capacity that is
intermediate between those of the wild-type rugose and smooth variants.
EPS biosynthesis mutants of the rugose colonial variants, including
vpsA and vpsL mutants, also exhibit an
intermediate biofilm phenotype (unpublished data). In view of these
results, it seems most likely that the rugose variant selectively
expresses not only genes in the vps biosynthetic cluster but
also other genes as well. These other genes are not under the control
of vpsR, but they nonetheless contribute to the
biofilm-forming phenotype of the rugose variant. Thus, the fully
manifested three-dimensional biofilm of the rugose variant is likely to
be the product of several separate effector genes and their cognate
regulators, including vpsR.
VpsR was found to be highly homologous to several response regulators
which, in well-characterized two-component signal transduction systems,
have been shown to act in conjunction with a cognate sensor kinase
protein. Activation of the response regulator typically occurs as a
result of sensor kinase-mediated phosphorylation of a conserved Asp
residue within the N-terminal segment of the response regulator
component. VpsR lacks two conserved residues, Asp and Lys, which are
critical for phosphorylation and are present at the N-terminal domain.
AlgB and AlgR response regulators, which control alginate production by
activating the transcription of algD, do not need to be
phosphorylated for their roles in alginate production
(24). Therefore, it will be of interest to determine if
VpsR requires phosphorylation for its function and if the mode of
phosphorylation differs from the typical members of the response regulators.
In well-characterized two-component signal transduction systems,
response regulators have been shown to act in conjunction with a
cognate sensor kinase protein. Because the response regulator and the
sensor kinase are in close proximity to one another in many
two-component regulatory systems, we examined ca. 2 kb of the sequence
flanking vpsR. However, we failed to locate a gene that
might encode the cognate sensor component of VpsR within this sequenced
region, nor was a candidate cognate sensor kinase identified among the
transposon mutants characterized thus far. Analysis of the annotated
genome sequence of V. cholerae O1 may lead to the
identification of candidate genes for this sensor kinase
(13). VpsR also contains a helix-turn-helix, DNA-binding motif near the C terminus. Thus, it is possible that VpsR directly activates the transcription of vps biosynthetic genes by
binding upstream promoter regions within this cluster. Alternatively, VpsR may mediate its effect on vps gene transcription
indirectly, by interacting with another positive regulator of
vps expression. The results described here are compatible
with either possibility.
VpsR is highly homologous with NtrC of serovar Typhimurium (Fig. 1B),
and most such homologues act in concert with the alternative sigma
factor RpoN. However, the expression of vpsA and
vpsL were not altered in an rpoN-null mutant
generated in the rugose variant (data not shown). Further, analysis of
the upstream regions of vpsA and vpsL did not
reveal the TGGCACn4TTTGCA sequences recognized by sigma-54
(7). Thus, like AlgB of P. aeruginosa, a
response regulator that harbors a RpoN-binding domain (11,
37), VpsR does not require RpoN to activate vps gene transcription.
Complementation studies reported in this study were performed with the
vpsR gene cloned from the smooth form of V. cholerae O1 El Tor. At present the mechanism of smooth-to-rugose
transition and vice versa is not known. However, our observations
suggest that vpsR is not the gene functioning as the switch.
Instead, VpsR may be the target of the switch.
Biofilm formation and decay must be a tightly controlled system if it
is to confer a selective advantage in natural aquatic habitats that are
subject to changes in a variety of physicochemical parameters,
including nutrient availability, salinity, and sheer force generated by
flowing water. For the system to be adequately responsive, flexible,
and robust, some environmental signals should trigger biofilm
formation, whereas others should inhibit this process and initiate
biofilm dissolution. Thus, depending on the signal, processes would be
initiated that change the ratio of the sessile to the planktonic
populations of the species. We predict that VpsR will be only one of
several regulators of this process as is the case for the much more
thoroughly studied alginate-dependent biofilm system of P. aeruginosa. Alginate biosynthesis by mucoid strains of this
species requires two response regulators (AlgB and AlgR) (6, 11,
37), an alternative sigma factor (AlgT) (38), and a
ribbon-helix-helix DNA-binding protein (AlgZ) (1). Further, the development of a mature biofilm architecture containing pillars of alginate-embedded bacteria that are separated by
water-containing channels requires quorum sensing mediated by the
lasI product, N-(3-oxododecanoly)-L-homoserine
(5). The V. cholerae O1 biofilm system is
likely to be equally complex. For example, studies by Watnick and
Kolter of the complex biofilm-forming system of this species
(36) led them to propose a three-step model of biofilm development: first, mannose-sensitive hemagglutinin type IV pili and
flagella facilitate the attachment of free-swimming bacteria to a
surface; second, the flagella cause attached bacteria to spread across
the surface; and third, EPS is secreted (36), providing
the extracellular matrix of the mature biofilm's three-dimensional structure. The work presented here highlights another level of complexity by pointing out that different V. cholerae O1 El
Tor isolates can vary significantly with respect to the third proposed step of biofilm development, vps gene expression. V. cholerae O1 El Tor, strain A1552, the prototype strain used in our
study, was isolated in Peru at the beginning of the recent South
American outbreak, where epidemic cholera had been absent for over a
century. In contrast, strain N16961, studied by Watnick and Kolter, was
isolated in India, where cholera has long been endemic. Based on the
comparative analysis of the biofilm-forming phenotypes of these strains
depicted in Fig. 5A, the smooth variant of N16961 is a better biofilm
former than the smooth variant of A1552 and correspondingly exhibits
more vpsA and vpsL expression. Strain-to-strain variation in the biofilm phenotype further compounded by intrastrain differences between the rugose and smooth-colony types. If the biofilm
phenotype is important for the survival of V. cholerae O1 El
Tor in an aquatic habitat, then differences of the kind exhibited by
strains A1552 and N16961 could cause the latter to be more
environmentally fit than the former. If so, then it is possible that
adaptation to different geographic locations and, in turn, acclimation
to distinct microenvironments could have led to the observed
differences in this important phenotype.
 |
ACKNOWLEDGMENTS |
We thank Melissa Carter (CSU Hayward) for help with the scanning
electron microscopy, Nafisa Ghori (Stanford) for help with the
transmission electron microscopy, Susan Palmieri for help with the
CSLM, Lee Kozar for his assistance with sequence analysis of the
vps gene cluster, Denise Monack for providing pACYC-GFP, and
TIGR for early release of vps coding sequence.
This work is supported by NIH grant RO1-AI43422.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Stanford University Medical School,
Stanford, CA 94305. Phone: (650) 723-7026. Fax: (650) 723-1399. E-mail: fitnat{at}cmgm.stanford.edu.
 |
REFERENCES |
| 1.
|
Baynham, P. J., and D. J. Wozniak.
1996.
Identification and characterization of AlgZ, an AlgT-dependent DNA-binding protein required for Pseudomonas aeruginosa algD transcription.
Mol. Microbiol.
22:97-108[CrossRef][Medline].
|
| 2.
|
Bugert, P., and K. Geider.
1995.
Molecular analysis of the ams operon required for exopolysaccharide synthesis of Erwinia amylovora.
Mol. Microbiol.
15:917-933[Medline].
|
| 3.
|
Chopra, A. K.,
J. W. Peterson, and R. Prasad.
1991.
Cloning and sequence analysis of hydrogenase regulatory genes (hydHG) from Salmonella typhimurium.
Biochim. Biophys. Acta
1129:115-118[Medline].
|
| 4.
|
Costerton, J. W.,
Z. Lewandowski,
D. E. Caldwell,
D. R. Korber, and H. M. Lappin-Scott.
1995.
Microbial biofilms.
Annu. Rev. Microbiol.
49:711-745[CrossRef][Medline].
|
| 5.
|
Davies, D. G.,
M. R. Parsek,
J. P. Pearson,
B. H. Iglewski,
J. W. Costerton, and E. P. Greenberg.
1998.
The involvement of cell-to-cell signals in the development of a bacterial biofilm.
Science
280:295-298[Abstract/Free Full Text].
|
| 6.
|
Deretic, V.,
R. Dikshit,
W. M. Konyecsni,
A. M. Chakrabarty, and T. K. Misra.
1989.
The algR gene, which regulates mucoidy in Pseudomonas aeruginosa, belongs to a class of environmentally responsive genes.
J. Bacteriol.
171:1278-1283[Abstract/Free Full Text].
|
| 7.
|
Drummond, M.,
P. Whitty, and J. Wootton.
1986.
Sequence and domain relationships of ntrC and nifA from Klebsiella pneumoniae: homologies to other regulatory proteins.
EMBO J.
5:441-447[Medline].
|
| 8.
|
Flashner, Y.,
D. S. Weiss,
J. Keener, and S. Kustu.
1995.
Constitutive forms of the enhancer-binding protein NtrC: evidence that essential oligomerization determinants lie in the central activation domain.
J. Mol. Biol.
249:700-713[CrossRef][Medline].
|
| 9.
|
Fletcher, M.
1996.
Bacterial attachment in aquatic environments: a diversity of surfaces and adhesion strategies, p. 1-24.
In
M. Fletcher (ed.), Bacterial adhesion: molecular and ecological diversity. Wiley-Liss, New York, N.Y.
|
| 10.
|
Gibson, U. E.,
C. A. Heid, and P. M. Williams.
1996.
A novel method for real time quantitative RT-PCR.
Genome Res.
6:995-1001[Abstract/Free Full Text].
|
| 11.
|
Goldberg, J. B., and T. Dahnke.
1992.
Pseudomonas aeruginosa AlgB, which modulates the expression of alginate, is a member of the NtrC subclass of prokaryotic regulators.
Mol. Microbiol.
6:59-66[CrossRef][Medline].
|
| 12.
|
Heid, C. A.,
J. Stevens,
K. J. Livak, and P. M. Williams.
1996.
Real time quantitative PCR.
Genome Res.
6:986-994[Abstract/Free Full Text].
|
| 13.
|
Heidelberg, J. F.,
J. A. Eisen,
W. C. Nelson,
R. A. Clayton,
M. L. Gwinn,
R. J. Dodson,
D. H. Haf,
E. K. Hickey,
J. D. Peterson,
L. Umayam,
S. R. Gill,
K. E. Nelson,
T. D. Read,
H. Tettelin,
D. Richardson,
M. D. Ermolaeva,
J. Vamathevan,
S. Bass,
H. Qin,
I. Dragoi,
P. Sellers,
L. McDonald,
T. Utterback,
R. D. Fleishmann,
W. C. Nierman,
W. O. White,
S. T. Salzberg,
H. O. Smith,
R. R. Colwell,
J. J. Mekalanos,
J. C. Venter, and C. M. Fraser.
2000.
DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae.
Nature
406:477-483[CrossRef][Medline].
|
| 14.
|
Huang, J., and M. Schell.
1995.
Molecular characterization of the eps gene cluster of Pseudomonas solanacearum and its transcriptional regulation at a single promoter.
Mol. Microbiol.
16:977-989[Medline].
|
| 15.
|
Islam, M. S.,
B. S. Drasar, and D. J. Bradley.
1990.
Long-term persistence of toxigenic Vibrio cholerae O1 in the mucilaginous sheath of a blue-green alga, Anabaena variabilis.
J. Trop. Med. Hyg.
93:133-139[Medline].
|
| 16.
|
Islam, M. S.,
B. S. Drasar, and D. J. Bradley.
1990.
Survival of toxigenic Vibrio cholerae O1 with a common duckweed, Lemna minor, in artificial aquatic ecosystems.
Trans. R. Soc. Trop. Med. Hyg.
84:422-424[CrossRef][Medline].
|
| 17.
|
Islam, M. S.,
B. S. Drasar, and R. B. Sack.
1994.
The aquatic flora and fauna as reservoirs of Vibrio cholerae: a review.
J. Diarrhoeal. Dis. Res.
12:87-96[Medline].
|
| 18.
|
Jiang, X. M.,
B. Neal,
F. Santiago,
S. J. Lee,
L. K. Romana, and P. R. Reeves.
1991.
Structure and sequence of the rfb (O antigen) gene cluster of Salmonella serovar typhimurium (strain LT2).
Mol. Microbiol.
5:695-713[CrossRef][Medline].
|
| 19.
|
Kiino, D. R.,
R. Licudine,
K. Wilt,
D. H. Yang, and L. B. Rothman-Denes.
1993.
A cytoplasmic protein, NfrC, is required for bacteriophage N4 adsorption.
J. Bacteriol.
175:7074-7080[Abstract/Free Full Text].
|
| 20.
|
Klose, K. E.,
V. Novik, and J. J. Mekalanos.
1998.
Identification of multiple sigma 54-dependent transcriptional activators in Vibrio cholerae.
J. Bacteriol.
180:5256-5259[Abstract/Free Full Text].
|
| 21.
|
Kolter, R., and R. Losick.
1998.
One for all and all for one.
Science
280:226-227[Free Full Text].
|
| 22.
|
Kustu, S.,
E. Santero,
J. Keener,
D. Popham, and D. Weiss.
1989.
Expression of sigma 54 (ntrA)-dependent genes is probably united by a common mechanism.
Microbiol. Rev.
53:367-376[Free Full Text].
|
| 23.
|
Leveque, F.,
P. Plateau,
P. Dessen, and S. Blanquet.
1990.
Homology of lysS and lysU, the two Escherichia coli genes encoding distinct lysyl-tRNA synthetase species.
Nucleic Acids Res.
18:305-312[Abstract/Free Full Text].
|
| 24.
|
Ma, S.,
U. Selvaraj,
D. E. Ohman,
R. Quarless,
D. J. Hassett, and D. J. Wozniak.
1998.
Phosphorylation-independent activity of the response regulators AlgB and AlgR in promoting alginate biosynthesis in mucoid Pseudomonas aeruginosa.
J. Bacteriol.
180:956-968[Abstract/Free Full Text].
|
| 25.
|
Muller, P.,
M. Keller,
W. M. Weng,
J. Quandt,
W. Arnold, and A. Puhler.
1993.
Genetic analysis of the Rhizobium meliloti exoYFQ operon: ExoY is homologous to sugar transferases and ExoQ represents a transmembrane protein.
Mol. Plant-Microbe Interact.
6:55-65[Medline].
|
| 26.
|
North, A. K.,
K. E. Klose,
K. M. Stedman, and S. Kustu.
1993.
Prokaryotic enhancer-binding proteins reflect eukaryote-like modularity: the puzzle of nitrogen regulatory protein C.
J. Bacteriol.
175:4267-4273[Free Full Text].
|
| 27.
|
O'Toole, G. A., and R. Kolter.
1998.
Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis.
Mol. Microbiol.
28:449-461[CrossRef][Medline].
|
| 28.
|
Pabo, C. A., and R. T. Sauer.
1984.
Protein DNA recognition.
Annu. Rev. Biochem.
53:293-321[CrossRef][Medline].
|
| 29.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 30.
|
Singleton, F.,
C. Attwell,
M. Jangi, and R. Colwell.
1983.
Influence of salinity, nutrient concentration and temperature on growth and survival of Vibrio cholerae in the aquatic environment.
In
S. Kuwahara, and N. Pierce (ed.), Advances in research on cholera and related diarrheas. JTJ Scientific Publisher, Tokyo, Japan.
|
| 31.
|
Singleton, F. L.,
R. W. Attwell,
M. S. Jangi, and R. R. Colwell.
1982.
Influence of salinity and organic nutrient concentration on survival and growth of Vibrio cholerae in aquatic microcosms.
Appl. Environ. Microbiol.
43:1080-1085[Abstract/Free Full Text].
|
| 32.
|
Stevenson, G.,
K. Andrianopoulos,
M. Hobbs, and P. R. Reeves.
1996.
Organization of the Escherichia coli K-12 gene cluster responsible for production of the extracellular polysaccharide colanic acid.
J. Bacteriol.
178:4885-4893[Abstract/Free Full Text].
|
| 33.
|
Stock, J. B.,
A. J. Ninfa, and A. M. Stock.
1989.
Protein phosphorylation and regulation of adaptive responses in bacteria.
Microbiol. Rev.
53:450-490[Abstract/Free Full Text].
|
| 34.
|
Timms, A. R., and B. A. Bridges.
1998.
Reversion of the tyrosine ochre strain Escherichia coli WU3610 under starvation conditions depends on a new gene tas.
Genetics
48:1627-1635.
|
| 35.
|
Wai, S. N.,
Y. Mizunoe,
A. Takade,
S. I. Kawabata, and S. I. Yoshida.
1998.
Vibrio cholerae O1 strain TSI-4 produces the exopolysaccharide materials that determine colony morphology, stress resistance, and biofilm formation.
Appl. Environ. Microbiol.
64:3648-3655[Abstract/Free Full Text].
|
| 36.
|
Watnick, P. I., and R. Kolter.
1999.
Steps in the development of a Vibrio cholerae El Tor biofilm.
Mol. Microbiol.
34:586-595[CrossRef][Medline].
|
| 37.
|
Wozniak, D. J., and D. E. Ohman.
1991.
Pseudomonas aeruginosa AlgB, a two-component response regulator of the NtrC family, is required for algD transcription.
J. Bacteriol.
173:1406-1413[Abstract/Free Full Text].
|
| 38.
|
Wozniak, D. J., and D. E. Ohman.
1994.
Transcriptional analysis of the Pseudomonas aeruginosa genes algR, algB, and algD reveals a hierarchy of alginate gene expression which is modulated by algT.
J. Bacteriol.
176:6007-6014[Abstract/Free Full Text].
|
| 39.
|
Yildiz, F. H., and G. K. Schoolnik.
1999.
Vibrio cholerae O1 El Tor: identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine resistance, and biofilm formation.
Proc. Natl. Acad. Sci. USA
96:4028-4033[Abstract/Free Full Text].
|
Journal of Bacteriology, March 2001, p. 1716-1726, Vol. 183, No. 5
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.5.1716-1726.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shikuma, N. J., Fong, J. C. N., Odell, L. S., Perchuk, B. S., Laub, M. T., Yildiz, F. H.
(2009). Overexpression of VpsS, a Hybrid Sensor Kinase, Enhances Biofilm Formation in Vibrio cholerae. J. Bacteriol.
191: 5147-5158
[Abstract]
[Full Text]
-
Shikuma, N. J., Yildiz, F. H.
(2009). Identification and Characterization of OscR, a Transcriptional Regulator Involved in Osmolarity Adaptation in Vibrio cholerae. J. Bacteriol.
191: 4082-4096
[Abstract]
[Full Text]
-
Karatan, E., Watnick, P.
(2009). Signals, Regulatory Networks, and Materials That Build and Break Bacterial Biofilms. Microbiol. Mol. Biol. Rev.
73: 310-347
[Abstract]
[Full Text]
-
Mueller, R. S., Beyhan, S., Saini, S. G., Yildiz, F. H., Bartlett, D. H.
(2009). Indole Acts as an Extracellular Cue Regulating Gene Expression in Vibrio cholerae. J. Bacteriol.
191: 3504-3516
[Abstract]
[Full Text]
-
Tsou, A. M., Cai, T., Liu, Z., Zhu, J., Kulkarni, R. V.
(2009). Regulatory targets of quorum sensing in Vibrio cholerae: evidence for two distinct HapR-binding motifs. Nucleic Acids Res
37: 2747-2756
[Abstract]
[Full Text]
-
Hammer, B. K., Bassler, B. L.
(2009). Distinct Sensory Pathways in Vibrio cholerae El Tor and Classical Biotypes Modulate Cyclic Dimeric GMP Levels To Control Biofilm Formation. J. Bacteriol.
191: 169-177
[Abstract]
[Full Text]
-
Beyhan, S., Odell, L. S., Yildiz, F. H.
(2008). Identification and Characterization of Cyclic Diguanylate Signaling Systems Controlling Rugosity in Vibrio cholerae. J. Bacteriol.
190: 7392-7405
[Abstract]
[Full Text]
-
Tomaras, A. P., Flagler, M. J., Dorsey, C. W., Gaddy, J. A., Actis, L. A.
(2008). Characterization of a two-component regulatory system from Acinetobacter baumannii that controls biofilm formation and cellular morphology. Microbiology
154: 3398-3409
[Abstract]
[Full Text]
-
Fong, J. C. N., Yildiz, F. H.
(2008). Interplay between Cyclic AMP-Cyclic AMP Receptor Protein and Cyclic di-GMP Signaling in Vibrio cholerae Biofilm Formation. J. Bacteriol.
190: 6646-6659
[Abstract]
[Full Text]
-
Darnell, C. L., Hussa, E. A., Visick, K. L.
(2008). The Putative Hybrid Sensor Kinase SypF Coordinates Biofilm Formation in Vibrio fischeri by Acting Upstream of Two Response Regulators, SypG and VpsR. J. Bacteriol.
190: 4941-4950
[Abstract]
[Full Text]
-
Hussa, E. A., Darnell, C. L., Visick, K. L.
(2008). RscS Functions Upstream of SypG To Control the syp Locus and Biofilm Formation in Vibrio fischeri. J. Bacteriol.
190: 4576-4583
[Abstract]
[Full Text]
-
Waters, C. M., Lu, W., Rabinowitz, J. D., Bassler, B. L.
(2008). Quorum Sensing Controls Biofilm Formation in Vibrio cholerae through Modulation of Cyclic Di-GMP Levels and Repression of vpsT. J. Bacteriol.
190: 2527-2536
[Abstract]
[Full Text]
-
Tamayo, R., Schild, S., Pratt, J. T., Camilli, A.
(2008). Role of Cyclic Di-GMP during El Tor Biotype Vibrio cholerae Infection: Characterization of the In Vivo-Induced Cyclic Di-GMP Phosphodiesterase CdpA. Infect. Immun.
76: 1617-1627
[Abstract]
[Full Text]
-
Bernier, S. P., Nguyen, D. T., Sokol, P. A.
(2008). A LysR-Type Transcriptional Regulator in Burkholderia cenocepacia Influences Colony Morphology and Virulence. Infect. Immun.
76: 38-47
[Abstract]
[Full Text]
-
Matson, J. S., Withey, J. H., DiRita, V. J.
(2007). Regulatory Networks Controlling Vibrio cholerae Virulence Gene Expression. Infect. Immun.
75: 5542-5549
[Full Text]
-
Pagel, M., Simonet, V., Li, J., Lallemand, M., Lauman, B., Delcour, A. H.
(2007). Phenotypic Characterization of Pore Mutants of the Vibrio cholerae Porin OmpU. J. Bacteriol.
189: 8593-8600
[Abstract]
[Full Text]
-
Liang, W., Silva, A. J., Benitez, J. A.
(2007). The Cyclic AMP Receptor Protein Modulates Colonial Morphology in Vibrio cholerae. Appl. Environ. Microbiol.
73: 7482-7487
[Abstract]
[Full Text]
-
Hussa, E. A., O'Shea, T. M., Darnell, C. L., Ruby, E. G., Visick, K. L.
(2007). Two-Component Response Regulators of Vibrio fischeri: Identification, Mutagenesis, and Characterization. J. Bacteriol.
189: 5825-5838
[Abstract]
[Full Text]
-
Mueller, R. S., McDougald, D., Cusumano, D., Sodhi, N., Kjelleberg, S., Azam, F., Bartlett, D. H.
(2007). Vibrio cholerae Strains Possess Multiple Strategies for Abiotic and Biotic Surface Colonization. J. Bacteriol.
189: 5348-5360
[Abstract]
[Full Text]
-
Pratt, J. T., Tamayo, R., Tischler, A. D., Camilli, A.
(2007). PilZ Domain Proteins Bind Cyclic Diguanylate and Regulate Diverse Processes in Vibrio cholerae. J. Biol. Chem.
282: 12860-12870
[Abstract]
[Full Text]
-
Fong, J. C. N., Yildiz, F. H.
(2007). The rbmBCDEF Gene Cluster Modulates Development of Rugose Colony Morphology and Biofilm Formation in Vibrio cholerae. J. Bacteriol.
189: 2319-2330
[Abstract]
[Full Text]
-
Curtis, S. K., Kothary, M. H., Blodgett, R. J., Raybourne, R. B., Ziobro, G. C., Tall, B. D.
(2007). Rugosity in Grimontia hollisae. Appl. Environ. Microbiol.
73: 1215-1224
[Abstract]
[Full Text]
-
Lim, B., Beyhan, S., Yildiz, F. H.
(2007). Regulation of Vibrio Polysaccharide Synthesis and Virulence Factor Production by CdgC, a GGDEF-EAL Domain Protein, in Vibrio cholerae. J. Bacteriol.
189: 717-729
[Abstract]
[Full Text]
-
Beyhan, S., Bilecen, K., Salama, S. R., Casper-Lindley, C., Yildiz, F. H.
(2007). Regulation of Rugosity and Biofilm Formation in Vibrio cholerae: Comparison of VpsT and VpsR Regulons and Epistasis Analysis of vpsT, vpsR, and hapR. J. Bacteriol.
189: 388-402
[Abstract]
[Full Text]
-
Liu, Z., Stirling, F. R., Zhu, J.
(2007). Temporal Quorum-Sensing Induction Regulates Vibrio cholerae Biofilm Architecture. Infect. Immun.
75: 122-126
[Abstract]
[Full Text]
-
Anriany, Y., Sahu, S. N., Wessels, K. R., McCann, L. M., Joseph, S. W.
(2006). Alteration of the Rugose Phenotype in waaG and ddhC Mutants of Salmonella enterica Serovar Typhimurium DT104 Is Associated with Inverse Production of Curli and Cellulose.. Appl. Environ. Microbiol.
72: 5002-5012
[Abstract]
[Full Text]
-
Beyhan, S., Tischler, A. D., Camilli, A., Yildiz, F. H.
(2006). Transcriptome and Phenotypic Responses of Vibrio cholerae to Increased Cyclic di-GMP Level.. J. Bacteriol.
188: 3600-3613
[Abstract]
[Full Text]
-
Fong, J. C. N., Karplus, K., Schoolnik, G. K., Yildiz, F. H.
(2006). Identification and Characterization of RbmA, a Novel Protein Required for the Development of Rugose Colony Morphology and Biofilm Structure in Vibrio cholerae. J. Bacteriol.
188: 1049-1059
[Abstract]
[Full Text]
-
Song, H., Belanger, M., Whitlock, J., Kozarov, E., Progulske-Fox, A.
(2005). Hemagglutinin B Is Involved in the Adherence of Porphyromonas gingivalis to Human Coronary Artery Endothelial Cells. Infect. Immun.
73: 7267-7273
[Abstract]
[Full Text]
-
Karatan, E., Duncan, T. R., Watnick, P. I.
(2005). NspS, a Predicted Polyamine Sensor, Mediates Activation of Vibrio cholerae Biofilm Formation by Norspermidine. J. Bacteriol.
187: 7434-7443
[Abstract]
[Full Text]
-
Tischler, A. D., Camilli, A.
(2005). Cyclic Diguanylate Regulates Vibrio cholerae Virulence Gene Expression. Infect. Immun.
73: 5873-5882
[Abstract]
[Full Text]
-
Kapfhammer, D., Karatan, E., Pflughoeft, K. J., Watnick, P. I.
(2005). Role for Glycine Betaine Transport in Vibrio cholerae Osmoadaptation and Biofilm Formation within Microbial Communities. Appl. Environ. Microbiol.
71: 3840-3847
[Abstract]
[Full Text]
-
Purdy, A., Rohwer, F., Edwards, R., Azam, F., Bartlett, D. H.
(2005). A Glimpse into the Expanded Genome Content of Vibrio cholerae through Identification of Genes Present in Environmental Strains. J. Bacteriol.
187: 2992-3001
[Abstract]
[Full Text]
-
Grau, B. L., Henk, M. C., Pettis, G. S.
(2005). High-Frequency Phase Variation of Vibrio vulnificus 1003: Isolation and Characterization of a Rugose Phenotypic Variant. J. Bacteriol.
187: 2519-2525
[Abstract]
[Full Text]
-
Laffey, S. F., Butler, G.
(2005). Phenotype switching affects biofilm formation by Candida parapsilosis. Microbiology
151: 1073-1081
[Abstract]
[Full Text]
-
Heithoff, D. M., Mahan, M. J.
(2004). Vibrio cholerae Biofilms: Stuck between a Rock and a Hard Place. J. Bacteriol.
186: 4835-4837
[Full Text]
-
Lauriano, C. M., Ghosh, C., Correa, N. E., Klose, K. E.
(2004). The Sodium-Driven Flagellar Motor Controls Exopolysaccharide Expression in Vibrio cholerae. J. Bacteriol.
186: 4864-4874
[Abstract]
[Full Text]
-
Casper-Lindley, C., Yildiz, F. H.
(2004). VpsT Is a Transcriptional Regulator Required for Expression of vps Biosynthesis Genes and the Development of Rugose Colonial Morphology in Vibrio cholerae O1 El Tor. J. Bacteriol.
186: 1574-1578
[Abstract]
[Full Text]
-
Kierek, K., Watnick, P. I.
(2003). From The Cover: The Vibrio cholerae O139 O-antigen polysaccharide is essential for Ca2+-dependent biofilm development in sea water. Proc. Natl. Acad. Sci. USA
100: 14357-14362
[Abstract]
[Full Text]
-
Worthington, E. N., Kavakli, I. H., Berrocal-Tito, G., Bondo, B. E., Sancar, A.
(2003). Purification and Characterization of Three Members of the Photolyase/Cryptochrome Family Blue-light Photoreceptors from Vibrio cholerae. J. Biol. Chem.
278: 39143-39154
[Abstract]
[Full Text]
-
Guvener, Z. T., McCarter, L. L.
(2003). Multiple Regulators Control Capsular Polysaccharide Production in Vibrio parahaemolyticus. J. Bacteriol.
185: 5431-5441
[Abstract]
[Full Text]
-
Kierek, K., Watnick, P. I.
(2003). Environmental Determinants of Vibrio cholerae Biofilm Development. Appl. Environ. Microbiol.
69: 5079-5088
[Abstract]
[Full Text]
-
Bomchil, N., Watnick, P., Kolter, R.
(2003). Identification and Characterization of a Vibrio cholerae Gene, mbaA, Involved in Maintenance of Biofilm Architecture. J. Bacteriol.
185: 1384-1390
[Abstract]
[Full Text]
-
Ali, A., Rashid, M. H., Karaolis, D. K. R.
(2002). High-Frequency Rugose Exopolysaccharide Production by Vibrio cholerae. Appl. Environ. Microbiol.
68: 5773-5778
[Abstract]
[Full Text]