Previous Article | Next Article ![]()
Journal of Bacteriology, March 2001, p. 1740-1747, Vol. 183, No. 5
Department of Biology, Texas A&M University,
College Station, Texas 77843-3258
Received 8 August 2000/Accepted 13 December 2000
The psbAI gene of the cyanobacterium
Synechococcus elongatus PCC 7942 is one of three
psbA genes that encode a critical photosystem II reaction
center protein, D1. Regulation of the gene family in response to
changes in the light environment is complex, occurs at transcriptional
and posttranscriptional levels, and results in an interchange of two
different forms of D1 in the membrane. Expression of psbAI
is downregulated under high-intensity light (high light) in contrast to
induction of the other two family members. We show that, in addition to
a known accelerated degradation of the psbAI message,
promoter activity decreases upon exposure to high light. Unlike the
other psbA genes, additional sequences upstream of the
psbAI Cyanobacteria are photosynthetic
prokaryotes that carry out oxygenic photosynthesis like the process in
the chloroplasts of plants and algae (15). This requires
the function of two reaction centers linked in series, of which
photosystem II is the site of water splitting and oxygen evolution.
Critical to the photosystem II complex are two proteins, D1 and D2,
which coordinate the cofactors of light-driven charge separation. In
Synechococcus elongatus PCC 7942, small gene families
consisting of three psbA and two psbD genes,
respectively, encode D1 and D2 (9). The three
psbA genes are regulated at both transcriptional and
posttranscriptional levels by light intensity and quality (4,
36). Under low light conditions (125 µE m Previous studies have shown that psbAII and
psbAIII respond to the shift to high light by
transcriptional induction, while transcripts from both psbAI
and psbAIII are actively destabilized (23).
These responses can be triggered by changes in light fluence or quality
and are independent of photosynthetic electron flow, invoking a genuine
response to light rather than to redox changes (32, 36).
Information that targets these messages, but not that of
psbAII, for accelerated degradation at high light resides within their untranslated leaders (22). The apparent
half-life of loss of the psbAI transcript at high light is
approximately equivalent to the half-life of the message in the
presence of a transcription inhibitor, which implies that no new
transcription contributes to the psbAI message pool under
these conditions. However, there has been no direct investigation of
regulation of the psbAI promoter.
Transcriptional fusions with lacZ previously facilitated the
dissection of the light-responsive psbAII and
psbAIII promoters (25). The minimal promoter
elements that drive constitutive expression correspond to
consensus Escherichia coli It was not practical to measure a possible high-light-regulated
decrease in psbAI transcription with the stable
The features of the psbAI promoter that account for its
strength and organism specificity were of special interest. Extensive assays of promoters fused to luxAB in S. elongatus circadian studies suggest that the psbAI
promoter is among the strongest in this organism (1, 27;
T. Kondo, personal communication; Nair and Golden, unpublished).
However, unlike the other psbA genes and the psbD
genes, the promoter for psbAI is entirely silent in E. coli, to the extent that a psbAI fusion to
lacZ or luxAB produces no detectable reporter
enzyme in that organism (31; unpublished data). The
promoters of all three psbA genes have appropriately spaced
Little is known about the recognition of promoters by the multiple
group 2 sigma factors characteristically present in the genomes of
cyanobacteria (2, 13, 34). Disrupted expression of
rpoD2, a group 2 sigma factor gene, causes altered circadian expression of psbAI in S. elongatus, such that
the amplitude of oscillation is low: not through decreased expression,
but because of elevated expression during a time of day that normally
represents the circadian trough (35). Elevated expression
of psbAI in the absence of RpoD2 suggested either the
unmasking of a competition among the multiple group 2 sigma factors or
the loss of an rpoD2-dependent trans-acting
factor that controls the temporally regulated strength of
psbAI expression (35).
We have defined here the sequences required for psbAI
promoter activity and shown that the smallest fragment sufficient for psbAI::lacZ expression extends from
Construction of lacZ reporter strains and
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.5.1740-1747.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Functional Elements of the Strong psbAI
Promoter of Synechococcus elongatus PCC 7942
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
35 element are required for expression. Mutagenizing the atypical psbAI
10 element from TCTCCT to
TATAAT increased the magnitude of expression from both
psbAI::lacZ and psbAI::luxAB fusions but did not
affect downregulation under high light. Inactivation of group 2 sigma
factor genes rpoD2 and sigC, in both wild-type
and
10-element mutagenized backgrounds, resulted in elevated
psbAI::luxAB expression but did not
alter the response to high light. The results are consistent with
redundancy of promoter recognition among cyanobacterial group 2 sigma
factors. Electrophoretic mobility shift assays showed that the DNA
sequence corresponding to the untranslated leader of the
psbAI message binds one or more proteins from an S. elongatus extract. The corresponding region of psbAII
efficiently competed for this binding activity, suggesting a shared
regulatory factor among these disparately regulated genes.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
2
s
1) over 80% of psbA transcripts are from
psbAI; however, within 15 min after a shift to
high-intensity light conditions (referred to here as "high light";
750 µE m
2 s
1), psbAI messages
decrease by more than 70%, whereas psbAII and psbAIII message levels increase (4). This
results in an interchange of two forms of the D1 protein
(31), because the product of psbAII and
psbAIII differs from that of psbAI by 25 residues. The substitution of one form of D1 for the other is important for cell fitness in a changing light environment (21).
70 promoters,
residing between
39 and +12 for psbAII and positions
38 and
1 for psbAIII (8, 25). Extension of
the right ends of the promoter elements to include the transcribed,
untranslated leader regions of the transcripts enhances and confers
light-responsive expression. One or more S. elongatus
proteins recognizes this region of the DNA, between the transcription
start sites and initiation codons of both psbAII and
psbAIII. Competition experiments suggest that the same
protein(s) recognizes the two genes. Upstream of the basal promoters
are negative elements that depress expression of the corresponding gene.
-galactosidase reporter enzyme that was used to analyze induction of
the other psbA promoters. A
psbAI::lacZ fusion shows only a slight
decrease
-galactosidase activity after 2 h in high light (25;
U. Nair and S. S. Golden, unpublished data). Better
characterization of the psbAI promoter was needed, not
only to complete the analysis of light-dependent regulation of the gene
family but also because this promoter figures prominently in the
study of cyanobacterial circadian rhythms (1, 16, 19, 20,
35).
35 elements characteristic of E. coli
70
promoters; however, the psbAI promoter has an atypical
10
element, TCTCCT (10).
54 to +1. Additional upstream sequences enhance expression but are
not required for light-responsive regulation. A
psbAI::luxAB fusion that lacks any
psbA sequences in the reporter transcript still shows a
marked drop in luciferase activity, indicating that the
psbAI promoter is downregulated, under high light. One or
more proteins in an S. elongatus extract specifically bound
to the psbAI upstream region (+1 to +43), as previously
shown for psbAII, and the untranslated leader region of
psbAII (+1 to +41) could compete efficiently for this
binding activity. Mutagenizing the
10 element of the psbAI
promoter did not alter its regulation but increased the promoter
strength. Inactivation of the group 2 sigma factor genes
rpoD2 and sigC in both wild-type and
10
mutagenized backgrounds resulted in elevated
psbAI::luxAB expression but did not
alter the response to high light.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactosidase assays.
All strains are described in Tables
1 and 2. S. elongatus PCC 7942 has been reported previously without a specific
name as Synechococcus sp. strain PCC 7942. However, as a
close relative of PCC 6301 (11, 37), which has been
proposed as the living neotype of S. elongatus (28,
29), PCC 7942 is assigned to this species name. A pending update
to Bergey's Manual of Determinative Bacteriology will
include this nomenclature (R. Rippka, personal communication).
TABLE 1.
Reporter strains
TABLE 2.
Sigma factor inactivation strains
-Galactosidase
specific activities from cyanobacterial reporter strains under low (125 µE m
2 s
1)- and high (750 µE
m
2 s
1)-light conditions were determined as
previously described (25).
-Galactosidase activity
produced by the promoterless lacZ strain AMC181 (9-12
units) was subtracted from all other values.
Construction of luxAB reporter strains and in vivo luciferase measurements. psbAI promoter fragments generated by PCR were transcriptionally fused to the promoterless luxAB genes from of Vibrio harveyi in the neutral site II (NSII) targeting vector pAM1580 (http://acs.tamu.edu/~ssg7231/ns2.html) (1). Promoter fragments were sequenced as described above. Strain AMC395, carrying psbAI driven luxCDE genes to provide aldehyde substrate for luciferase and a spectinomycin-streptomycin resistance marker in neutral site I (NSI), was transformed with the pAM1580 derivatives. The luxAB fusions integrated at NSII, conferring resistance to chloramphenicol and resulting in autonomous bioluminescence. Reporter strains were propagated in spectinomycin (20 µg/ml) and chloramphenicol (7.5 µg/ml). In vivo luciferase activity was measured from cells grown to an optical density at 750 nm (OD750) of 0.4 as described previously (32). A background bioluminescence of 15,000 to 20,000 U produced by the promoterless luxAB strain AMC397 was subtracted from all other values.
Preparation of protein extract.
DNA-binding proteins were
isolated using a procedure optimized for psbAII-binding
factor purification. Synechococcus cells with an
OD750 of 0.15 to 0.20 were grown in 750-ml flat culture flasks containing BG-11M under low light conditions (100 µE
m
2 s
1). When the OD750 reached
0.35 to 0.50, cultures were exposed to high light (350 µE
m
2 s
1) for 30 min. Cells were collected by
centrifugation at 4,400 × g for 5 min, and the pellets
were stored at
85°C. The extract was prepared from a 4.2-liter
culture of cells. Pellets were resuspended in a total volume of 90 ml
of homogenization buffer (50 mM Tris-HCl [pH 7.5], 1 mM EDTA, 0.5%
Triton X-100, 2 mM dithiothreitol [DTT], 2 mM
4-(2-aminoethyl)benzenesulfonyl fluoride, 1 µM pepstatin, 10%
glycerol). Cells were broken by passage through a French pressure cell
twice at approximately 14,000 lb/in2. The extract was
centrifuged at 27,000 × g for 15 min to remove most of
the cell debris. NaCl was added to the supernatant fraction to a final
concentration of 500 mM to dissociate DNA-binding proteins from
chromosomal DNA. After 15 min, the extract was clarified by
centrifugation at 149,000 × g for 1 h.
Preparation of DNA fragments for electrophoretic mobility shift
assays.
The
54 to +43 and
54 to +1 psbAI
fragments were released from pAM990 by digestion with BamHI
and BglII and end labeled as described earlier
(24). For competition assays the +1 to +41 psbAII fragment and the
54 to +43 and
54 to +1
psbAI fragments were amplified from plasmid templates
(pAM1325 and pAM1468) using Pwo polymerase (Roche Molecular
Biochemicals, Indianapolis, Ind.).
Electrophoretic mobility shift assays. DNA-binding assays were performed as described earlier (24), with the following modifications: the binding buffer did not contain KCl, and gels were run at room temperature for 20 min at 200 V. After drying, gels were read by a Fujix BAS 2000 phosphorimager.
Mutagenesis of the
10 region of the psbAI
promoter.
The
10 element was mutagenized by PCR with mutant
forward primers corresponding to the
54 and
43 endpoints,
respectively, and extending through +43:
GCTAAAAATTAA GGGTTTTTTACACCTTTTTGACAGTTAATATAATAGCCTAAAAAG and
AGGGTTTTTTACACCTTTTTGACAGTTAATATAATAGCCTAAAAAG,
respectively. The reverse primer in the construction of both
mutant fragments was GAGGTTGTAAAGGGGCAAG (+43 right endpoint
of PCR fragments).
Inactivation of sigma factor genes. A 1.93-kb PvuII fragment from pDAH346 (a gift from D. Hodgson) containing a Gmr gene or a 2.0-kb HincII fragment from pKS101 (33) carrying a Kmr gene was inserted into BclI digested and blunted pAM1519 to generate a Gmr (pAM2332) or Kmr (pAM2413) rpoD4 null allele, respectively (12). The rpoD3 gene in pAM1520 was disrupted by the same fragments after being digested with PstI and blunted (12), resulting in pAM2414 (Kmr) and pAM2333 (Gmr). pAM2330 was digested with BclI and BstEII and blunted, and the Gmr PvuII fragment was inserted to create a sigC null allele (pAM2331). Inactivation of the rpoD2 gene (with pAM1344) was described previously (35).
Single or pairwise inactivations of sigma factor genes were made in strains AMC777 and AMC778. Transformants were selected on BG-11M agar with kanamycin (20 µg/ml) and/or gentamicin (2 µg/ml), as appropriate. They were later grown in BG-11M liquid with spectinomycin (20 µg/ml), chloremphenicol (7.5 µg/ml), and either kanamycin or gentamicin as appropriate.Assay of bioluminescence in 96-well microtiter plates. Liquid cultures of AMC777, AMC778, and their sigma-inactivated derivatives were diluted to an OD750 of 0.4. Samples (40 µl) of each were inoculated onto 280-µl BG-11M agar pads in 96-well plates and incubated under continuous light for 12 h. The bioluminescence was measured using a Packard TopCount luminometer (1).
Nucleotide sequence accession number. The sigC gene sequence was entered into the GenBank database (accession no. AF288784).
| |
RESULTS |
|---|
|
|
|---|
Sequences required for basal expression of the psbAI
gene.
In order to define the promoter elements of the
psbAI gene, we constructed transcriptional fusions
between different psbAI upstream fragments and a
promoterless E. coli lacZ gene in a recombinational vector
that targets the reporter gene to a specific locus in the S. elongatus genome. (25). The in vivo expression
of each lacZ gene fusion was determined by
-galactosidase
assay from strains during growth under low light (125 µE
m
2 s
1) and after exposure to high light
(750 µE m
2 s
1) (Fig.
1). Control strains AMC181, containing a
promoterless lacZ gene, and AMC213, in which the
well-characterized light-induced psbAIII promoter is
fused to lacZ, were assayed simultaneously with the
psbAI fusions. AMC213 showed a 2.5-fold induction
under high light, as reported earlier (25).
|
1291 to +113 (relative to the transcription start site), was used to initiate analysis of the psbAI
promoter and regulatory regions (25). This strain had
-galactosidase activity of 690 U under low light, which dropped
~15% by 2 h after a shift to high light (data not shown). When
the
1291 to +113 fragment was fused to lacZ in the
opposite orientation, the
-galactosidase activities were
approximately at background levels at both light intensities (data not
shown). The shortest fragment assayed that yielded the same pattern
and similar strength of expression as AMC182 contained the
promoter sequence between positions
115 and +18 (AMC439;
Fig. 1). The smallest fragment that allowed expression of the reporter
extends from positions
54 to +1 (AMC773); neither AMC438 nor
AMC774, whose reporters have upstream promoter endpoints at
43,
showed a
-galactosidase activity higher than that of the
promoterless control strain. This is in contrast to the promoters of
psbAII and psbAIII, which require no
additional sequences upstream of the
35 element (i.e.,
39 and
38,
respectively, are sufficient) (25). The
-galactosidase
activity of AMC771 was ~6-fold higher than that of AMC773 under both
low and high light. Because their reporters differ only with respect to
the left end points of the promoter region, this difference in
-galactosidase activity is consistent with a positive element
located between positions
115 and
54. The
-galactosidase
activities of AMC439 and AMC440 were about twice those of AMC771 and
AMC773, respectively; the pairs of strains differ in the presence and
absence, respectively, of endpoints that extend beyond +1. Therefore,
sequences downstream of +1 seem to influence the strength of the
psbAI promoter, as was reported previously for
psbAII and psbAIII.
psbAI promoter activity decreases under high
light.
The psbAI transcript rapidly decreases in
abundance when cells are shifted to high light, with an apparent
half-life of about 10 to 12 min (22, 23). This is, at
least in part, attributable to destabilization of the transcript, which
depends on the 52-nucleotide untranslated leader (22).
Previous reporter gene experiments did not determine whether promoter
activity also decreases under high light conditions. The 15% decrease
in
-galactosidase activity from a
psbAI::lacZ reporter is too small
to use as a convincing indicator of decreased transcription, even
though it is reproducible and no such decrease is observed with a
fusion of a constitutive E. coli promoter to lacZ
(25). We expected that, if there is a negative
transcriptional response upon exposure to high light, it would be
readily detected with the more dynamic luciferase enzyme encoded by
luxAB. We constructed
psbAI::luxAB fusion strains that
lacked the untranslated leader region (AMC781), included the first 18 bp (AMC780) or 43 bp (AMC776) of the untranslated leader region, or had
the full untranslated leader and part of the coding region (AMC393). We
measured in vivo bioluminescence from whole cells at low light and at 2 and 3 h after a shift to high light.
38 to +39 of the light-induced psbAIII promoter fused to
luxAB, increased to ~330 and ~180% after 2 and 3 h, respectively. AMC408, which carries luxAB fused to the
upstream region of purF (a gene involved in purine
biosynthesis which is not regulated by light), showed a slight increase
in luciferase activity after 2 h and was equivalent to the
reference value after 3 h. We concluded that, in addition to the
accelerated degradation of the psbAI mRNA mediated by
its untranslated leader region, expression of the psbAI
promoter decreases after a shift to high light.
|
Specific binding of protein(s) to the untranslated leader region of
psbAI.
To detect the binding of putative regulatory
proteins to the upstream region of psbAI, we performed
electrophoretic mobility shift assays with a radiolabeled
psbAI probe extending from positions
54 to +43. When
partially purified protein extract from high-light-shifted S. elongatus cells was incubated with the probe, two shifted bands, C1 and C2, were formed (Fig. 3A).
Addition of a 50-fold molar excess of unlabeled probe fragment greatly
reduced formation of the C1 complex. In contrast, the
54 to +1
psbAI competitor fragment did not inhibit formation of
C1, even when added at a 500-fold molar excess. Neither competitor
fragment affected formation of C2, indicating that it is probably a
nonspecific protein-DNA complex. These results suggest that at least
one protein binds specifically to the
54 to +43 region of
psbAI and that sequences within the +1 to +43 region are
required for stable protein binding.
|
The psbAI-binding factor also binds to the untranslated
leader region of psbAII.
Previous work has shown that
a putative regulatory factor binds to the +1 to +41 region of
psbAII and that fragments from the untranslated leader
regions of psbAIII and psbDII
compete for binding to a psbAII probe (24).
To determine whether the psbAI-binding factor may be
the same one that binds to the untranslated leader region of
psbAII, we used an unlabeled +1 to +41
psbAII fragment to compete for binding to the
54 to
+43 psbAI probe (Fig. 3B). A 25-fold molar excess of the
psbAII fragment eliminated formation of the C1 complex,
suggesting that psbAI and psbAII share a
regulatory factor.
Testing the role of an unusual
10 element in the expression
properties of psbAI.
The psbAI
promoter, in spite of a "good"
35 element, is silent in E. coli, as evidenced from the lack of expression of both lacZ and luxAB fusions in that organism
(31; unpublished data). Its
10 element differs from
E. coli
70 consensus promoters and the
psbAII and psbAIII promoters by the substitution of C in place of A residues. To determine whether the
unusual
10 region of psbAI accounts for the dependence
on upstream sequences and/or negative regulation by high light, we mutated the
10 element of the psbAI fragment in AMC438
from TCTCCT to TATAAT, generating AMC775. Unlike the native
psbAI promoter, the mutated promoter drives
lacZ expression in E. coli. The
-galactosidase activities from AMC775 were ~50 U at both light intensities. Thus, alteration of the
10 element allowed expression in S. elongatus in the absence of psbAI sequences
upstream of
43. The strength of this artificially activated promoter
was approximately equivalent to that of the minimal basal promoter
(AMC773), and expression was not influenced by light intensity (Fig.
4A).
|
10 element in a reporter that is normally
expressed, a luxAB fusion that carries the
54 to +43
promoter fragment (AMC777). Although the resulting strain AMC778 showed an ~6-fold-higher bioluminescence than did the wild-type AMC777, expression dropped similarly from both under high light (Fig. 4B).
Thus, the atypical
10 element of the psbAI gene is not
responsible for reduced expression at high light, and the sequence
between
54 and
43 is required.
Inactivating the group 2 sigma factor genes, rpoD2 and
sigC, affects psbAI promoter strength but not
its regulation.
S. elongatus has at least four group 2 sigma factors in addition to the
70 homolog, RpoD1
(34) (Nair and Golden, unpublished). Recognition of the
psbAI promoter may be accomplished by one of these
factors, or redundantly by two or more. For example, the principal
sigma factor RpoD1 may have a greater affinity for the mutant
10
element of AMC775 and AMC778 than for the wild type, thus explaining
the elevated
-galactosidase activity in those strains. Another
possibility is that the altered promoter may be transcribed by a group
2 sigma factor that was previously unable to recognize and
transcribe the wild-type promoter. In order to determine whether
either the wild-type or E. coli consensus mutant promoter is
dependent on a specific group 2 sigma factor, we inactivated four group
2 sigma factor genes, rpoD2, rpoD3,
rpoD4, or sigC (GenBank accession nos.
AB006910, AB024709, AB024710, and AF288784, respectively) singly
and pairwise, in strains AMC777 and AMC778.
10 region of the psbAI
promoter (AMC778 background) caused an ~6-fold increase in
bioluminescence relative to the wild-type promoter construct in AMC777
(Fig. 5B), the dependence patterns for various group 2 sigma factors
were not altered by the promoter mutation.
|
| |
DISCUSSION |
|---|
|
|
|---|
The psbAI promoter response to high light is a
decrease in expression that is not readily monitored by persistent
reporter enzymes such as
-galactosidase. Luciferase as a reporter
allowed us to uncouple psbAI transcriptional and
posttranscriptional events by providing a clear phenotype that could be
assayed from constructs that included or lacked portions of the
psbAI transcript in the reporter message. The decrease
in expression from these reporter genes upon exposure to high light
indicated that the psbAI promoter, as well as its
message, is negatively responsive to increased light. In addition,
these experiments confirmed that the known posttranscriptional
regulation of psbAI does not influence transcriptional reporting by luxAB or lacZ. This was predicted,
because both reporter messages are much less stable than the native
psbAI transcript and not likely to preserve
posttranscriptional regulatory information (26, 30).
The psbAI promoter is different from typical
70 promoters in that it requires sequences upstream of
the
35 element for activity. Analysis of the psbAII
and psbAIII promoters revealed previously that they are
composed of three elements: a basal
70-type promoter
that is not light responsive, a negative element of unknown length
upstream of the promoter, and a light-responsive element downstream of
the promoter (8, 25). The basal promoter elements of the
two genes correspond to consensus promoters in E. coli, with
a left end of
39 or
38 relative to the transcription start site and
right ends of +12 for psbAII and
1 for
psbAIII. In contrast, the smallest fragment required for
the basal expression of a
psbAI::lacZ reporter extends from
position
54 to +1. The psbAI promoter also differs
from the psbAII and psbAIII promoters in
that sequences upstream of the minimal promoter stimulate, rather than
inhibit, transcription. The segment located between positions
54 and
43 also seems to be required for decreased expression after
exposure to high light: the fragment from
43 to +43, artificially
activated by changing the
10 element to
70
consensus, did not show light-responsive expression, whereas the same mutation in the context of sequences up to position
54 allowed a wild-type pattern of decreased expression under high light.
Thus, a segment of approximately 20 bp upstream of the consensus
35
element is implicated in both promoter activation per se and
light-responsive regulation of this gene. There are no obvious features
in this region, other than that it is AT-rich.
Despite differences between the psbAI promoter and those
of psbAII and psbAIII, the three genes
seem to bind the same factor in the regions that correspond to the
untranslated leaders of their transcripts. DNA mobility shift assays
previously showed that protein(s) from high light-shifted S. elongatus cells bind specifically to the untranslated leader
region of psbAII and that the binding site extends from
positions +1 to +41 relative to the transcription start site
(24). Fragments containing the upstream regions of the
light-regulated psbAIII or psbDII gene compete efficiently for binding to a
70 to +110 psbAII
probe, but a fragment containing the equivalent region of the
constitutive gene psbDI does not. These results suggest
that psbAII, psbAIII, and
psbDII share at least one regulatory factor
(24). Here we show that at least one protein binds
specifically to the region from positions
54 to +43 of
psbAI, that sequences between +1 and +43 are required
for stable protein binding, and that a psbAII fragment
from positions +1 to +41 competes efficiently for this binding,
suggesting that psbAI also shares a regulatory factor with psbAII. The untranslated leader regions of the
three psbA genes share little similarity beyond a
degenerate consensus, TAANANT, that could be involved in binding a
regulatory factor. We suggest that binding this factor increases the
magnitude of expression of all three psbA genes. Higher
-galactosidase activities were observed under low light for AMC440
(positions
54 to +43 of psbAI), AMC206 (
39 to +41 of
psbAII), and AMC221 (
38 to +39 of
psbAIII) than for AMC773 (
54 to +1 of
psbAI), AMC204 (
39 to +18 of psbAII), and AMC220 (
38 to +6 of psbAIII), respectively
(25). The role of this uncharacterized protein in
high-light-specific transcriptional regulation of psbAII
and psbAIII is uncertain. It is not a repressor of the
psbAI promoter, because sequences downstream of
position +1 are not required for decreased expression under high light. Determining differences in abundance or activity of the factor between low- and high-light conditions awaits its purification, which
is under way (C. Thomas and S. S. Golden, unpublished data).
Cyanobacteria contain a number of group 2 sigma factor genes that are closely related to each other (2, 5-7, 13, 14, 17, 34, 35). In vitro transcription experiments with purified S. elongatus core RNA polymerase reconstituted with RpoD1, RpoD3, or RpoD4 show that both group 1 and group 2 sigma factors recognize and transcribe eubacterial consensus promoters, suggesting a redundancy in sigma factor specificity (12). Work in our lab has shown that all four known group 2 sigma factors are expressed in S. elongatus cells under standard laboratory conditions (35; U. Nair, J. Ditty, and S. S. Golden, unpublished data). In the present study we have shown that strains in which rpoD2, rpoD3, rpoD4, and sigC are inactivated singly or in pairs still express psbAI::luxAB at wild-type or elevated levels. The principal sigma factor and each group 2 sigma factor may be capable of recognizing the psbAI promoter but perhaps with different affinities for the promoter. Our results suggest that, in the absence of RpoD2 or SigC, the psbAI promoter is transcribed much more efficiently by another sigma factor(s). This was previously proposed as an explanation for the loss of the nighttime circadian trough of psbAI expression in an rpoD2 mutant (35). The alternate hypothesis held that RpoD2 transcribes a gene(s) for a repressor(s) of psbAI. However, inactivation of sigC also causes elevated expression from a generic E. coli promoter, conII (Nair and Golden, unpublished); these data argue against a specific repressor accounting for increased expression when a group 2 sigma factor is eliminated. The similarity of phenotypes of rpoD2 and sigC mutants is more consistent with redundancy of promoter recognition by sigma factors with differing affinities for individual promoters, which compete for association with core polymerase.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by Public Health Service grant GM37040 from the National Institute of General Medical Sciences.
We thank Kan Tanaka for plasmids and sequences used to inactivate rpoD3 and rpoD4.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biology, Texas A&M University, 3258 TAMU, College Station, TX 77843-3258. Phone: (979) 845-9824. Fax: (979) 862-7659. E-mail: sgolden{at}tamu.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Andersson, C. A., N. F. Tsinoremas, J. Shelton, N. V. Lebedeva, J. Yarrow, H. Min, and S. S. Golden. 2000. Application of bioluminescence to the study of circadian rhythms in cyanobacteria. Methods Enzymol. 305:527-542[Medline]. |
| 2. |
Brahamsha, B., and R. Haselkorn.
1992.
Identification of multiple RNA polymerase sigma factor homologs in the cyanobacterium Anabaena sp. strain PCC 7120: cloning, expression, and inactivation of the sigB and sigC genes.
J. Bacteriol.
174:7273-7282 |
| 3. |
Bustos, S. A., and S. S. Golden.
1991.
Expression of the psbDII gene in Synechococcus sp. strain PCC 7942 requires sequences downstream of the transcription start site.
J. Bacteriol.
173:7525-7533 |
| 4. |
Bustos, S. A.,
M. R. Schaefer, and S. S. Golden.
1990.
Different and rapid responses of four cyanobacterial psbA transcripts to changes in light intensity.
J. Bacteriol.
172:1998-2004 |
| 5. |
Campbell, E. L.,
B. Brahamsha, and J. C. Meeks.
1998.
Mutation of an alternative sigma factor in the cyanobacterium Nostoc punctiforme results in increased infection of its symbiotic plant partner, Anthoceros punctatus.
J. Bacteriol.
180:4938-4941 |
| 6. |
Caslake, L. F., and D. A. Bryant.
1996.
The sigA gene encoding the major sigma factor of RNA polymerase from the marine cyanobacterium Synechococcus sp. strain PCC 7002: cloning and characterization.
Microbiology
142:347-357 |
| 7. |
Caslake, L. F.,
T. M. Gruber, and D. A. Bryant.
1997.
Expression of two alternative sigma factors of Synechococcus sp. strain PCC 7002 is modulated by carbon and nitrogen stress.
Microbiology
143:3807-3318 |
| 8. | Golden, S. S. 1994. Light-responsive gene expression and the biochemistry of the photosystem II reaction center, p. 693-714. In D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands. |
| 9. |
Golden, S. S.
1995.
Light-responsive gene expression in cyanobacteria.
J. Bacteriol.
177:1651-1654 |
| 10. | Golden, S. S., J. Brusslan, and R. Haselkorn. 1986. Expression of a family of psbA genes encoding a photosystem II polypeptide in the cyanobacterium Anacystis nidulans R2. EMBO J. 5:2789-2798[Medline]. |
| 11. |
Golden, S. S.,
M. S. Nalty, and D.-C. Cho.
1989.
Genetic relationship of two highly studied Synechococcus strains designated Anacystis nidulans.
J. Bacteriol.
171:4707-4713 |
| 12. | Goto-Seki, A., M. Shirokane, S. Masuda, K. Tanaka, and H. Takahashi. 1999. Specificity crosstalk among group 1 and group 2 sigma factors in the cyanobacterium Synechococcus sp. PCC7942: in vitro specificity and a phylogenetic analysis. Mol. Microbiol. 34:473-484[CrossRef][Medline]. |
| 13. | Gruber, T. M., and D. A. Bryant. 1998. Characterization of the alternative sigma-factors SigD and SigE in Synechococcus sp. strain PCC 7002. SigE is implicated in transcription of post-exponential-phase-specific genes. Arch. Microbiol. 169:211-219[CrossRef][Medline]. |
| 14. | Gruber, T. M., and D. A. Bryant. 1998. Characterization of the group 1 and group 2 sigma factors of the green sulfur bacterium Chlorobium tepidum and the green non-sulfur bacterium Chloroflexus aurantiacus. Arch Microbiol. 170:285-296[CrossRef][Medline]. |
| 15. | Ho, K. K., and D. W. Krogmann. 1982. Photosynthesis, p. 191-214. In N. G. Carr, and B. A. Whitton (ed.), the biology of cyanobacteria, vol. 19. University of California Press, Berkeley, Calif. |
| 16. |
Ishiura, M.,
S. Kutsuna,
S. Aoki,
H. Iwasaki,
C. R. Andersson,
A. Tanabe,
S. S. Golden,
C. H. Johnson, and T. Kondo.
1998.
Expression of a gene cluster kaiABC as a circadian feedback process in cyanobacteria.
Science
281:1519-1523 |
| 17. | Kaneko, T., S. Sato, H. Kotani, A. Tanaka, E. Asamizu, Y. Nakamura, N. Miyajima, M. Hirosawa, M. Sugiura, S. Sasamoto, T. Kimura, T. Hosouchi, A. Matsuno, A. Muraki, N. Nakazaki, K. Naruo, S. Okumura, S. Shimpo, C. Takeuchi, T. Wada, A. Y. Watanabe, M., M. Yasuda, and S. Tabata. 1996. Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res. 3:109-136[Abstract]. |
| 18. |
Katayama, M.,
N. F. Tsinoremas,
T. Kondo, and S. S. Golden.
1999.
cpmA, a gene involved in an output pathway of the cyanobacterial circadian system.
J. Bacteriol.
181:3516-3524 |
| 19. |
Kondo, T.,
C. A. Strayer,
R. D. Kulkarni,
W. Taylor,
M. Ishiura,
S. S. Golden, and C. H. Johnson.
1993.
Circadian rhythms in prokaryotes: luciferase as a reporter of circadian gene expression in cyanobacteria.
Proc. Natl. Acad. Sci. USA
90:5672-5676 |
| 20. |
Kondo, T.,
N. F. Tsinoremas,
S. S. Golden,
C. H. Johnson,
S. Kutsuna, and M. Ishiura.
1994.
Circadian clock mutants of cyanobacteria.
Science
266:1233-1236 |
| 21. | Kulkarni, R. D., and S. S. Golden. 1995. Form II of D1 is important during transition from standard to high light intensity in Synechococcus sp. strain PCC 7942. Photosyn. Res. 46:435-443[CrossRef]. |
| 22. | Kulkarni, R. D., and S. S. Golden. 1997. mRNA stability is regulated by a coding-region element and the unique 5' untranslated leader sequences of the three Synechococcus psbA transcripts. Mol. Microbiol. 24:1131-1142[CrossRef][Medline]. |
| 23. |
Kulkarni, R. D.,
M. R. Schaefer, and S. S. Golden.
1992.
Transcriptional and posttranscriptional components of psbA response to high light intensity in Synechococcus sp. strain PCC 7942.
J. Bacteriol.
174:3775-3781 |
| 24. |
Li, R.,
N. S. Dickerson,
U. W. Mueller, and S. S. Golden.
1995.
Specific binding of Synechococcus sp. strain PCC 7942 proteins to the enhancer element of psbAII required for high-light-induced expression.
J. Bacteriol.
177:508-516 |
| 25. |
Li, R., and S. S. Golden.
1993.
Enhancer activity of light-responsive regulatory elements in the untranslated leader regions of cyanobacterial psbA genes.
Proc. Natl. Acad. Sci. USA
90:11678-11682 |
| 26. |
Liu, Y.,
S. S. Golden,
T. Kondo,
M. Ishiura, and C. H. Johnson.
1995.
Bacterial luciferase as a reporter of circadian gene expression in cyanobacteria.
J. Bacteriol.
177:2080-2086 |
| 27. |
Liu, Y.,
N. F. Tsinoremas,
C. H. Johnson,
N. V. Lebedeva,
S. S. Golden,
M. Ishiura, and T. Kondo.
1995.
Circadian orchestration of gene expression in cyanobacteria.
Genes Dev.
9:1469-1478 |
| 28. | Rippka, R., and G. Cohen-Bazire. 1983. The cyanobacteriales: a legitimate order based on the type strain Cyanobacterium stanieri? Ann. Microbiol. (Paris) 134B:21-36. |
| 29. | Rippka, R., and M. Herdman. 1992. Pasteur culture collection of cyanobacteria. Catalogue and taxonomic handbook.: catalogue of strains Institut Pasteur, Paris, France. |
| 30. |
Schaefer, M. R., and S. S. Golden.
1989.
Differential expression of members of a cyanobacterial psbA gene family in response to light.
J. Bacteriol.
171:3973-3981 |
| 31. |
Schaefer, M. R., and S. S. Golden.
1989.
Light availability influences the ratio of two forms of D1 in cyanobacterial thylakoids.
J. Biol. Chem.
264:7412-7417 |
| 32. | Schmitz, O., N. F. Tsinoremas, S. Anandan, and S. S. Golden. 1999. General effect of photosynthetic electron inhibitors on translation precludes their use for investigating regulation of D1 biosynthesis in Synechococcus sp. strain PCC 7942. Photosynthesis Res. 62:261-271[CrossRef]. |
| 33. |
Shapira, S. K.,
J. Chou,
F. V. Richaud, and M. J. Casadaban.
1983.
New versatile plasmid vectors for expression of hybrid proteins coded by a cloned gene fused to lacZ gene sequences encoding an enzymatically active carboxy-terminal portion of -galactosidase.
Gene
25:71-82[CrossRef][Medline].
|
| 34. | Tanaka, K., S. Masuda, and H. Takahashi. 1992. Multiple rpoD-related genes of cyanobacteria. Biosci. Biotechnol. Biochem. 56:1113-1117[Medline]. |
| 35. | Tsinoremas, N. F., M. Ishiura, T. Kondo, C. R. Andersson, K. Tanaka, H. Takahashi, C. H. Johnson, and S. S. Golden. 1996. A sigma factor that modifies the circadian expression of a subset of genes in cyanobacteria. EMBO J. 15:2488-2495[Medline]. |
| 36. |
Tsinoremas, N. F.,
M. R. Schaefer, and S. S. Golden.
1994.
Blue and red light reversibly control psbA expression in the cyanobacterium Synechococcus sp. strain PCC 7942.
J. Biol. Chem.
269:16143-16147 |
| 37. | Wilmotte, A. M. R., and W. T. Stam. 1984. Genetic relationships among cyanobacterial strains originally designated as `Anacystis nidulans' and some other Synechococcus strains. J. Gen. Microbiol. 130:2737-2740. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»