Previous Article | Next Article 
Journal of Bacteriology, March 2001, p. 1870-1880, Vol. 183, No. 6
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.6.1870-1880.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Molecular Characterization of Global Regulatory RNA
Species That Control Pathogenicity Factors in Erwinia
amylovora and Erwinia herbicola pv.
gypsophilae
,
Weilei
Ma,
Yaya
Cui,
Yang
Liu,
C. Korsi
Dumenyo,
Asita
Mukherjee, and
Arun K.
Chatterjee*
Department of Plant Microbiology and
Pathology, Plant Sciences Unit, University of Missouri, Columbia,
Missouri 65211
Received 21 August 2000/Accepted 12 December 2000
 |
ABSTRACT |
rsmBEcc specifies a nontranslatable RNA
regulator that controls exoprotein production and pathogenicity in soft
rot-causing Erwinia carotovora subsp.
carotovora. This effect of rsmBEcc
RNA is mediated mostly by neutralizing the function of
RsmAEcc, an RNA-binding protein of E. carotovora subsp. carotovora, which acts as a global
negative regulator. To determine the occurrence of functional homologs
of rsmBEcc in non-soft-rot-causing
Erwinia species, we cloned the rsmB genes of
E. amylovora (rsmBEa) and E. herbicola pv. gypsophilae (rsmBEhg). We
show that rsmBEa in E. amylovora
positively regulates extracellular polysaccharide (EPS) production,
motility, and pathogenicity. In E. herbicola pv.
gypsophilae, rsmBEhg elevates the levels of
transcripts of a cytokinin (etz) gene and stimulates the
production of EPS and yellow pigment as well as motility.
RsmAEa and RsmAEhg have more than 93% identity
to RsmAEcc and, like the latter, function as negative
regulators by affecting the transcript stability of the target gene.
The rsmB genes reverse the negative effects of
RsmAEa, RsmAEhg, and RsmAEcc, but
the extent of reversal is highest with homologous combinations of
rsm genes. These observations and findings that
rsmBEa and rsmBEhg RNA
bind RsmAEcc indicate that the rsmB effect is
channeled via RsmA. Additional support for this conclusion comes from
the observation that the rsmB genes are much more effective as positive regulators in a RsmA+ strain of E. carotovora subsp. carotovora than in its
RsmA
derivative. E. herbicola pv. gypsophilae
produces a 290-base rsmB transcript that is not subject to
processing. By contrast, E. amylovora produces 430- and
300-base rsmB transcripts, the latter presumably derived by
processing of the primary transcript as previously noted with the
transcripts of rsmBEcc. Southern blot
hybridizations revealed the presence of rsmB homologs in E. carotovora, E. chrysanthemi, E. amylovora, E. herbicola, E. stewartii and E. rhapontici, as well as in other
enterobacteria such as Escherichia coli, Salmonella
enterica serovar Typhimurium, Serratia marcescens, Shigella
flexneri, Enterobacter aerogenes, Klebsiella pneumoniae, Yersinia
enterocolitica, and Y. pseudotuberculosis. A
comparison of rsmB sequences from several of these
enterobacterial species revealed a highly conserved 34-mer region which
is predicted to play a role in positive regulation by rsmB RNA.
| |
INTRODUCTION |
In many host-pathogen systems,
disease development requires coordinate expression of sets of genes in
response to various signals and environmental cues (9,
13). Regulation of these genes, like that of the housekeeping
genes, is subject to both transcriptional and posttranscriptional
control. We have determined that posttranscriptional regulation
mediated by the RsmA-rsmB pair is the most critical factor
in soft-rot-causing Erwinia. RsmA is a small RNA binding
protein, which acts by reducing the half-life of mRNA species
(21, 33). rsmB specifies an untranslated regulatory RNA (21) and neutralizes the effect of RsmA.
RsmA and rsmB RNA control many phenotypes in
soft-rot-causing Erwinia, including the production of
pectate lyase, polygalacturonase, cellulase, protease, harpin,
motility, flagellum formation, antibiotic, pigment, elicitation of the
HR (hypersensitive reaction), and pathogenicity (10, 26).
Erwinia carotovora subsp. carotovora strain 71 produces two rsmB RNA species: a primary RNA of 479 bases
which is processed to yield a 259-base RNA, designated
rsmB' RNA (21). The rsmB' RNA has
the regulatory functions attributed to rsmB. Romeo and
associates have identified a 360-base csrB RNA in
Escherichia coli which is functionally very similar to rsmB RNA, except that there is no evidence that
csrB RNA is processed (33).
Preliminary trials with the cloned E. carotovora subsp.
carotovora genes revealed transdominant regulatory effects
of rsmA and rsmB genes in non-soft-rot-causing
Erwinia species such as E. amylovora, the
representative of the Amylovora group (31), and E. stewartii and E. herbicola pv. gypsophilae, the
representatives of the Herbicola group (31) (now members
of the genus Pantoea [14]). Furthermore,
homologs of rsmA exist in these bacteria and in all other
Erwinia species tested (10). These observations prompted the hypothesis that the regulatory pair controls the production of pathogenicity factors in these non-soft-rot-causing Erwinia species as well. We should note that pathogenicity
of the Amylovora and Herbicola (Pantoea) groups of bacteria
is determined not by extracellular enzymes, as in soft-rot-causing
Erwinia, but by factors such as extracellular polysaccharide
(EPS) or growth hormones (4, 23). Since rsmB
homologs of these bacteria have not been examined, it was of interest
to compare the structural and functional characteristics of
rsmB genes of the three groups of bacteria. We report here
(i) cloning of rsmA and rsmB genes of E. amylovora (rsmAEa and
rsmBEa) and E. herbicola pv.
gypsophilae (rsmAEhg and
rsmBEhg), (ii) nucleotide sequence or deduced
amino acid sequence homologies of these genes, (iii) effects of
rsmA and rsmB in homologous and heterologous
bacterial species, and (iv) reversal of the RsmA effect by
rsmB. We also show that E. amylovora strain E9
produces two rsmB RNA species whereas E. herbicola pv. gypsophilae possesses a single rsmB
transcript species. Our findings and the physical evidence for the
occurrence of RsmA homologs (10) suggest that the
RsmA-rsmB regulatory system has been conserved in
enterobacterial species. Moreover, we have identified a region of
rsmB RNA which has been conserved in enterobacterial species.
| |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and media.
The bacterial
strains and plasmids used in this study are described in Table
1. The strains carrying drug markers were
maintained on Luria-Bertani (LB) agar containing appropriate
antibiotics. The wild-type strains were maintained on LB agar. The
composition of LB medium, minimal salts medium, KB medium, nutrient
gelatin (NG) agar, and polygalacturonate-yeast extract agar (PYA) have been described previously (2, 8). When required,
antibiotics were supplemented as follows (in micrograms per
milliliter): ampicillin, 100; kanamycin, 50; spectinomycin, 50;
tetracycline, 10. Media were solidified by the addition of 1.5%
(wt/vol) agar.
Extracellular enzyme assays.
Growth conditions, preparation
of culture supernatant, quantitative assay conditions for pectate lyase
(Pel) and semiquantitative assay conditions for pectate lyase (Pel),
polygalacturonase (Peh), cellulase (Cel), and protease (Prt) have been
previously described (5, 29).
EPS production and motility assays.
Cultures of E. herbicola pv. gypsophilae or E. amylovora were patched
or streaked on minimal salts medium plus sucrose (1%, wt/vol) and
spectinomycin for EPS detection and stab inoculated into KB soft agar
(0.4%, wt/vol) plus spectinomycin with a needle for examination of
motility. Bacteria were incubated at 28°C for 24 h. Motility and
EPS production of the bacteria were visually examined.
Pathogenicity assays on apple shoots.
Pathogenicity assays
on apple shoots were carried out essentially as previously described
(26), cell suspensions (30 µl containing 2 × 108 CFU) of E. amylovora strain E9 carrying the
rsmAEa+ plasmid,
rsmBEa+ plasmid, or the cloning
vector, pCL1920, were applied to the cut surface of each petiole.
Inoculated plants were incubated at 28°C with a 14-h light/10-h dark
regime until disease symptoms appeared.
DNA techniques.
Standard procedures were used in the
isolation of plasmid and chromosomal DNAs, transformation, restriction
endonuclease digests, gel electrophoresis, and DNA ligation
(34). Southern hybridizations were carried out as
previously described (10). Restriction and modifying
enzymes were obtained from Promega Biotec (Madison, Wis.). The
Prime-a-Gene DNA labeling system of Promega Biotec was used for
labeling DNA probes. PCR was performed as described by Liu et al.
(21). By using the degenerate primers, DB1
(5'-YMADGGACACCTCCAGG-3') and DB2
(5'-WCTGYRCYCCCGGTTCG-3') (Y = C or T; M = A or C;
D = A, G, or T; W = A or T; R = A or G), in the
rsmB sequence, we amplified the rsmB DNA in the
following bacterial species: Pseudomonas fluorescens, Serratia
marcescens, Shigella flexneri, Enterobactor arogenes, Salmonella
enterica serovar Typhimurium, and Klebsiella pneumoniae
(Table 1).
The
plac-rsmB transcription fusions were constructed as
follows. The 0.7-kb
HincII-
EcoRV fragment from
pAKC1042 was cloned
into the
SmaI site of pCL1920 to produce
pAKC1061, which contains
plac-rsmBEhg. The
473-bp DNA fragment was amplified by PCR using
the
KpnI-tagged primer AGGGTACCGTTGCGAAGGAACAGCATG
and
HindIII-tagged
primer
AGAAGCTTAAAGGGGGCACTGTATAAACA and template DNA pAKC1043.
After digestion with endonucleases, the DNA fragment was cloned
into
pCL1920 to produce pAKC1062 which carries
plac-rsmBEa. Similarly,
pAKC1063, which contains
plac-rsmB'Ea was constructed by cloning
the
326-bp DNA fragment into pCL1920. The DNA fragment was amplified
by PCR
using the
KpnI-tagged primer
AGGGTACCTCTCCAGGATGGAGAAACG
and the
HindIII-tagged primer AGAAGCTTAAAGGGGGCACTGTATAAACA
and
template DNA pAKC1043 and digested with endonucleases
KpnI and
HindIII. To construct pAKC1049
containing
plac-rsmBEcc the
KpnI-tagged
primer AGGGTACCAAGTTAGTAACCGGTTACA
and P7 primer GCAAGCTTCTTCACAACGTGGCGCTACAT
(
21) and template DNA pAKC679 were used for PCR. The
558-bp
PCR product was digested with
HindIII and
KpnI and cloned into
pCL1920.
RNA preparation and Northern hybridization.
Bacteria were
grown in 20 ml of LB or minimal salts medium supplemented with sucrose
(0.5%, wt/vol) and appropriate antibiotics at 28°C to a turbidity of
ca. 200 Klett units. Total RNA was then extracted by the method of Aiba
et al. (1). The procedure used for Northern blot analysis
was previously described (6, 22).
A 730-bp
EcoRI fragment containing pre-
etz and
etz from pMBL-R.73 (
17) was used as a probe. A
695-bp
HincII-
EcoRV fragment
from pAKC1042 was
used as the
rsmBEhg probe. A 310-bp
PstI-
BglII
fragment from pAKC1043 was used as the
rsmBEa probe. A 314-bp
EcoRV-
KpnI fragment from pAKC783 was used as the
pel-1 probe (
19).
A 743-bp
HindIII fragment from pAKC781 was used as the
peh-1 probe
(
19).
Primer extension analysis and RNase protection assay.
Primer
extension was performed as specified by the manufacturer (Promega
Biotec). An aliquot (10 pmol) of primer EhgB1
(5'-TGCTCAATCCTGAGCGATCCTG-3') (nucleotides [nt] +103 to
+125) or EaP6 (5'-CTTCATCCTGAAGCCTGTCCCTG-3') (nt +214 to
+236) was end labeled with T4 polynucleotide kinase and
[
-32P]ATP. A 20-µg portion of total RNA from
E. herbicola pv. gypsophilae or E. amylovora and
100 fmol of 32P-labeled primer in 11 µl of primer
extension buffer were incubated at 58°C for 20 min and cooled for 10 min at room temperature for annealing. Reverse transcription reaction
was carried out with avian myeloblastosis virus reverse transcriptase
at 42°C for 30 min.
The RNase protection assay was carried out as described by Liu et al.
(
20). The 272-bp
rsmBEa DNA
fragment (corresponding
to at
62 to +194) amplified from pAKC1043 by
PCR using
BamHI-tagged
primer EaP13
(5'-AGGGATCCAATAGCCTAAATAGCCGCTC-3') and
XbaI-tagged
primer EaP15
(5'-AGTCTAGAATCCTGTTATCATCCATGAACTGCCG-3') was cloned
into
pBluescript SK(+) to produce pAKC1044.
XbaI-digested
pAKC1044
was used as the template for in vitro transcription. The in
vitro-synthesized
RNA probes were labeled with
[
-
32P]UTP by using T7 polymerase as specified by the
manufacturer
instructions (Promega Biotec). The DNA template was then
removed
from the RNA probes by DNase treatment. A 20-µg RNA sample
from
E. amylovora strain E9 and 10
5 cpm of RNA
probe were incubated in 30 µl of hybridization buffer
(80%
formamide, 40 mM PIPES [pH 6.7], 400 mM NaCl, 1 mM EDTA)
overnight at
45°C and then digested with 300 µl of RNase solution
(10 mM Tris
[pH 7.5], 5 mM EDTA, 300 mM NaCl, 40 µg of RNase A
per ml, 2 µg
of RNase T
1 per ml) at 30°C for 1
h.
RNA stability assays.
Cultures were grown at 28°C in
minimal salts medium plus sucrose (0.5%, wt/vol) and spectinomycin to
a turbidity of ca. 160 Klett units, and rifampicin was added to a final
concentration of 200 µg/ml. Aliquots (10 ml) were collected at 0, 2.5, 5, 7.5, 10, and 15 min in tubes containing 5 ml of
diethylpyrocarbonate-treated ice-cold water. Total RNA was extracted by
the method of Aiba et al. (1), and Northern blot analysis
was performed by the procedures described by Chatterjee et al.
(6) and Liu et al. (22). After being washed,
the blots were exposed to X-ray film. The Metamorph imaging system
(Universal Imaging Corp.) was used for the densitometric analysis of
the autoradiograms. All experiments were performed three times or more,
and the results were reproducible.
RNA mobility shift assays.
Using primers
KpnI-tagged EaP10 (5'-AGGGTACCGTTGCGAAGGAACAGCATG-3')
and HindIII-tagged EaP12
(5'-AGAAGCTTAAAGGGGGCACTGTATAAACA-3') or
KpnI-tagged EhgB11 (5'-AGGGTACCACTGCAGGAGGCTCAGGAA-3')
and HindIII-tagged EhgB12
(5'-AGAAGCTTAAAGGGAGCACTGTATAAACA-3'), the PCR-amplified DNA
fragment corresponding to nt +1 to +455 of
rsmBEa or nt +1 to +310 of
rsmBEhg was cloned in pBluescript SK(+) to produce pAKC1045 and pAKC1046. The rsmBEa and
rsmBEhg RNA probes were synthesized in vitro
from the HindIII-digested pAKC1045 and pAKC1046 DNAs by
T7 RNA polymerase in the presence of [
-32P]UTP. The
RNA-protein interaction was assayed in 20 µl of binding buffer (10 mM
Tris-acetate [pH 7.5], 10 mM MgCl2, 50 mM NaCl, 50 mM
KCl, 10 mM dithiothreitol, 5% [wt/vol] glycerol) containing 4000 cpm
of labeled RNA (0.1 ng), with or without purified
His6-tagged RsmAEcc and a 50-fold excess of
unlabeled RNAs or yeast tRNA (Gibco BRL). After incubation for 30 min
at room temperature, the reaction mixtures were loaded on a prerun 5%
(wt/vol) polyacrylamide gel containing 5% (wt/vol) glycerol at 4°C.
Electrophoresis was continued in 0.5× Tris-borate-EDTA (TBE) running
buffer for another 4 h at 4°C. The gel was dried and exposed to
X-ray film.
| |
RESULTS AND DISCUSSION |
As stated above, physical evidence has established the presence of
rsmA homologs in various enterobacterial species
(10). Furthermore, several studies have revealed that
rsmA-rsmB and csrA-csrB work together to modulate
gene expression in E. carotovora subsp.
carotovora and Escherichia coli, respectively
(18, 21). However, prior to this work, there was no
evidence for RsmA-plus-rsmB-mediated gene regulation beyond
these bacterial species. To alleviate this deficiency, we cloned and
characterized rsmB genes from two Erwinia species
that do not cause soft rot disease, i.e., E. amylovora and
E. herbicola pv. gypsophylae, and obtained physical evidence for the occurrence of rsmB homologs in Erwinia
and other enterobacterial species.
Cloning of rsmB from E. herbicola pv.
gypsophilae strain PD713 and E. amylovora strain E9.
To clone the rsmB genes, genomic libraries of E. herbicola pv. gypsophilae strain PD713 and E. amylovora
strain E9 were transferred by triparental matings into E. carotovora subsp. carotovora strain Ecc71 or strain
AC5071 carrying the E9 rsmA+ plasmid, pAKC120
(Table 1). Transconjugants were screened for protease production on
nutrient gelatin agar medium, and colonies showing higher protease
activity were tested for their levels of pectinase and cellulase
activities. The clones showing higher levels of all these enzymes were
presumed to carry rsmB+ plasmids. In this
manner, we obtained several E9 and PD713 clones which produced elevated
levels of enzymatic activities. Plasmid DNAs isolated from these
colonies were subsequently analyzed by Southern blot hybridization
under low-stringency conditions using the transcribed region of
rsmBEcc as the probe. One E9 clone and two
clones from PD713 hybridized with the probe. By a subcloning and
functional assay, the rsmBEhg gene was localized
in a 1.7-kb HincII DNA fragment and the
rsmBEa gene was localized in a 1.7-kb BamHI DNA fragment.
Characterization of the rsmB genes of E. amylovora and E. herbicola pv. gypsophilae.
To
gain a better understanding of the structure and function of the
rsmB genes of E. amylovora and E. herbicola pv. gypsophilae, we determined the nucleotide sequences
of the 1.7-kb BamHI fragment and the 1.7-kb
HincII fragment that contain the E. amylovora
rsmB gene (rsmBEa) and the E. herbicola pv. gypsophilae rsmB gene
(rsmBEhg), respectively. A homology search
revealed that the nucleotide sequences of rsmBEa
and rsmBEhg have high similarities to those of
rsmBEcc of E. carotovora subsp.
carotovora (21) and csrB of
Escherichia coli (see below and Fig.
1A). Like
csrB (18) and rsmBEcc
(21), the rsmBEa and
rsmBEhg genes contain no apparent open reading frames, suggesting that they encode RNA regulators rather than protein
products.
View larger version (92K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Alignment of the ribonucleotide sequences of
rsmB genes from E. amylovora strain E9 (Ea),
E. herbicola pv. gypsophilae strain PD713 (Ehg), E. carotovora subsp. carotovora strain Ecc71(Ecc), and
csrB from Escherichia coli. Asterisks indicate
identical amino acids, and dots indicate conserved substitutions.
Arrows indicate the processed start sites of
rsmBEa RNA and rsmBEcc
RNA. The 34-mer consensus sequences in rsmB are shown
against shaded backgrounds. The 7-base repeats are in boldface type.
(B) Alignment of the deduced amino acid sequence of RsmA from E. herbicola pv. gypsophilae strain PD713, E. amylovora
strain E9, E. carotovora subsp. carotovora strain
Ecc71, and CsrA from Escherichia coli.
|
|
To characterize
rsmB RNAs, we performed Northern blot
analyses. As shown in Fig.
2A, the
E. herbicola pv. gypsophilae probe
hybridized to a 290-base
transcript. By contrast, with E9 total
RNA, we detected two bands of
about 300 and 430 bases. To further
characterize the transcripts, we
performed primer extension analysis
(Fig.
2B) and RNase protection
assays (data not shown). Using
appropriate oligonucleotide primers, we
detected that the 5' end
of
rsmBEhg was
positioned at a single adenosine residue and that
two 5' ends of the
rsmBEa transcripts, separated by 133 nt, were
localized at the guanosine and thymidine residues, respectively
(Fig.
2B). Analysis of the 3' sequence revealed that each
rsmB RNA
species contains a strong stem-loop structure (Fig.
1A), which
can
function as rho-independent transcription terminators as defined
for
rsmBEcc (
21). Therefore, the sizes
of
rsmB RNA species,
stretching from the 5' ends identified
by primer extension or
RNase protection assays to their 3'
rho-independent terminators,
are 310 nt for
rsmBEhg and 317 and 451 nt for the
rsmBEa RNA species.
These observations confirm
that
E. amylovora produces two
rsmB transcripts,
the shorter one spanning the 3' end and the larger
one extending
further upstream of the shorter one (Fig.
2). We
do not know the
mechanism underlying the production of these two
rsmB RNA
species by
E. amylovora. However, extrapolating from
the
findings with
rsmBEcc (
21), we
consider it most likely that
the 451-nt transcript represents the
primary transcript whereas
the 317-nt transcript is the processed
product of the primary
transcript. Since we have not detected sequences
resembling typical
enterobacterial promoters upstream of the 5' end of
the 317-base
transcript, we consider it unlikely that the 451- and the
317-nt
transcripts result from initiation of transcription from
different
start sites.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Northern blot analysis of rsmB
transcripts of E. herbicola pv. gypsophilae strain PD713
(lane 1) and E. amylovora strain E9 (lane 2). The positions
of two rsmB transcripts of E9 are indicated by arrows. (B)
Primer extension analysis of the 5' ends of rsmB transcripts
from E. herbicola pv. gypsophilae strain PD713 (a) and
E. amylovora strain E9 (b). The portions of sequences
pertinent to the 5' ends are shown. The A residue in lane P1 is
identified as the 5' end of rsmB mRNA of PD713; the G and T
residues in lane P2 are indicated as the two 5' ends of rsmB
mRNA of E9.
|
|
To determine the minimal size of
rsmB required for its
biological function, we constructed several
plac-rsmB
plasmids. In
these constructs, the
rsmB DNA fragments that
do not carry the
promoter regions were subcloned into the pCL1920
vector. Similar
to the positive control pAKC1049 and pAKC1004 plasmids,
which
contain
plac-rsmBEcc and
plac-rsmB'Ecc, respectively, all of these
constructs were able to not only stimulate extracellular Pel production
in
E. carotovora subsp.
carotovora strain 71 and
its RsmA-deficient
derivative AC5071 but also reverse the negative
effect of RsmA
on extracellular Pel production (see Tables
2 and
3).
These
data allow several conclusions; (i) the
rsmBEa and
rsmBEhg RNA
species are biologically active and are responsible for the activation
of extracellular enzyme production; (ii) these RNA species
specifically
act against the negative effect of RsmA; and (iii)
the putative
processed
rsmB'Ea RNA species is still active, although
it is
less active than the primary
rsmBEa RNA.
Our findings reported here and elsewhere (
21) reveal two
classes of
rsmB genes. In one class, the larger primary
transcript
presumably is processed to yield a smaller and relatively
stable
RNA species. The other class comprises the
rsmB genes
that yield
a small and stable RNA species not subject to processing.
Moreover,
based on our findings with strain Ecc71
rsmB
transcripts (
21),
we postulate that the primary transcript
binds more RsmA molecules
than the processed
rsmB RNA does,
thereby more effectively lowering
the pool of free RsmA. In fact, the
analysis of primary and secondary
structures of RNA species (data not
shown) clearly shows the availability
of more putative RsmA binding
sites in the primary transcript
than in the processed
RNA.
Analysis of rsmB and csrB RNA
sequences.
A database search revealed that
rsmBEa and rsmBEhg RNA
sequences are homologs of rsmBEcc of E. carotovora subsp. carotovora (21) and
csrB of Escherichia coli (18).
Alignment of the ribonucleotide sequences of rsmB from
E. carotovora subsp. carotovora, E. herbicola pv.
gypsophilae, and E. amylovora, as well as csrB,
is shown in Fig. 1A. In addition, phylogram analysis shows that the
rsmB RNAs of E. amylovora and E. herbicola pv. gypsophilae fall into a subgroup, suggesting that
rsmBEa and rsmBEhg may be
evolutionarily and functionally closer. It also was evident that the
rsmBEa and rsmBEhg RNAs
are genetically closer to the csrB RNA than to the
rsmBEcc RNA (data not shown). A noteworthy
feature is that the homologies among these RNAs are higher at their 3'
ends than at the 5' ends. While the last 100-base sequence of
rsmBEcc is critical for RNA stability, this
sequence is not involved in regulating gene expression
(21; Y. Liu and A. K. Chatterjee, unpublished data).
Therefore, we propose that the 100-base sequence at the 3' end, the
most highly conserved sequence in the rsmB and
csrB RNAs, plays roles in the transcription termination and
RNA stability due to its extremely stable stem-loop structure.
Moreover, this RNA region does not possess the putative sequences that
can be bound by RsmA and CsrA proteins (see below).
Liu et al. (
18) proposed that CsrA binds
csrB
RNA, most probably to the 7-base repeats in the RNA molecules. The
repeats
contain the consensus sequence 5'-CAGGA(U/C)G-3'.
Repeats carrying
the identical consensus sequence also have been
found within the
rsmBEcc RNA as well as in
rsmBEa RNA and
rsmBEhg
RNA (Fig.
1A),
and there is evidence to suggest that these can be bound
in vitro
by purified RsmA
Ecc protein (
18,
21).
However, whether these
sequences represent the specific recognition
site for CsrA and
RsmA
Ecc proteins is not known. Also, the
significance of the sequences
flanking the 7-base core sequence is
unknown. A comparison of
the
rsmB and
csrB RNA
sequences reveals a 34-mer consensus sequence
in each RNA species (Fig.
3). The 34-mer sequence has the following
specific characteristics in addition to the presence of the
5'-CAGGA(U/C)G-3'
sequence in the middle. (i) The 34-mer
sequence is much longer
than the previously determined 7-base
5'-CAGGA(U/C)G-3' sequence.
(ii) In each
rsmB RNA
species, only one copy of this 34-mer sequence
exists, whereas
additional 5'-CAGGA(U/C)G-3' sequences are present
as
multiple modules in every RNA species, i.e., five copies in
rsmBEhg, eight copies in
rsmBEa, and nine copies in
rsmBEcc and
csrB. (iii) In instances
where there is evidence for RNA processing,
the 34-mer consensus
sequence occurs in the
rsmB' RNA species,
the 3'-end
processed product of the primary transcripts. In Ecc71,
the
rsmB' RNA, rather than the 5' region, is responsible for the
regulatory role of
rsmB RNA, i.e., the activation of
exoprotein
production (
21). (iv) The 34-mer consensus
sequence is predicted
to carry a conserved secondary structure
consisting of a 4-nt
stem and a 5-nt [5'-AGGAA(U/C)-3']
loop (Fig.
3). Based on the
specific features of the 34-mer
consensus sequence, we propose
this motif as the signature sequence for
the growing
rsmB/csrB regulatory RNA family. Indeed, a
database search using the 34-mer
consensus sequence revealed a single
motif in the putative
rsmB/csrB homolog of
S. enterica serovar Typhimurium (accession number,
gi 5730336) (Fig.
3 csrBSty). Furthermore, to test the proposal
that the 34-mer motif is present in every
rsmB homolog,
degenerate
primers were designed to be complementary to the nucleotide
sequences
within the 34-mer motif and to the 3' terminator region. PCR
analysis
revealed amplification of
rsmB DNA fragments from
Serratia marcescens, Shigella flexneri, and
Enterobacter aerogenes; moreover, nucleotide
sequence
analysis confirmed that each PCR product carried one
34-mer motif
(W. L. Ma and A. K. Chatterjee, unpublished data).
These
structural characteristics suggest that the 34-mer sequence
represents
an ancient motif arising prior to the evolutionary
separation of the
genera tested and that this motif is important
for the basic biological
function of the
rsmB/csrB RNA regulator.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Alignment of the 34-mer consensus sequences in the
rsmB RNA species of E. amylovora strain E9 (Ea),
E. carotovora subsp. carotovora strain Ecc71
(Ecc), E. herbicola pv. gypsophilae strain PD713 (Ehg), and
csrB RNA of Escherichia coli (Eco), and S. enterica serovar Typhimurium (Sty). Positions refer to the
nucleotide sequences relative to the 5' of rsmB' of E. amylovora and E. carotovora subsp.
carotovora and 5' of rsmB of E. herbicola pv. gypsophilae, Escherichia coli, and
S. enterica serovar Typhimurium. Inverted arrows indicate
the 4-nt stems of the stem-loop structure. The identical nucleotides of
the 7-base repeats are in boldface type.
|
|
Effects of rsmBEhg in E. herbicola pv. gypsophilae and E. carotovora subsp.
carotovora.
To determine the effects of multiple
copies of rsmBEhg, pAKC1042 containing the
rsmB gene or the vector pCL1920 was transformed into
E. herbicola pv. gypsophilae strain PD713 and E. carotovora subsp. carotovora strain Ecc71. The E. herbicola pv. gypsophilae constructs were tested for extracellular
polysaccharide production and motility. As shown in Fig.
4A, columns 1 and 2, multiple copies of
rsmBEhg activate EPS production and stimulate
swarming motility in E. herbicola pv. gypsophilae strain
PD713. Previous studies have shown that rsmBEcc
activates pathogenicity factor production (21, 28).
To ascertain if rsmBEhg would affect
pathogenicity factors, such as phytohormones, we performed Northern
blot analysis of the cytokinin (etz) genes in the E. herbicola pv. gypsophilae constructs. Total RNA samples of PD713
carrying pCL1920 or its rsmBEhg+
derivative were hybridized with pre-etz plus etz
(17) as the probe. The results show that two RNA bands of
1.4 and 1.0 kb hybridized with the probe, consistent with the
previously reported pre-etz plus etz RNA profile
of PD713 (17). Also, the levels of pre-etz and
etz transcripts were higher with multiple copies of
rsmBEhg than with the vector control (Fig. 4B).
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
Effects of multiple copies of
rsmBEhg and rsmAEhg in
E. herbicola pv. gypsophilae strain PD713. (A) EPS
production and motility of E. herbicola pv. gypsophilae
strain PD713 carrying pCL1920 (cloning vector, column 1), pAKC1042
(rsmBEhg+, column 2), or pAKC891
(RsmAEhg+, column 3). (B) Northern blot
analysis showing multiple-copy effects of
rsmAEhg and rsmBEhg on
etz (cytokinin gene) transcripts in E. herbicola
pv. gypsophilae strain PD713. Lanes: 1, PD713/pCL1920; 2, PD713/pAKC891; 3, PD713/pAKC1042. Each lane contained 15 µg of total
RNA.
|
|
E. carotovora subsp.
carotovora strain Ecc71
carrying the
rsmBEhg+ plasmid or the
cloning vector was tested for extracellular enzyme
production. The
bacteria were grown in minimal salts medium supplemented
with sucrose
(0.5%, wt/vol) and spectinomycin, and the culture
supernatants were
assayed for Pel, polygalacturonase (Peh), protease
(Prt) and cellulase
(Cel) activities. Figure
5 (columns 1 and
2) shows that Ecc71 carrying the
rsmBEhg+ plasmid produced higher
levels of Pel, Peh, Prt, and Cel than
did Ecc71 carrying the cloning
vector pCL1920. The effects of
rsmBEhg in both
homologous and heterologous systems indicate that
rsmBEhg is functionally similar to
rsmBEcc (
21) (Table
3).
View larger version (76K):
[in this window]
[in a new window]
|
FIG. 5.
Effects of multiple copies of
rsmBEhg and rsmAEhg on
extracellular enzyme production in E. carotovora subsp.
carotovora strain Ecc71. Ecc71 carrying the cloning vector
pCL1920 (column 1), pAKC1042
(rsmBEhg+, column 2), or pAKC891
(RsmAEhg+, column 3) were grown in minimal
salts medium plus sucrose (0.5%, wt/vol) and spectinomycin to a
turbidity of ca. 200 Klett units, and the culture supernatant was used
for an agarose plate assay of Pel, Peh, Prt, and Cel activities. Each
well contained 20 µl of culture supernatant.
|
|
Effects of rsmBEa in E. amylovora and E. carotovora subsp.
carotovora.
In studies similar to that with
rsmBEhg described above, we determined the
effects of multiple copies of rsmBEa gene in
E. amylovora and E. carotovora subsp.
carotovora. The rsmBEa+
plasmid, pAKC1043, or the cloning vector, pCL1920, was transformed into
E. amylovora strain E9 and E. carotovora subsp.
carotovora strain Ecc71. The E. amylovora
constructs were tested for EPS production, motility, and pathogenicity
on apple shoots. As shown in Fig. 6A
(columns 1 and 2), E. amylovora E9 carrying multiple copies
of rsmBEa produced copious amounts of EPS
compared to E9 carrying the vector. The bacteria carrying pAKC1043 also
were more motile on semisolid agar medium. Furthermore, compared to E9
carrying pCL1920, E9 carrying the
rsmBEa+ plasmid wilted apple shoots
in a shorter time (data not shown). Like the
rsmBEhg gene, rsmBEa
activated the production of Pel, Peh, Cel, and Prt in E. carotovora subsp. carotovora strain Ecc71 (data not
shown).
View larger version (51K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of multiple copies of
rsmBEa and rsmAEa in
E. amylovora strain E9. (A) EPS production and motility of
E. amylovora strain E9 carrying pCL1920 (cloning vector,
column 1), pAKC1043 (rsmBEa+, column
2), or pAKC893 (RsmAEa+, column 3). (B)
Pathogenicity of E. amylovora strain E9 carrying the cloning
vector pSF6 (B1) and the rsmAEa+
plasmid pAKC120 (B2). E. amylovora strain E9 carrying the
vector pSF6 caused the apple shoots to bent down and wilt, whereas E9
carrying the rsmAEa+ plasmid pAKC120
was nonpathogenic in apple shoots.
|
|
Neutralization of RsmA by rsmB.
Since
rsmBEcc neutralizes the effect of RsmA in
E. carotovora subsp. carotovora (21)
and csrB neutralizes the effect of CsrA in Escherichia
coli (18), it was of interest to determine if the
rsmB genes of E. amylovora and E. herbicola pv. gypsophilae also antagonize their own RsmA-like
factors. For this propose, we cloned and sequenced the rsmA
genes from E. amylovora strain E9 and E. herbicola pv. gypsophilae strain PD713. Analysis of the nucleotide
sequences of the two rsmA genes revealed that 183-bp open
reading frames encode the putative RsmAEhg and
RsmAEa proteins, each consisting of 61 amino acid residues.
A homology search disclosed that RsmAEhg and
RsmAEa have 93 and 95% identity to RsmAEcc,
respectively (Fig. 1B). In E. carotovora subsp.
carotovora strain Ecc71, the RsmAEhg+ plasmid pAKC891 repressed
extracellular enzyme (Pel, Peh, Cel, and Prt) production as determined
by agarose plate assays (Fig. 5, column 3, shows the suppressive effect
of rsmAEhg). In addition, in E. herbicola pv. gypsophilae strain PD713, the
RsmAEhg+ plasmid pAKC891 repressed
EPS production, motility, and the levels of cytokinin transcripts (Fig.
4A, columns 1 and 3, and Fig. 4B). Similarly,
RsmAEa+ plasmid pAKC893 suppressed motility on
semisolid medium and suppressed EPS production (Fig. 6A, columns 1 and
3) in E. amylovora strain E9. Moreover, E. amylovora strain E9 carrying rsmAEa cosmid
pAKC120 was nonpathogenic in apple shoots (Fig. 6B). Since
RsmAEhg and RsmAEa promote pel-1 and
peh-1 mRNA degradation in E. carotovora subsp.
carotovora RsmA strain AC5071 (Fig.
7), it is most likely that, like
RsmAEcc and CsrA, these RsmA species also affect mRNA
stability and consequently the cognate phenotypes.
View larger version (64K):
[in this window]
[in a new window]
|
FIG. 7.
mRNA stability of pel-1 and peh-1
in E. carotovora subsp. carotovora strain AC5071
(RsmA) carrying pCL1920 (cloning vector, row a), pAKC891
(RsmAEhg+, row b), pAKC893
(RsmAEa+, row c), or pAKC880
(RsmAEcc+, row d). Rifampin (200 µg/ml) was
added to the cultures at a turbidity of ca.160 Klett units, and RNA was
extracted at 0 min (lane 1), 2.5 min (lane 2), 5 min (lane 3), 7.5 min
(lane 4), 10 min (lane 5), and 15 min (lane 6). Northern hybridization
was performed at 65°C with [-P32]dATP-labeled
pel-1 and peh-1 probes. Each lane in row a
contained 5 µg of total RNA, and each lane in rows b, c, and d
contained 30 µg of total RNA. The blots were exposed to X-ray film
for 24 h and analyzed by densitometric scanning. The densitometric
results (percentage of remaining mRNA) were plotted against time after
rifampin treatment. The circles, squares, triangles, and diamonds
represent AC5071 carrying pCL1920, pAKC891, pAKC893, or pAKC880,
respectively.
|
|
The cloning of both the
rsmA and
rsmB genes of
E. amylovora strain E9 and
E. herbicola pv.
gypsophilae strain PD713 and the
availability of a well-characterized
RsmA
strain of
E. carotovora subsp.
carotovora (AC5071) made it possible
for us to test the
interaction of these genes. Each of the AC5071
derivatives carrying
rsmAEcc, rsmAEa or
rsmAEhg was transformed
with pAKC1004
(
plac-rsmB'Ecc), pAKC1049
(
plac-rsmBEcc), pAKC1062
(
plac-rsmBEa), pAKC1063
(
plac-rsmB'Ea), pAKC1061
(
plac-rsmBEhg),
or vector pCL1920. The bacterial
constructs were assayed for extracellular
Pel activity. The data in
Table
2 show that the three
rsmB genes
could reverse the repressive effects of all the
rsmA species;
i.e., the genes are functional in heterologous
systems. However,
the efficiency of reversal of
rsmB varies
depending on the source
of the
rsmA species. While
rsmBEcc RNA was most effective in reversing
the
effect of RsmA
Ecc, it was least effective in neutralizing
the effects of RsmA
Ea or RsmA
Ehg. On the other
hand, each of these
RsmA species was more effectively neutralized by
the cognate
rsmB RNA species. These observations imply a
degree of specificity
in RsmA-
rsmB interaction. In this
context, it is perhaps significant
that
rsmBEa
and
rsmBEhg RNA species belong to the same
subgroup
whereas
rsmBEcc RNA belongs to another
subgroup genetically distant
from
rsmBEa and
rsmBEhg RNAs. These observations raise the
possibility
that structural differences among the three
rsmB
RNA species could
account for the differential effects of
rsmB RNAs on RsmA species.
Table
2 also shows that in the
RsmA
Ecc
background,
the suppressive effect on
Pel production by the three
rsmA species
varied:
rsmAEcc was most suppressive, followed by
rsmAEa and then
rsmAEhg.
However, genetic variation among the three RsmA proteins
is minor, with
alterations mostly occurring within the last 6
amino acid residues
within their C-terminal regions (Fig.
1B).
It remains to be determined
if the variations in RsmA proteins
affect the binding specificity of
rsmB RNAs. However, we prefer
the view that the differences
among these
rsmB RNA species probably
determine the
efficiency of interactions with RsmA species and
the consequent
extracellular Pel production. In addition, these
differences in RNA may
affect the RsmA-independent regulatory
pathway(s) through which
rsmB acts to regulate gene expression
(
21).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Reversal of negative effects of rsmA on
extracellular Pel production by rsmB in RsmA
strain AC5071 of E. carotovora subsp.
carotovora
|
|
To ascertain that the
rsmB effects were mediated via RsmA,
we compared the effects of plasmids carrying the
rsmB genes
in
RsmA
+ and RsmA
strains of
E. carotovora subsp.
carotovora. The data (Table
3)
show that
rsmBEa and
rsmBEhg better
stimulated enzyme production
in RsmA
+ bacteria than in the
RsmA
strain. In RsmA
bacteria, the degrees
of stimulation of Pel production were three-
and twofold, which
contrasts with six- and ninefold stimulation
of Pel production in
RsmA
+ bacteria by the
rsmBEa and
rsmBEhg genes. Generally similar effects
were
seen with
rsmBEcc, although the degree of
stimulation in
RsmA
+ bacteria was much higher with this
gene (80-fold stimulation)
than with the
rsmB genes from
E. amylovora (6-fold stimulation)
or
E. herbicola
pv. gypsophilae (9-fold stimulation). These differences
notwithstanding, the data allow the conclusion that
rsmB
activates
gene expression by neutralizing the RsmA effect. However,
these
results also indicate that
rsmB RNA species play an
additional
regulatory role in the activation of extracellular enzyme
production,
which is RsmA independent.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Multiple-copy effects of rsmB on extracellular
Pel production in E. carotovora subsp. carotovora
strains Ecc71 (RsmA+) and AC5071 (RsmA)
|
|
rsmB RNAs bind RsmAEcc.
Previous
studies with Escherichia coli and E. carotovora
subsp. carotovora have shown that RsmA/CsrA binds
rsmB RNA/csrB RNA (18, 21).
Subsequent studies with E. carotovora subsp.
carotovora have established that most of the regulatory
effect of rsmB is channeled via RsmA. In light of the
effects of rsmBEa and
rsmBEhg on RsmAEcc, we
considered it important to determine if RsmAEcc binds these
rsmB RNA species. The results of gel mobility shift assays
(Fig. 8) show that the purified
RsmAEcc protein binds each of those two rsmB RNA
species. The RsmAEcc-rsmB binding was prevented by the addition of excess unlabeled RNA to the reaction mixture (Fig.
8, lanes 3 and 7). In addition, in vitro studies suggest specificity in
the binding of RsmAEcc and these rsmB RNA
species, since yeast tRNA had no effect on this binding (lanes 4 and
8).
View larger version (102K):
[in this window]
[in a new window]
|
FIG. 8.
RNA mobility shift assay for binding of
RsmAEcc to the rsmB RNAs. rsmB RNA
probes of E. herbicola pv. gypsophilae and E. amylovora were synthesized from pAKC1046 and pAKC1045 in vitro by
T7 RNA polymerase in the presence of [-32P]-UTP.
Labeled RNAs (0.1 ng, 4,000 cpm) were incubated without RsmA, with 5.0 ng of affinity-purified RsmA, with 5.0 ng of affinity-purified RsmA in
the presence of a 50-fold excess of unlabeled probes, or with 5.0 ng of
affinity-purified RsmA in the presence of a 50-fold excess of yeast
tRNA. Lanes: 1, labeled rsmBEa RNA; 2, labeled
rsmBEa RNA plus RsmAEcc; 3, labeled
rsmBEa RNA plus RsmAEcc plus 50-fold
unlabeled rsmBEa RNA; 4, labeled
rsmBEa RNA plus RsmAEcc plus 50-fold
yeast tRNA; 5, labeled rsmBEhg RNA; 6, labeled
rsmBEhg RNA plus RsmAEcc; 7, labeled
rsmBEhg RNA plus RsmAEcc plus
50-fold unlabeled rsmBEhg RNA; 8, labeled
rsmBEhg RNA plus RsmAEcc plus
50-fold yeast tRNA.
|
|
Occurrence of rsmB homologs in Erwinia
species and other enterobacteria.
It has been established that
rsmA occurs in enterobacteria and P. aeruginosa
(38) and perhaps even in other bacteria such as
Bacillus subtilis and Haemophilus influenzae
(12, 35). Our previous findings (28) have
revealed that rsmBEcc (formerly aepH)
occurs in E. carotovora subsp. carotovora and
E. carotovora subsp. atroseptica strains. To
examine if an rsmB homolog occurs in other
Erwinia and enterobacterial species, we conducted Southern hybridizations with the rsmB probe from E. herbicola pv. gypsophilae strain PD713. The data (Fig.
9) show that
rsmBEhg hybridized to all Erwinia and
other enterobacterial species tested, indicating the presence of
rsmB homologs in these bacteria. To further strengthen this
physical evidence, we used E. coli csrB as the probe. The same size bands that hybridized with the rsmBEa
probe also hybridized with the csrB probe (data not shown).
These data demonstrate that rsmB sequences have been
conserved in these bacteria. However, the differences in the sizes of
the hybridizing fragments suggest that sequences of the
rsmB-like genes and the DNA flanking them may have diverged.
View larger version (45K):
[in this window]
[in a new window]
|
FIG. 9.
Southern hybridization of EcoRI-digested
chromosomal DNAs of Erwinia and other enterobacterial
strains with rsmB of E. herbicola pv. gypsophilae
strain PD713. Lanes: 1, E. chrysanthemi strain Ec16; 2, E. amylovora strain E9; 3, E. herbicola strain
EH105; 4, E. herbicola pv. gypsophilae strain PD713; 5, E. rhapontici strain Erl; 6, E. stewartii strain
DC283; 7, Escherichia coli strain K-12; 8, S. enterica serovar Typhimurium strain LT2; 9, Serratia
marcescens strain Sm1; 10, Yersinia pseudotuberculosis
strain Yp1; 11, Shigella flexneri strain Sf1; 12, Enterobacter aerogenes strain Ena1; 13, Klebsiella
pneumoniae strain Kp1. Southern hybridization was performed at
65°C. The blot was washed in 2× SSC (1× SSC is 0.15 M NaCl plus
0.015 M sodium citrate) for 15 min at room temperature followed by 30 min in 2× SSC-0.1% sodium dodecyl sulfate at 65°C. A 500-bp
HincII-EcoRV fragment from pAKC1042 was used as
the rsmBEhg probe.
|
|
In conclusion, we have characterized the
rsmB genes cloned
from
E. amylovora and
E. herbicola pv.
gypsophilae. These genes
have high levels of genetic, structural, and
functional homology
among themselves and to that of
E. carotovora subsp.
carotovora.
The suppression of EPS
production and pathogenicity of
E. amylovora by
RsmA
Ea, the inhibition of expression of a cytokinin gene in
E. herbicola pv. gypsophilae by RsmA
Ehg, and the
reversal of the
negative effects of the RsmA species by the
rsmB genes in E. carotovora
subsp.
carotovora demonstrate that the
rsmA-rsmB pairs
play important
regulatory roles in these bacteria. The fully conserved
KH motifs
in putative products of these
rsmA genes strongly
suggest that
RsmA
Ea and RsmA
Ehg, like
RsmA
Ecc, bind RNA species. Indeed, studies
with the
pel and
peh genes suggest that
RsmA
Ehg and RsmA
Ea affect
mRNA stability, most
probably by binding and promoting mRNA decay.
rsmBEhg and
rsmBEa
counteract the RsmA effects, probably by reducing
the pool of free RsmA
due to the formation of a biologically inactive
RsmA-
rsmB
ribonucleoprotein complex. The occurrence of
rsmB homologs
in all enterobacterial species included in this study strongly
suggests
that many more bacteria employ this regulatory system
to modulate their
gene expression. This is clearly supported by
the pleiotropic effect of
RsmA of
P. aeruginosa and
P. fluorescens (
3). Our work has also raised several other issues that
await
clarification. For example, what is the teleological significance
of the processing of
rsmB transcripts in some bacteria but
not
in others? Does RsmA binding prime RNAs for degradation by
nucleases?
Does RsmA act in conjunction with other factors which are
responsible
for the decay of specific transcripts? Since the
RsmA-
rsmB pair
controls many factors important in bacterial
ecology and in the
production of useful metabolites, we expect that
these and other
issues will be resolved in the near
future.
| |
ACKNOWLEDGMENTS |
Our work was supported by the National Science Foundation (grant
MCB-9728505) and the Food for the 21st Century program of the
University of Missouri.
We thank S. Manulis for E. herbicola pv. gypsophilae strains
and the etz plasmid, and we thank Jeanne Erickson and Judy
D. Wall for reviewing the manuscript.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Plant Microbiology and Pathology, Plant Sciences Unit, University of Missouri, 108 Waters Hall, Columbia, MO 65211. Phone: (573) 882 1892. Fax: (573) 882 0588. E-mail: CHATTERJEEA{at}MISSOURI.EDU.
We affectionately dedicate this paper to the memory of Robert N. Goodman, whose insight and numerous contributions have led to a better
understanding of the biology of these and other plant-pathogenic bacteria.
Journal series 13,022 of the Missouri Agriculture Experiment Station.
| |
REFERENCES |
| 1.
|
Aiba, H.,
S. Adhya, and B. de Crombrugghe.
1981.
Evidence for two functional gal promoters in intact Escherichia coli.
J. Biol. Chem.
256:111905-11910.
|
| 2.
|
Barras, F.,
K. K. Thurn, and A. K. Chatterjee.
1987.
Resolution of four pectate lyase structural genes of Erweinia chrysanthemi (EC16) and characterization of the enzymes produced in Escherichia coli.
Mol. Gen. Genet.
209:319-325[CrossRef][Medline].
|
| 3.
|
Blumer, C.,
S. Heeb,
G. Pessi, and D. Haas.
1999.
Global GacA-steered control of cyanide and exoprotease production in Pseudomonas fluorescens involves specific ribosome binding sites.
Proc. Natl. Acad. Aci. USA
96:14073-14078[Abstract/Free Full Text].
|
| 4.
|
Bugert, P., and K. Geider.
1995.
Molecular analysis of the ams operon required for exopolysaccharide synthesis of Erwinia amylovora.
Mol. Microbiol.
15:917-933[Medline].
|
| 5.
|
Chatterjee, A.,
Y. Liu,
C. K. Dumenyo, and A. K. Chatterjee.
1995.
Inactivation of rsmA leads to overproduction of extracellular pectinases, cellulases, and proteases in Erwinia carotovora subsp. carotovora in the absence of the starvation/cell density-sensing signal, N-(3-oxohexanoyl)-L-homoserine lactone.
Appl. Environ. Microbiol.
61:1959-1967[Abstract].
|
| 6.
|
Chatterjee, A.,
J. L. McEvoy,
J. P. Chambost,
F. Blasco, and A. K. Chatterjee.
1991.
Nucleotide sequence and molecular characterization of pnlA, the structural gene for damage-inducible pectin lyase of Erwinia carotovora subsp. carotovora 71.
J. Bacteriol.
173:1765-1769[Abstract/Free Full Text].
|
| 7.
|
Chatterjee, A. K.,
G. E. Buchanan,
M. K. Behrens, and M. P. Starr.
1979.
Synthesis and excretion of polygalacturonic acid trans-eliminase in Erwinia, Yersinia, and Klebsiella species.
Can. J. Microbiol.
25:94-102[Medline].
|
| 8.
|
Chatterjee, A. K.,
K. K. Thurn, and D. J. Tyrell.
1985.
Isolation and characterization of Tn5 insertion mutants of Erwinia chrysanthemi that are deficient in polygalacturonate catabolic enzymes oligogalacturonate lyase and 3-deoxy-D-glycero-2,5-hexodiulosonate dehydrogenase.
J. Bacteriol.
162:708-714[Abstract/Free Full Text].
|
| 9.
|
Cotter, P. A., and J. F. Miller.
1998.
In vivo and ex vivo regulation of bacterial virulence gene expression.
Curr. Opin. Microbiol.
1:17-26[CrossRef][Medline].
|
| 10.
|
Cui, Y.,
A. Chatterjee,
Y. Liu,
C. K. Dumenyo, and A. K. Chatterjee.
1995.
Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp. carotovora that controls extracellular enzymes, N-(3-oxohexanoyl)-L-homoserine lactone, and pathogenicity in soft-rotting Erwinia spp.
J. Bacteriol.
177:5108-5115[Abstract/Free Full Text].
|
| 11.
|
Cui, Y.,
A. Mukherjee,
C. K. Dumenyo,
Y. Liu, and A. K. Chatterjee.
1999.
rsmC of the soft-rotting bacterium Erwinia carotovora subsp. carotovora negatively controls extracellular enzyme and harpinEcc production and virulence by modulating levels of regulatory RNA (rsmB) and RNA-binding protein (RsmA).
J. Bacteriol.
181:6042-6052[Abstract/Free Full Text].
|
| 12.
|
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J.-F. Tomb,
B. A. Dougherty,
J. M. Merrick,
K. McKenney,
G. Sutton,
W. Fitzhugh,
C. A. Fields,
J. D. Gocayne,
J. D. Scott,
R. Shirley,
L.-I. Liu,
A. Glodek,
J. M. Kelley,
J. F. Weidman,
C. A. Phillips,
T. Spriggs,
E. Hedblom,
M. D. Cotton,
T. R. Utterback,
M. C. Hanna,
D. T. Nguyen,
D. M. Saudek,
R. C. Brandon,
L. D. Fine,
J. L. Fritchman,
J. L. Fuhrmann,
N. S. M. Geoghagen,
C. L. Gnehm,
L. A. McDonald,
K. V. Small,
C. M. Fraser,
H. O. Smith, and J. C. Venter.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512[Abstract/Free Full Text].
|
| 13.
|
Grant, M., and J. Mansfield.
1999.
Early events in host-pathogen interactions.
Curr. Opin. Plant Biol.
2:312-319[CrossRef][Medline].
|
| 14.
|
Hauben, L.,
E. R. B. Moore,
L. Vauterin,
M. Steenackers,
J. Mergaert,
L. Verdonck, and J. Swings.
1998.
Phylogenetic position of phytopathogens within the Enterobacteriaceae.
Syst. Appl. Microbiol.
21:384-397[Medline].
|
| 15.
|
Keen, N. T.,
S. Tamaki,
D. Kobayashi, and D. Trollinger.
1988.
Improved broad-host-range plasmids for DNA cloning in Gram negative bacteria.
Gene.
70:191-197[CrossRef][Medline].
|
| 16.
|
Lerner, C. G., and M. Inouye.
1990.
Low copy number pasmids for regulated low-level expression of cloned genes in Escherichia coli with blue/white inset screening capability.
Gene
18:4631.
|
| 17.
|
Lichter, A.,
I. Barash,
L. Valinsky, and S. Manulis.
1995.
The genes involved in cytokinin biosynthesis in Erwinia herbicola pv. gypsophilae: characterization and role in gall formation.
J. Bacteriol.
177:4457-4465[Abstract/Free Full Text].
|
| 18.
|
Liu, M. Y.,
G. Gui,
B. Wei,
J. F. Preston III,
L. Oakford,
U. Yueksel,
D. P. Giedroc, and T. Romeo.
1997.
The RNA molecule CsrB binds to the global regulatory protein CsrA and antagonizes its activity in Escherichia coli.
J. Biol. Chem.
272:17502-17510[Abstract/Free Full Text].
|
| 19.
|
Liu, Y.,
A. Chatterjee, and A. K. Chatterjee.
1994.
Nucleotide sequence and expression of a novel pectate lyase gene (pel-3) and a closely linked endopolygalacturonase gene (peh-l) of Erwinia carotovora subsp. carotovora 71.
Appl. Environ. Microbiol.
60:2545-2552[Abstract/Free Full Text].
|
| 20.
|
Liu, Y.,
A. Chatterjee, and A. K. Chatterjee.
1994.
Nucleotide sequence, organization and expression of rdgA and rdgB genes that regulate pectin lyase production in the plant pathogenic bacterium Erwinia carotovora subsp. carotovora in response to DNA-damaging agents.
Mol. Microbiol.
14:999-1010[CrossRef][Medline].
|
| 21.
|
Liu, Y.,
Y. Cui,
A. Mukherjee, and A. K. Chatterjee.
1998.
Characterization of a novel RNA regulator of Erwinia carotovora ssp. carotovora that controls production of extracellular enzymes and secondary metabolites.
Mol. Microbiol.
29:219-234[CrossRef][Medline].
|
| 22.
|
Liu, Y.,
H. Murata,
A. Chatterjee, and A. K. Chatterjee.
1993.
Characterization of a novel regulatory gene aepA that controls extracellular enzyme production in the phytopathogenic bacterium Erwinia carotovora ssp carotovora.
Mol. Plant-Microbe Interact.
6:299-308[Medline].
|
| 23.
|
Manulis, S.,
A. Havivchesner,
M. T. Brandl,
S. E. Lindow, and I. Barash.
1998.
Differential involvement of indole-3-acetic acid biosynthetic pathways in pathogenicity and epiphytic fitness of Erwinia herbicola pv. gypsophilae.
Mol. Plant-Microbe Interact.
11:634-642[Medline].
|
| 24.
|
McEvoy, J. L.,
H. Murata, and A. K. Chatterjee.
1990.
Molecular cloning and characterization of an Erwinia carotovora subsp. carotovora pectin lyase gene that responds to DNA-damaging agents.
J. Bacteriol.
172:3284-3289[Abstract/Free Full Text].
|
| 25.
|
Mukherjee, A.,
Y. Cui,
Y. Liu, and A. K. Chatterjee.
1997.
Molecular characterization and expression of the Erwinia carotovora hrpNEcc gene, which encodes an elicitor of the hypersensitive reaction.
Mol. Plant-Microbe Interact.
10:462-71[Medline].
|
| 26.
|
Mukherjee, A.,
Y. Cui,
Y. Liu,
C. K. Dumenyo, and A. K. Chatterjee.
1996.
Global regulation in Erwinia species by Erwinia carotovora rsmA, a homologue of Escherichia coli csrA: repression of secondary metabolites, pathogenicity and hypersensitive reaction.
Microbiology
142:427-434[Abstract/Free Full Text].
|
| 27.
|
Mukherjee, A.,
Y. Cui,
W. Ma,
Y. Liu, and A. K. Chatterjee.
2000.
hexA of Erwinia carotovora ssp. carotovora strain Ecc71 negatively regulates production of RpoS and rsmB RNA, a global regulator of extracellular proteins, plant virulence and the quorum sensing signal, N-(3-oxohexanoyl)-L-homoserine lactone.
Environ. Microbiol.
2:203-215[CrossRef][Medline].
|
| 28.
|
Murata, H.,
A. Chatterjee,
Y. Liu, and A. K. Chatterjee.
1994.
Regulation of the production of extracellular pectinase, cellulase, and protease in the soft rot bacterium Erwinia carotovora subsp. carotovora: evidence that aepH of E. carotovora subsp. carotovora 71 activates gene expression in E. carotovora subsp. carotovora, E. carotovora subsp. atroseptica, and Escherichia coli.
Appl. Environ. Microbiol.
60:3150-3159[Abstract/Free Full Text].
|
| 29.
|
Murata, H.,
J. L. McEvoy,
A. Chatterjee,
A. Collmer, and A. K. Chatterjee.
1991.
Molecular cloning of an aepA gene that activates production of extracellular pectolytic, cellulolytic, and proteolytic enzymes in Erwinia carotovora subsp. carotovora.
Mol. Plant-Microbe Interact.
4:239-246.
|
| 30.
|
Musco, G.,
G. Stier,
C. Joseph,
M. A. C. Morelli,
M. Nilges,
T. J. Gibson, and A. Pastore.
1996.
Three-dimensional structure and stability of the KH domain molecular insights into the fragile X syndrome.
Cell
85:237-245[CrossRef][Medline].
|
| 31.
|
Perombelon, M. C. M.
1992.
The genus Erwinia, p. 2899-2921.
In
A. Balows, H. G. Trüper, M. Dworkin, and K.-H. Schleifer (ed.), The prokaryotes: a handbook on the biology of bacteria. Ecophysiology, isolation, identification, applications. Springer-Verlag, New York, N.Y.
|
| 32.
|
Politis, D., and R. N. Goodman.
1980.
Fine structure of extracellular polysaccharide of Erwinia amylovora.
Appl. Environ. Microbiol.
40:596-607[Abstract/Free Full Text].
|
| 33.
|
Romeo, T.
1998.
Global regulation by the small RNA-binding protein CsrA and the non-coding RNA molecule CsrB.
Mol. Microbiol.
29:1321-1330[CrossRef][Medline].
|
| 34.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Habor, N.Y.
|
| 35.
|
Seldo, B.,
V. Lazarevic,
C. Mauel, and D. Karamata.
1996.
Sequence of the 305 degrees-307 degrees region of the Bacillus subtilis chromosome.
Microbiology
142:3079-3088[Abstract/Free Full Text].
|
| 36.
|
Selvaraj, G.,
Y. C. Fong, and V. N. Iyer.
1984.
A portable DNA sequence carrying the cohesive site (cos) of the bacteriophage lambda and the mob (mobilization) region of the broad-host-range plasmid RK2: a module for the construction of new cosmids.
Gene
32:235-241[CrossRef][Medline].
|
| 37.
|
Thurn, K. K., and A. K. Chatterjee.
1982.
Isolation and protein composition of the outer membrane of Erwinia amylovora.
Curr. Microbiol.
7:87-92.
|
| 38.
|
White, D.,
M. E. Hart, and T. Romeo.
1996.
Phylogenetic distribution of the global regulatory gene csrA among eubacteria.
Gene
182:221-223[CrossRef][Medline].
|
| 39.
|
Zink, R. T.,
R. J. Kemble, and A. K. Chatterjee.
1984.
Transposon Tn5 mutagenesis in Erwinia carotovora subsp. carotovora and E. carotovora subsp. atroseptica.
J. Bacteriol.
157:809-814[Abstract/Free Full Text].
|
Journal of Bacteriology, March 2001, p. 1870-1880, Vol. 183, No. 6
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.6.1870-1880.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Cui, Y., Chatterjee, A., Yang, H., Chatterjee, A. K.
(2008). Regulatory Network Controlling Extracellular Proteins in Erwinia carotovora subsp. carotovora: FlhDC, the Master Regulator of Flagellar Genes, Activates rsmB Regulatory RNA Production by Affecting gacA and hexA (lrhA) Expression. J. Bacteriol.
190: 4610-4623
[Abstract]
[Full Text]
-
Yang, S., Zhang, Q., Guo, J., Charkowski, A. O., Glick, B. R., Ibekwe, A. M., Cooksey, D. A., Yang, C.-H.
(2007). Global Effect of Indole-3-Acetic Acid Biosynthesis on Multiple Virulence Factors of Erwinia chrysanthemi 3937. Appl. Environ. Microbiol.
73: 1079-1088
[Abstract]
[Full Text]
-
Suzuki, K., Babitzke, P., Kushner, S. R., Romeo, T.
(2006). Identification of a novel regulatory protein (CsrD) that targets the global regulatory RNAs CsrB and CsrC for degradation by RNase E. Genes Dev.
20: 2605-2617
[Abstract]
[Full Text]
Top
Abstract
Introduction
