INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The Sec-dependent translocation of secretory proteins across the inner membrane of Escherichia coli is catalyzed by the action of translocase, a complex of cytoplasmic and inner membrane proteins. The core components of translocase are the integral membrane proteins SecY and SecE and the peripheral membrane protein, SecA. SecY and SecE interact to form a protein-conducting channel that translocates secretory proteins across the membrane, while SecA is an ATPase that binds to the SecYE complex. SecA undergoes cycles of membrane insertion and deinsertion coupled to ATP binding and hydrolysis that are believed to drive the segmental translocation of the secretory protein (13, 15, 18, 32).

A number of genetic and biochemical studies have demonstrated that SecY, SecE, and SecA are necessary and sufficient for preprotein translocation (2, 4, 9, 10, 34). However, translocation with only these three components of translocase does not achieve optimal efficiency; the interaction of additional inner membrane proteins with the SecYE complex enhances translocation activity. SecG is a small protein that copurifies with SecYE and stimulates translocation activity in reconstituted membrane vesicles (8, 35), while SecD, SecF, and YajC form a heterotrimeric complex that also interacts with SecYE (16). Duong and Wickner (16) demonstrated that SecYE can associate with either SecG or SecDFYajC to generate full translocation activity. It appears that both SecG and SecDFYajC modulate the SecA cycle of insertion and deinsertion, but they do so by subtly different mechanisms. SecG stimulates the insertion of SecA after initiation of translocation, while SecDFYajC increases SecA insertion and stabilizes the inserted state. Thus, SecG and SecDFYajC appear to have overlapping roles in fully activating the translocation process (16).

Neither SecG nor SecDFYajC is required for translocation activity, although each stimulates activity in vitro (16, 35). In keeping with these observations, none of these genes are essential for viability of E. coli (19, 33, 36). However, depletion of SecDF has a profound effect on cell growth and protein export. Null mutants of secDF form only minute colonies at 37°C and are unable to form colonies at all at 30°C or lower (36). In contrast, deletion of secG results in a less severe export defect and a cold-sensitive phenotype that is manifest only at very low temperatures (20°C) (33). Importantly, both the cold sensitivity and the severity of the secG export defect have been shown to be strain dependent. Indeed, only the initial deletion strains (including KN370) containing the secG deletion are cold sensitive; no other strain could be constructed that produced this phenotype (6, 19). We previously proposed that the cold sensitivity of KN370 was due to the combination of secG::kan with another unidentified mutation (19). In this report, that hypothesis is verified and the mutation in KN370 that acts in concert with secG::kan to produce a cold-sensitive phenotype is identified.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains, plasmids, and media. All bacterial strains used are E. coli K-12 derivatives and are listed in Table 1. Bacteria were grown in Luria-Bertani (LB) or M63 minimal media, with kanamycin (50 mg/liter), ampicillin (125 mg/liter), or tetracycline (25 mg/liter) added when appropriate (40). The DL--glycerophosphate (Sigma) was a generous gift from John Cronan (University of Illinois at Urbana-Champaign). Plasmid pBAD18 has been described elsewhere (23). Plasmids pAF69 and pAF70 were constructed by PCR amplification of glpE and glpR, respectively, from the chromosome of MG1655, using primers with restriction sites near the termini (glpE-1, GCAATGCCCGGGTACCGTAAAGAAAGAGAGACGCATG; glpE-2, CCTAGCCTGCAGAAGCTTGACAGTATAAAGCGTTACGC; glpR-1, GCAATGCCCGGGTACCATTCCAGGGATTTATAAATG; and glpR-2, CCTAGCCTGCAGAAGCTTGCACAGCTCCAGTTGAATAT; KpnI and HindIII sites are underlined), followed by digestion with KpnI and HindIII and ligation with pBAD18 that had been digested with KpnI and HindIII. Preparation of competent cells, transformation, and genetic manipulations were performed as described previously (37, 40).

Growth curves. Growth curves were performed with a Bioscreen C Microbiology Reader from Labsystems. The Bioscreen C is a computer-controlled shaker-incubator-reader. Customized microplates hold up to 200 individual 400-µl samples. The Bioscreen maintains the samples at the desired temperature, shakes the samples, and measures the optical density at set intervals. Bacterial dilutions were prepared in LB medium prior to inoculation into the microplates, and cell density was determined by viable plate counts from the diluted cultures. For the experiments described here, the temperature was held at 20°C, shaking occurred once every minute for 10 s, and the A₆₀₀ was measured and recorded every 30 min. The growth curves were continued until all cultures reached stationary phase, usually in 5 days. Data were exported to a Microsoft Excel worksheet for analysis.

Construction of the mini-Tn10 library. The mini-Tn10 library, constructed in strain MG1655, was a generous gift from Majda Valjavec-Gratian and Thomas Hill (University of North Dakota). P1-mediated transduction was used to introduce the library into strain KN370, with selection for tetracycline-resistant transductants. Following transduction, 200 individual colonies were inoculated into LB medium containing 10 mM sodium citrate and 12 mg of tetracycline/liter. The colonies were inoculated into 20 tubes, with 10 inocula per tube. The mixed cultures were grown overnight at 37°C and then diluted to a starting concentration of approximately 500 CFU/ml. Duplicate samples (400 µl) of each culture were inoculated into microwell plates, and growth rates were analyzed in the Bioscreen C as described above.

Inverse PCR. Inverse PCR was performed as described previously (31). In short, chromosomal DNA from fast-growing transductants was digested with various restriction enzymes that do not cleave within the mini-Tn10 sequence (BamHI, PstI, KpnI, or XhoI). The digested DNA was ligated in a dilute reaction mixture and then used as a template for PCR amplification. The primers used for PCR were derived from mini-Tn10 sequences (Tn10T-645, GAACCATTTTCAGTGATCCATTGCTGTTGAC and Tn10T-3358, AAAGTGATGATAAAAGGCACCTTTGG) and were oriented such that the resultant PCR product would include the chromosomal DNA. DNA from the samples with the most easily detectable PCR product (from the KpnI digest) were purified and used for DNA sequence analysis.

DNA sequencing. All PCR DNA to be sequenced was purified by agarose gel electrophoresis followed by Qiaex II gel extraction (Qiagen). DNA sequencing was performed by the Macromolecular Resources Sequi-Net Department at Colorado State University (Fort Collins).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Characterization of the secG::kan cold-sensitive phenotype. Previous studies demonstrated that the presence of the secG::kan allele resulted in a cold-sensitive phenotype only in certain strains, specifically the original deletion strain, KN370, and its derivatives (6, 19, 33). It was also noted that the cold sensitivity manifested by these strains was a leaky phenotype (19). That is, the cold-sensitive strains were able to form single colonies at 20°C, albeit at a slower rate than wild-type strains. After streaking on solid media and incubation at 20°C, the primary streaks grew normally while a marked defect was apparent in streaks further out on the plate. These results suggested that the cold-sensitive strains had a defect in single colony formation but were able to grow well at high cell density (in the initial streak).

secG

secG

secG

secG

View larger version (26K): [in this window] [in a new window]   FIG. 1.   Growth curves of AF538 and AF539. Strains were diluted from overnight cultures to starting concentrations of 37,500 CFU/ml (squares), 375 CFU/ml (triangles), or 3 to 4 CFU/ml (circles) and grown at 20°C in LB. AF538 is represented by closed symbols and AF539 is shown by open symbols. Although absorbance was measured every 30 min, for clarity only readings for each 5-h increment are shown.

The growth defect of KN370 can be rescued by a single gene. The observed growth defect of AF539 was clearly dependent on the deletion of secG, as its isogenic partner, AF538, did not exhibit this cold sensitivity. To confirm our previous hypothesis that a second mutation contributes to this phenotype (19) and to identify the second mutation, the presumed mutation was replaced with a wild-type allele, thereby restoring normal growth characteristics to the strain. To this end, a mini-Tn10 library was constructed from a wild-type strain (MG1655) and transduced into KN370 (AF539 could not be used because it is tetracycline resistant). If the growth defect is due to a single other mutation in combination with secG::kan, then some transductants should receive a wild-type copy of that gene and thereby regain normal growth characteristics.

secG

secG

secG

secG

Cold sensitivity can be rescued by glpR⁺. To identify the gene that contributes to the cold sensitivity of KN370, inverse PCR was used to locate the site of insertion of two of the three mini-Tn10s. Both mapped to approximately 76.5 min on the E. coli chromosome, one in glpG and the other in yzgL (5). Cotransduction frequencies indicated that the gene that rescues the growth defect was approximately 95 to 98% linked to each of the mini-Tn10s. Cloning of chromosomal DNA fragments demonstrated that a 6-kb KpnI fragment, which contains only five intact genes, glpR, glpG, glpE, glpD, and yzgL, was able to complement the cold sensitivity of KN370. As the mini-Tn10s were located in two of these genes, only three candidate genes remained, glpD, glpE, and glpR. The glpE and glpR wild-type genes were amplified from MG1655 by PCR and subcloned into pBAD18. Recombinant plasmids were transformed into KN370, and growth was examined at 20°C in the presence and absence of arabinose. The plasmid containing glpR rescued growth of KN370 in the presence of arabinose. This result suggested that a mutation in glpR contributed to the growth defect in KN370 and, further, that the glpR mutation was recessive because the growth defect was complemented by plasmid-borne wild-type glpR.

KN370 has a constitutive mutation in glpR. The glpR gene encodes the repressor for the glp regulon, which is involved in metabolism of glycerol phosphate (38). KN370 is a derivative of C600 (3), which is known to have a mutation in glpR, glpR200 (17). To confirm that KN370 did in fact contain the glpR200 mutation, glpR was PCR amplified from KN370 as well as from fast-growing derivatives, and DNA sequence analysis was performed. KN370 glpR had a mutation in amino acid 55 from Gly to Ala, while the fast-growing derivatives did not contain this mutation. Because KN370 was complemented by the wild-type copy of glpR, it seemed likely that this mutation resulted in an inactive GlpR repressor and constitutive synthesis of the glp regulon. Indeed, the original characterization of glpR200 in C600 demonstrated that it does result in constitutive expression of the regulon (17). Further, this same amino acid alteration has been identified independently as glpR2 and characterized as a constitutive mutation (Donald Pettigrew, Texas A&M University, personal communication).

The combination of secG::kan and glpR200 results in a cold-sensitive phenotype. To verify that the glpR200 mutation in combination with secG::kan results in cold sensitivity, both mutations were introduced into MC4100 by P1-mediated transduction. As shown previously, secG::kan alone does not produce a cold-sensitive phenotype in MC4100 (Fig. 2). Furthermore, glpR200 alone does not result in cold sensitivity (Fig. 2). However, the two mutations in combination did cause a cold-sensitive growth defect in the MC4100 background (Fig. 2). The lag in growth was not as striking as it was in KN370, but it was reproducible and was detectable by streaking as well as by growth curve analysis. The growth defect was more apparent when the length of time required to reach mid-log phase (A₆₀₀ = 0.3) was calculated. The parent and singly mutant strains reached this point in 30 to 35 h, while the doubly mutant strain required 42.5 h to reach the same absorbance. This result explains the puzzling prior observations that secG::kan resulted in cold sensitivity in some strains but not in others. Only when glpR200 and secG::kan were both present in the same strain was a growth defect observed.

View larger version (26K): [in this window] [in a new window]   FIG. 2.   Growth curves for MC4100 containing secG::kan and glpR200. Strains were diluted from overnight cultures to a starting concentration of approximately 400 CFU/ml and grown in LB medium at 20°C. Symbols: AF636 (secG+ glpR+), open triangles; AF638 (secG::kan), open squares; AF635 (glpR200), open circles; AF637 (secG::kan glpR200), asterisks. Absorbance readings for each 5-h increment are shown.

Growth of KN370 is improved by increasing the intracellular concentration of glycerol-3-phosphate. Why does the combination of glpR200 and secG::kan result in cold sensitivity? One possible explanation is that constitutive expression of the glp regulon results in depletion of the intracellular pool of glycerol-3-phosphate, due to overexpression of glpD (the aerobic glycerol-3-phosphate dehydrogenase) and subsequent channeling of glycerol-3-phosphate into metabolic pathways (29). It is possible that this depletion limits the glycerol-3-phosphate available for phospholipid biosynthesis, leading to perturbations in the phospholipid levels (Fig. 3). Under these circumstances, the function of SecG may become critical. If this hypothesis is correct, the growth defect should be alleviated either by addition of glycerol-3-phosphate to the media or by introduction of a null mutation in glpD.

View larger version (14K): [in this window] [in a new window]   FIG. 3.   Pathways for glycerol-3-phosphate and phospholipid metabolism. Abbreviations are as follows: G3P, glycerol-3-phosphate; DHAP, dihydroxyacetone phosphate; PE, phosphatidylethanolamine; PG, phosphatidylglycerol. Genes encoding relevant proteins are indicated. Not all steps of phospholipid biosynthesis are shown. This figure is adapted from previous reviews (14, 29).

secG

secG

secG

View larger version (47K): [in this window] [in a new window]   FIG. 4.   Growth characteristics in the presence of glycerol-3-phosphate. Strains were grown in LB with the indicated amounts of glycerol-3-phosphate (G3P) at 20°C. Strains were diluted from overnight cultures to a starting concentration of approximately 400 CFU/ml. The bars represent the number of hours required for each culture to reach mid-log phase (A600 = 0.3). AF539 (secG::kan glpR200), stippled bars; AF538 (glpR200), striped bars; AF634 (secG::kan), cross-hatched bars. All assays were performed in duplicate, and the standard error never exceeded ±5%.

secG::kan, glpR8 (another glpR constitutive allele), and glpD26 was cold resistant (Fig. 5), while the isogenic glpD⁺

View larger version (57K): [in this window] [in a new window]   FIG. 5.   Effect of glpD26 on growth. Strains were grown on LB plates at 20°C. AF645 is secG::kan glpR200, while AF646 is secG::kan glpR8 glpD26.

glpR200 secG

View larger version (79K): [in this window] [in a new window]   FIG. 6.   Effect of alternate carbon sources on growth of secG::kan strains. Strains were grown on either glucose minimal (top) or glycerol minimal (bottom) medium at 20°C.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Early observations of the phenotypes associated with the secG::kan mutation were perplexing because the observed cold sensitivity and the severity of the export defect were strain dependent and few strains other than the original secG deletion strain could be constructed that demonstrated these phenotypes (6, 16, 19). To reconcile these data, we proposed that an additional mutation was required for the cold sensitivity of secG::kan (19), and the results presented here support that hypothesis. The original secG deletion strain, KN370, contains a mutation in glpR; replacement of the mutant allele with wild-type glpR resulted in abrogation of the cold-sensitive phenotype. Further, introduction of both secG::kan and glpR200 into another strain background, MC4100, also produced a cold-sensitive phenotype. Clearly, the phenotype of the secG deletion mutation varies with the genetic background. Understanding this variation is crucial to understanding the function of SecG.

Several genes were identified previously as high-copy suppressors of the cold sensitivity of KN370. The Bacillus subtilis pgsA and scgR genes were both identified by selection of cold-resistant transformants from a plasmid-borne genomic library (26, 27); the E. coli pgsA and gpsA genes encoded on high-copy-number plasmids also suppressed the cold-sensitive phenotype (27, 39). The identification of these high-copy-number suppressors led to a hypothesis that the effect of secG deletion can be ameliorated by an increase in the level of acidic phospholipids (39, 41).

The evidence presented here suggests an alternative interpretation of those previous results. The current data demonstrate that deletion of secG has a detrimental effect on the cell only in the presence of a glpR constitutive mutation. We propose that the glpR200 mutation leads to constitutive expression of glpD, thereby shunting glycerol-3-phosphate to dihydroxyacetone phosphate which, in turn, limits the amount of glycerol-3-phosphate available for phospholipid biosynthesis (Fig. 3). Consistent with this prediction, the cold-sensitive growth defect of the secG deletion strain was alleviated by addition of glycerol-3-phosphate to the growth media or by introduction of a glpD null mutation. In this scheme, therefore, the previously observed suppression by overexpression of pgsA, gpsA, or scgR is explained not because the amount of acidic phospholipids increases above wild-type levels, but rather because expression of these genes reestablishes normal phospholipid biosynthetic patterns.

The proposed alteration to phospholipid levels is very subtle. It was demonstrated previously that steady-state phospholipid ratios in the secG deletion strain, KN370, are essentially identical to that of MC4100 (39). Our results are consistent with this finding, as we found that KN370 and its derivatives grow at a rate indistinguishable from wild-type strains, once logarithmic growth begins. The growth defect is apparent only in dilute cultures prior to onset of exponential growth. Therefore, we predict that the glpR200 mutation confers a defect in phospholipid metabolism that is not detectable by measurement of steady-state levels. It is possible that there is an alteration in the flux of the pathways, particularly during the transition from stationary phase to log phase. Along these lines, it is interesting to note that phospholipid metabolism is growth-phase regulated, with an increase in cardiolipin and a decrease in phosphatidylglycerol as cells enter stationary phase (14). Additionally, it remains unclear why cell density affects the phenotype of the glpR200 secG::kan strain, but there is evidence that population density affects the global pattern of cellular metabolites (30), perhaps explaining the density dependence of the cold sensitivity observed here.

Acidic phospholipids (phosphatidylglycerol and cardiolipin) enhance translocation at several steps: they promote the interaction of SecA with the inner membrane (7, 28, 43) and with SecYE (24), they are required for SecA translocation ATPase activity (28, 42), they are involved in the interaction of the signal sequence with the inner membrane (25), and they are important in achieving the proper orientation of membrane proteins (44). SecA insertion and deinsertion is tightly linked to the phospholipid content of the membrane, and it has been shown that an increase in acidic phospholipids stimulates both the insertion and deinsertion steps of the SecA cycle in secG::kan or secAcsR11 strains (41). Although the precise function of SecG remains unknown, the present studies suggest that SecG may be involved in the function and/or stabilization of the translocation apparatus under conditions that alter the phospholipid content of the membrane.