Previous Article | Next Article 
Journal of Bacteriology, March 2001, p. 2081-2085, Vol. 183, No. 6
Howard Hughes Medical
Institute3 and Division of Geographic
Medicine and Infectious Diseases, Tufts University School of
Medicine, Boston, Massachusetts 021111;
Department of Microbiology and Immunology, University of
Michigan, Ann Arbor, Michigan 481092
Received 1 November 2000/Accepted 3 January 2001
Shiga toxins (Stxs), encoded by the stxA and
stxB genes, are important contributors to the virulence of
Escherichia coli O157:H7 and other Stx-producing E. coli (STEC) strains. The stxA and stxB genes in STEC strains are located on the genomes of resident prophages of the Escherichia coli O157:H7
and other Shiga toxin (Stx)-producing E. coli (STEC) strains
are responsible for outbreaks and sporadic cases of diarrhea. In some
patients, exposure to STEC leads to hemorrhagic colitis and hemolytic
uremic syndrome that may lead to death (20). Two major
classes of Stxs, Stx1 and Stx2, encoded respectively by
stx1AB and
stx2AB, have been identified in STEC (2). The severe clinical consequences of STEC infections
are thought to be caused by the activities of Stxs, although Stx2 appears to be more closely associated with these sequelae than does
Stx1 (7, 28, 36). Shiga toxins are of the A-B type, with
the glycolipid-binding B subunits being involved in the transport of
the enzymatic A subunits into the eukaryotic cell where the A subunit,
acting as a glycosylase, catalyzes a cleavage at a unique site in the
28S rRNA (2). The resulting inactivation of the ribosome
leads to an inhibition of protein synthesis. More than 60 serotypes of
STEC have been associated with human disease (1). The
stx genes of many, if not all, STEC strains are in the
genomes of prophages of the lambdoid family (19, 23, 27). This fact probably accounts for the wide dissemination of these genes
in diverse E. coli serotypes.
Comparison of lambdoid phage genomes (9) has revealed a
common arrangement of functionally similar genes and a shared strategy governing gene expression (Fig. 1). In
the lysogenic state, the repressor silences transcription of most phage
genes (30). Removal of repression, which can occur when
DNA damage activates the bacterial SOS response causing RecA-mediated
cleavage of the repressor (21), leads to a cascade of
regulatory events beginning with expression of the N transcription
antitermination protein (30). Terminator read-through
mediated by the N protein results in expression of delayed early genes
that encode products involved in replication and prophage excision, as
well as the Q antitermination protein (15). Q acts at a
site, qut, within the phage late promoter, pR', modifying RNA polymerase to a highly
processive form that reads through downstream terminators
(39), including the strong Rho-independent terminator,
tR', located directly downstream of
pR' (32, 33). Thus, late gene
expression by lambdoid prophages is a consequence of prophage
induction; i.e., it follows removal of repression of the early
promoters, pR and pL.
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.6.2081-2085.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Role for a Phage Promoter in Shiga Toxin 2 Expression from a Pathogenic Escherichia coli
Strain
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
family immediately downstream of the phage late promoters (pR'). The phage-encoded Q proteins modify RNA
polymerase initiating transcription at the cognate
pR' promoter which creates transcription
complexes that transcend a transcription terminator immediately
downstream of pR' as well as terminator kilobases distal to pR'. To test if this
Q-directed processive transcription plays a role in
stx2AB expression, we constructed a
mutant prophage in an O157:H7 clinical isolate from which
pR' and part of Q were deleted but which has an
intact pStx, the previously described
stx2AB-associated promoter. We
report that production of significant levels of Stx2 in this O157:H7
isolate depends on the pR' promoter. Since
transcription initiating at pR' ultimately
requires activation of the phage lytic cascade, expression of
stx2AB in STEC depends primarily on
prophage induction. By showing this central role for the prophage in
stx2AB expression, our findings
contradict the prevailing assumption that phages serve merely as agents
for virulence gene transfer.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
View larger version (14K):
[in a new window]
FIG. 1.
Presumed genome arrangement and transcription patterns
of Stx2-encoding phage 
361. This diagram is based on the maps of
characterized lambdoid phages (16, 26), including the
Stx2-encoding phage 933W (29), and the information we have
on 361 (not drawn to scale). Shown are relevant genes, promoters,
terminators, operators, and the site of the 
Q-pR'
deletion. The attL and attR sites are the
junctions of the integrated prophage with the bacterial DNA. Below are
shown the patterns of transcription initiating at the early promoters,
pL and pR, in the absence
and presence of N. Above are shown the patterns of transcription
initiating at the late promoter pR' in the
absence and presence of Q. Induction inactivates the repressor
(cI), resulting in expression of the N protein-encoded
antiterminator. N modification of RNA polymerase allows read-through of
the tL1 and tR1
terminators, resulting in production of proteins catalyzing excision
and replication of the phage genome. The N-modified RNA polymerase also
reads through the tR2, -3, and -4 terminators, leading to synthesis of the Q antiterminator. The
Q-modified RNA polymerase transcends transcription termination at
tR' and subsequent downstream terminators,
allowing expression of late genes, which include those encoding
proteins involved in lysis and morphogenesis. Recomb., recombination;
Rep., replication.
Although previous studies have identified functional promoters immediately upstream of stx genes (8, 34), recent evidence suggests that prophage induction and the resulting transcription from the phage pR' late promoters are likely to be important in stx expression (26). First, stx genes are located directly downstream of the pR' promoters and upstream of the phage lysis genes (25, 26, 29). Second, agents that induce Stx phages also increase Stx expression by their host STEC strains (24, 40). Third, the Q protein from Stx phage H-19B acting in trans directs high-level expression from the stx genes of repressed H-19B and 933W prophages, two phages that share nearly identical Q, qut, and pR' sequences but different stx genes (25, 29). Thus, these observations suggest that the regulatory circuits of Stx-encoding phages play a direct role in STEC pathogenesis. Moreover, if phage-directed lysis is important in Stx release from STEC cells, Q-activated transcription of stx and downstream lysis genes may serve as the primary mechanism for coordinating production and release of toxin during a STEC infection (26, 38). We present evidence that transcription from the late phage promoter pR' resulting from prophage induction plays a major role in the production of toxin from the Stx2-encoding O157:H7 enterohemorrhagic E. coli clinical isolate 1:361.
| |
MATERIALS AND METHODS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Bacteria and plasmids.
Strain 1:361, a clinical E. coli isolate of serotype O157:H7, has previously been described
(37). Strain 1:361Q-pR' was
derived from 1:361 using the allele exchange vector
pQ-pR'. This plasmid is a derivative of the
sacB counterselectable vector pCVD442 (13),
which contains an ~900-bp DNA fragment from the pR' region of 361 with a 189-bp deletion that
includes pR'. The inserted fragment was
synthesized using the procedure involving PCR-based splicing by overlap
extension (18) with the 1:361 chromosomal DNA serving as
the template. Four primers were employed in constructing this fragment:
the upstream primer 5'CACCGTAAAAACCATTCCTGACATGCTCC,
corresponding to sequences in the Q gene; the overlapping primers
5'CCTTTCTGTGTACTTTCCGCCAGCATCATCAGCATGCC and
5'GGCATGCTGATGATGCTGGCGGAAAGTACACAGAAAGG,
corresponding to sequences upstream and downstream of the
deleted region; and 5'GCCACCACATTAACTGAAAAGATAAC, corresponding to sequences downstream of
pR'. pQ-pR' was
introduced into 1:361 by conjugation from E. coli strain
SM10pir. Exconjugates were selected as streptomycin- and
ampicillin-resistant colonies. Haploid cells were then selected as
sucrose-resistant colonies as described previously (13)
and subsequently screened for Q-pR'
mutations. DNA sequence analysis confirmed that 1:361Q-pR' contains the proper deletion.
RNA preparation.
RNA from mid-log-phase culture of 1:361 or
1:361Q-pR' was prepared using an RNeasy kit
(Qiagen). Northern blotting was performed using standard procedures
(3) with a 32P-labeled
stx2A riboprobe. The
stx2A probe was synthesized using T7
polymerase (Ambion), with plasmid pPW58 (which contains 258 bp of
stx2A coding sequence subcloned into
plasmid pCR2.1-TOPO [Invitrogen]) as the template.
Animal model.
A modified version of the
streptomycin-treated-mouse model of enterohemorrhagic E. coli infection (35) was used to compare the levels of
colonization and intestinal Stx2 production of 1:361 and
1:361Q-pR'. Four-week-old CD-1 mice were
given drinking water containing streptomycin (2 g/liter) throughout
each experiment. Two days after streptomycin treatment was begun, mice
were inoculated intragastrically with ~1010 CFU of either
1:361 or 1:361Q-pR'. Fecal samples were collected daily beginning 1 day after inoculation. Numbers of streptomycin-resistant CFU of either 1:361 or
1:361Q-pR' and fecal Stx2 concentration were
determined as described previously (41).
Toxin assay. Stx levels were measured using an enzyme-linked immunosorbent assay (ELISA) essentially as previously described (14).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Prophage construction.
E. coli strain 1:361,
isolated from a patient with bloody diarrhea, contains two
Stx2-encoding lambdoid prophages (data not shown). One of these
phages was found to be defective, and the other, designated 361,
shares, at a minimum, the Q, pR', and
stx2 sequences found in phage 933W
(37) (Fig. 1). We constructed a derivative of 1:361,
called 1:361Q-pR', in which a 189-bp region
including the 3' end of Q and the pR'
late promoter of the 361 prophage was deleted (Fig. 1). This
deletion left intact the stx2A and
-B genes and the previously identified
stx2 promoter, pStx2. As expected for
a lysogen carrying a lambdoid prophage defective in transcription from
pR', 1:361Q-pR' did
not produce phage detectable by plaque formation following induction
with mitomycin C (Fig. 2C).
|
) 0.5 µg of mitomycin C per ml. Six micrograms of RNA was run on a
1% agarose gel, transferred to a nylon membrane, and then probed with
a 32P-labeled Stx2-encoding sequence riboprobe. (B) Total
Stx2 was measured from the same cultures used in the Northern blot,
using a previously described ELISA (Transcription levels.
Northern blotting was performed to
directly assess the role of transcription initiating at
pR' in stx expression (Fig. 2A).
Strain 1:361 produced low levels of the stx transcript (lane 1), while strain 1:361Q-pR' (lane 3) failed
to produce detectable levels of the stx transcript.
Following induction with mitomycin C, strain 1:361 produced high levels
of the stx transcript (lane 2), while strain
1:361Q-pR' again failed to produce observable
levels of the stx transcript (lane 4). Based on studies with
(33), Q-mediated antitermination of transcription
initiating at pR' is expected to result in a
>25-kb message; however, the relatively small size of the
stx transcript is not surprising for an mRNA initiating at
pR' since the pR'
message is known to be processed (11). Therefore, these
experiments provide evidence that the Q-pR'
region in 361, which is necessary for transcription of late phage
genes, is also important for stx2 transcription.
Toxin levels.
Stx levels in cultures of 1:361 and
1:361Q-pR', measured by an ELISA
(14), provide further evidence that transcription from
pR' contributes significantly to stx
expression (Fig. 2B). Uninduced cultures of strain 1:361 produced low
levels of Stx2, and under identical conditions, cultures of
1:361Q-pR' failed to produce measurable
levels of Stx2. Thus, the low level of Stx produced by the untreated
culture most likely resulted from Q-stimulated transcription from
pR' in the small fraction of lysogens in which
there was spontaneous induction of the prophage. Induced cultures of
1:361 (treated with mitomycin C) produced high levels of Stx2, while
similarly treated cultures of 1:361Q-pR' produced toxin levels that were nearly 20-fold less (Fig. 2B). These
results confirm the conclusion from the Northern analysis that the
Q-pR' region exerts a critical role in
regulating Stx2 synthesis in vitro.
Stx production in vivo.
To assess the physiological
relevance of these findings, Stx2 production by strains 1:361 and
1:361Q-pR' was examined in vivo, using a
mouse model system (35). In these experiments, CD-1 mice
were inoculated intragastrically with either 1:361 or 1:361Q-pR'. Over the course of 4 days, stool
samples were collected and assayed both for CFU of 1:361 or
1:361Q-pR' and for levels of Stx2. In
striking contrast to the similar numbers of 1:361 and
1:361Q-pR' CFU recovered, the difference in the amounts of Stx in the stool specimens between the mice inoculated with the two strains was dramatic (Fig.
3). There was an approximately 30-fold
lower concentration of Stx2 in stools from animals inoculated with
1:361Q-pR' than the concentration of Stx2 in
stools from mice inoculated with 1:361. Thus, Stx production by strain 1:361 in the animal gut, as in vitro culture, largely derives from the
small fraction of the bacteria in which there is prophage induction.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Previous studies identified a functional promoter, pStx, immediately upstream of stx genes in the Stx1-encoding phage H-19B (8) and the Stx2-encoding phage 933W (34). These findings appeared to confirm the idea that, although stx genes can be carried by phages, once the phage is established as a prophage, stx is expressed independently of the regulatory system governing phage gene expression. More recent studies led to the suggestion that phage-encoded regulatory circuits that result in Q modification of transcription initiating at the phage pR' promoter and subsequent processive transcription of downstream genes, including stxA and stxB, may play a role in stxAB expression (26). We directly tested this hypothesis by deleting the Q-pR' region while leaving intact the pStx promoter of a prophage that carries the stx2A and -B genes in an E. coli O157:H7 clinical isolate.
Our experiments comparing levels of Stx2 production by the parent
clinical strain and an isogenic derivative with a deletion of the
Q-pR' region of the prophage provide compelling
evidence supporting the idea that Q-activated
pR'-promoted processive transcription plays a
critical role in Stx2 production. Since Q expression depends on
transcription from pR, a promoter that is under
repressor control, stx expression, according to this idea,
ultimately depends on induction of the prophage. Induction is expected
to result in increased stx copy number and increased transcription of phage late genes initiating from the early promoter pR. However, copy number and increased
transcription of phage late genes by N-antiterminated transcription
from the early promoter pR are not expected to
be affected by the Q-pR' deletion (17). Therefore, our results strongly suggest that
high-level Q-modified transcription initiating at the 361
pR' late promoter is responsible for the
increase in Stx2 production observed upon induction of strain 1:361.
Residual toxin production by 1:361Q-pR' may
be due to low-level transcription from the early
pR' promoter (10) or
pStx2 and possibly from the other defective Stx2-encoding
phage present in 1:361. Our results are consistent with the hypothesis
that Q-modified transcription (32) beginning at
pR' proceeds through the terminator
tR', into the stx genes, past
termination signals, and through the downstream lysis genes, providing
a unified mechanism for coupling Stx production and release.
Previously, Stx phages were considered to be important in the
dissemination of but not the regulation of expression of toxin genes
(38). Our results favor the view that
stx2 expression is regulated as one of the late
phage genes and suggest that, far from being a mere vector for toxin
gene transfer, 361 directs production of Stx2 as part of its lytic
cycle. If our model is correct, it would mean that an induced
subpopulation of the total infecting STEC population is responsible for
significant levels of Stx production. This does not appear to be the
exclusive mode for regulating virulence gene expression in lambdoid
phages. The prototypical itself encodes bor and
lom, genes encoding proteins having significant homology to
known bacterial virulence factors (5) and, in the case of
bor, shown to confer a virulence phenotype (6).
The biologically relevant expression of these genes, unlike that of the
stx genes, occurs from the repressed prophage.
Our study raises a question about the evolution of stx-carrying phages. Since the subpopulation of bacteria postulated to be the primary producers of Stx would not survive to be infectious, how can evolution select for stx if its production is coupled with phage-mediated lysis? The diarrhea induced by Stx likely contributes to the dissemination of the remaining population, an effect that may outweigh selection against toxin producers. There is precedence for the idea that the death of a minority of a bacterial population contributes to the survival advantage of the majority. Bacteriocins, molecules produced by some bacteria that are lethal to other bacteria of the same and closely related species, are produced by a subpopulation that is lysed in the process of releasing the bacteriocin (31). A possible role for the phage in expression of phage-borne virulence genes has been considered since the early demonstration that diphtheria toxin is carried by a phage (4). As far as we know, the results of our study provide the first evidence directly linking a phage regulatory cascade with expression of a phage-encoded virulence factor.
Expression of virulence factors, even when carried by mobile genetic elements, is generally considered in the context of overall coordination of the infectious strategy of the host bacterium (22). Here we present evidence that the bacteriophage life cycle is the dominant, if not the only, important factor involved in Stx2 expression. It will be interesting to learn whether phage control of virulence gene expression is unique to stx or can serve as a paradigm that explains regulation of expression of other phage-encoded virulence factors. In light of our findings, an understanding of the conditions in the intestine that trigger prophage induction and subsequent up-regulation of Stx expression takes on new significance. Notable pharmacologic agents which induce prophages include mitomycin C, used in chemotherapy, and numerous antibiotics, including the fluoroquinolones, often used in treatment of diarrhea (41). Interestingly, endogenous products of inflammatory cells, such as H2O2, are also known to induce lambdoid prophages (12). While it remains unknown to what extent such exogenous and endogenous factors contribute to STEC pathogenesis, our study suggests that clinical intervention to prevent prophage induction may reduce Stx production during STEC infection.
| |
ACKNOWLEDGMENTS |
|---|
P.L.W. and M.N.N. contributed equally to this work.
We thank Andrew Camilli, Victor DiRita, Michelle Swanson, and Bridgid Davis for critical reading of the manuscript. Eric Olson is thanked for helpful discussions and encouragement.
This work was supported by grants from the NIH (D.I.F., M.K.W., and D.W.K.A.), the Pew Foundation (M.K.W.), the FDA (D.W.K.A.), the HHMI (P.L.W. and M.K.W.), and an NIH biotechnology training grant (M.N.N.).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Medical School, 5641 Medical Science Building II, University of Michigan, Ann Arbor, MI 48109-0620. Phone: (734) 763-3142. Fax: (734) 764-3562. E-mail: davidfri{at}umich.edu.
Present address: Department of Molecular Microbiology, Washington
University School of Medicine, St. Louis, MO 63110.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Acheson, D. W. K., and G. T. K. Keusch. 1996. Which Shiga toxin-producing types of Escherichia coli are important? ASM News 62:302-306. |
| 2. | Acheson, W. K., A. Donohue-Rolfe, and G. T. Keusch. 1991. The family of Shiga and Shiga-like toxins, p. 415-433. In J. E. Alouf, and J. H. Freer (ed.), Sourcebook of bacterial protein toxins. Academic Press, London, United Kingdom. |
| 3. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1999. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y. |
| 4. | Barksdale, L., and S. B. Arden. 1974. Persisting bacteriophage infections, lysogeny, and phage conversion. Annu. Rev. Microbiol. 28:265-297[CrossRef][Medline]. |
| 5. | Barondess, J. J., and J. Beckwith. 1990. A bacterial virulence determinant encoded by lysogenic coliphage lambda. Nature 346:871-874[CrossRef][Medline]. |
| 6. |
Barondess, J. J., and J. Beckwith.
1995.
bor gene of phage lambda, involved in serum resistance, encodes a widely conserved outer membrane lipoprotein.
J. Bacteriol.
177:1247-1253 |
| 7. |
Boerlin, P.,
S. A. McEwen,
F. Boerlin-Petzold,
J. B. Wilson,
R. P. Johnson, and C. L. Gyles.
1999.
Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans.
J. Clin. Microbiol.
37:497-503 |
| 8. |
Calderwood, S. B.,
F. Auclair,
A. Donohue-Rolfe,
G. T. Keusch, and J. J. Mekalanos.
1987.
Nucleotide sequence of the Shiga-like toxin genes of Escherichia coli.
Proc. Natl. Acad Sci. USA
84:4364-4368 |
| 9. | Campbell, A. 1994. Comparative molecular biology of lambdoid phages. Annu. Rev. Microbiol. 48:193-222[CrossRef][Medline]. |
| 10. | Dambly, C., and M. Couturier. 1971. A minor Q-independent pathway for expression of late genes in bacteriophage lambda. Mol. Gen. Genet. 113:244-250[CrossRef][Medline]. |
| 11. | Daniels, D. L., M. N. Subbarao, F. R. Blattner, and H. A. Lozeron. 1988. Q-mediated late gene transcription of bacteriophage lambda: RNA start point and RNase III processing sites in vivo. Virology 167:568-577[Medline]. |
| 12. | DeMarini, D. M., and H. G. Brooks. 1992. Induction of prophage lambda by chlorinated organics: detection of some single-species/single-site carcinogens. Environ. Mol. Mutagen. 19:98-111[Medline]. |
| 13. |
Donnenberg, M. S., and J. B. Kaper.
1991.
Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector.
Infect. Immun.
59:4310-4317 |
| 14. |
Donohue-Rolfe, A.,
D. W. Acheson,
A. V. Kane, and G. T. Keusch.
1989.
Purification of Shiga toxin and Shiga-like toxins I and II by receptor analog affinity chromatography with immobilized P1 glycoprotein and production of cross-reactive monoclonal antibodies.
Infect. Immun.
57:3888-3893 |
| 15. | Friedman, D. I., and D. L. Court. 1995. Transcription antitermination: the lambda paradigm updated. Mol. Microbiol. 18:191-200[CrossRef][Medline]. |
| 16. | Hendrix, R. W., J. W. Roberts, F. W. Stahl, and R. A. Weisberg. 1983. Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 17. |
Herskowitz, I., and Signer.
1970.
Control of transcription from the r strand of bacteriophage lambda.
Cold Spring Harbor Symp. Quant. Biol.
35:355-368 |
| 18. | Horton, R. M., Z. L. Cai, S. N. Ho, and L. R. Pease. 1990. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. BioTechniques 8:528-535[Medline]. |
| 19. |
Huang, A.,
J. Friesen, and J. L. Brunton.
1987.
Characterization of a bacteriophage that carries the genes for production of Shiga-like toxin I in Escherichia coli.
J. Bacteriol.
169:4308-4312 |
| 20. | Kaper, J. B., and A. D. O'Brien. 1998. Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. American Society for Microbiology, Washington, D.C. |
| 21. | Little, J. W. The SOS regulatory system, p. 453-479. In E. C. C. Linn and A. S. Lynch (ed.), Regulation of gene expression in Escherichia coli. R. G. Landis Co., Georgetown, Tex. |
| 22. |
Mekalanos, J. J.
1992.
Environmental signals controlling expression of virulence determinants in bacteria.
J. Bacteriol.
174:1-7 |
| 23. | Mizutani, S., N. Nakazono, and Y. Sugino. 1999. The so-called chromosomal verotoxin genes are actually carried by defective prophages. DNA Res. 6:141-143[CrossRef][Medline]. |
| 24. | Mühldorfer, I., J. Hacker, G. T. Keusch, D. W. Acheson, H. Tschape, A. V. Kane, A. Ritter, T. Olschlager, and A. Donohue-Rolfe. 1996. Regulation of the Shiga-like toxin II operon in Escherichia coli. Infect. Immun. 64:495-502[Abstract]. |
| 25. | Neely, M. N., and D. I. Friedman. 1998. Arrangement and functional identification of genes in the regulatory region of lambdoid phage H-19B, a carrier of a Shiga-like toxin. Gene 223:105-113[CrossRef][Medline]. |
| 26. | Neely, M. N., and D. I. Friedman. 1998. Functional and genetic analysis of regulatory regions of coliphage H-19B: location of shiga-like toxin and lysis genes suggest a role for phage functions in toxin release. Mol. Microbiol. 28:1255-1267[CrossRef][Medline]. |
| 27. |
O'Brien, A. D.,
J. W. Newland,
S. F. Miller,
R. K. Holmes,
H. W. Smith, and S. B. Formal.
1984.
Shiga-like toxin-converting phages from Escherichia coli strains that cause hemorrhagic colitis or infantile diarrhea.
Science
226:694-696 |
| 28. | Ostroff, S. M., P. I. Tarr, M. A. Neill, J. H. Lewis, N. Hargrett-Bean, and J. M. Kobayashi. 1989. Toxin genotypes and plasmid profiles as determinants of systemic sequelae in Escherichia coli O157:H7 infections. J. Infect. Dis. 160:994-998[Medline]. |
| 29. |
Plunkett, G., III,
D. J. Rose,
T. J. Durfee, and F. R. Blattner.
1999.
Sequence of Shiga toxin 2 phage 933W from Escherichia coli O157:H7: Shiga toxin as a phage late-gene product.
J. Bacteriol.
181:1767-1778 |
| 30. | Ptashne, M. 1992. A genetic switch, 2nd ed. Cell Press, Blackwell Scientific Publications, Cambridge, Mass. |
| 31. | Riley, M. A. 1998. Molecular mechanisms of bacteriocin evolution. Annu. Rev. Genet. 32:255-278[CrossRef][Medline]. |
| 32. | Roberts, J. 1992. Antitermination and the control of transcription elongation, p. 389-406. In S. L. McKnight, and K. R. Yamamoto (ed.), Transcription regulation. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 33. | Roberts, J. W., W. Yarnell, E. Bartlett, J. Guo, M. Marr, D. C. Ko, H. Sun, and C. W. Roberts. 1998. Antitermination by bacteriophage Lambda Q protein. Cold Spring Harbor Symp. Quant. Biol. 63:319-325[CrossRef][Medline]. |
| 34. |
Sung, L. M.,
M. P. Jackson,
A. D. O'Brien, and R. K. Holmes.
1990.
Transcription of the Shiga-like toxin type II and Shiga-like toxin type II variant operons of Escherichia coli.
J. Bacteriol.
172:6386-6395 |
| 35. |
Wadolkowski, E. A.,
J. A. Burris, and A. D. O'Brien.
1990.
Mouse model for colonization and disease caused by enterohemorrhagic Escherichia coli O157:H7.
Infect. Immun.
58:2438-2445 |
| 36. |
Wadolkowski, E. A.,
L. M. Sung,
J. A. Burris,
J. E. Samuel, and A. D. O'Brien.
1990.
Acute renal tubular necrosis and death of mice orally infected with Escherichia coli strains that produce Shiga-like toxin type II.
Infect. Immun.
58:3959-3965 |
| 37. |
Wagner, P. L.,
D. W. Acheson, and M. K. Waldor.
1999.
Isogenic lysogens of diverse Shiga toxin 2-encoding bacteriophages produce markedly different amounts of Shiga toxin.
Infect. Immun.
67:6710-6714 |
| 38. | Waldor, M. K. 1998. Bacteriophage biology and bacterial virulence. Trends Microbiol. 6:295-297[CrossRef][Medline]. |
| 39. |
Yarnell, W. S., and J. W. Roberts.
1999.
Mechanism of intrinsic transcription termination and antitermination.
Science
284:611-615 |
| 40. |
Yee, A. J.,
S. De Grandis, and C. L. Gyles.
1993.
Mitomycin-induced synthesis of a Shiga-like toxin from enteropathogenic Escherichia coli H.I.8.
Infect. Immun.
61:4510-4513 |
| 41. | Zhang, X., A. D. McDaniel, L. E. Wolf, G. T. Keusch, M. K. Waldor, and D. W. Acheson. 2000. Quinolone antibiotics induce Shiga toxin-encoding bacteriophages, toxin production, and death in mice. J. Infect. Dis. 181:664-670[CrossRef][Medline]. |
Journal of Bacteriology, March 2001, p. 2081-2085, Vol. 183, No. 6
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.6.2081-2085.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lainhart, W., Stolfa, G., Koudelka, G. B.
(2009). Shiga Toxin as a Bacterial Defense against a Eukaryotic Predator, Tetrahymena thermophila. J. Bacteriol.
191: 5116-5122
[Abstract] [Full Text] -
Shimizu, T., Ohta, Y., Noda, M.
(2009). Shiga Toxin 2 Is Specifically Released from Bacterial Cells by Two Different Mechanisms. Infect. Immun.
77: 2813-2823
[Abstract] [Full Text] -
Zurla, C., Manzo, C., Dunlap, D., Lewis, D. E. A., Adhya, S., Finzi, L.
(2009). Direct demonstration and quantification of long-range DNA looping by the {lambda} bacteriophage repressor. Nucleic Acids Res
37: 2789-2795
[Abstract] [Full Text] -
Imamovic, L., Jofre, J., Schmidt, H., Serra-Moreno, R., Muniesa, M.
(2009). Phage-Mediated Shiga Toxin 2 Gene Transfer in Food and Water. Appl. Environ. Microbiol.
75: 1764-1768
[Abstract] [Full Text] -
de Sablet, T., Chassard, C., Bernalier-Donadille, A., Vareille, M., Gobert, A. P., Martin, C.
(2009). Human Microbiota-Secreted Factors Inhibit Shiga Toxin Synthesis by Enterohemorrhagic Escherichia coli O157:H7. Infect. Immun.
77: 783-790
[Abstract] [Full Text] -
Pedersen, M. G., Hansen, C., Riise, E., Persson, S., Olsen, K. E. P.
(2008). Subtype-Specific Suppression of Shiga Toxin 2 Released from Escherichia coli upon Exposure to Protein Synthesis Inhibitors. J. Clin. Microbiol.
46: 2987-2991
[Abstract] [Full Text] -
Rasko, D. A., Moreira, C. G., Li, D. R., Reading, N. C., Ritchie, J. M., Waldor, M. K., Williams, N., Taussig, R., Wei, S., Roth, M., Hughes, D. T., Huntley, J. F., Fina, M. W., Falck, J. R., Sperandio, V.
(2008). Targeting QseC Signaling and Virulence for Antibiotic Development. Science
321: 1078-1080
[Abstract] [Full Text] -
de Sablet, T., Bertin, Y., Vareille, M., Girardeau, J.-P., Garrivier, A., Gobert, A. P., Martin, C.
(2008). Differential expression of stx2 variants in Shiga toxin-producing Escherichia coli belonging to seropathotypes A and C. Microbiology
154: 176-186
[Abstract] [Full Text] -
Murphy, K. C., Ritchie, J. M., Waldor, M. K., Lobner-Olesen, A., Marinus, M. G.
(2008). Dam Methyltransferase Is Required for Stable Lysogeny of the Shiga Toxin (Stx2)-Encoding Bacteriophage 933W of Enterohemorrhagic Escherichia coli O157:H7. J. Bacteriol.
190: 438-441
[Abstract] [Full Text] -
Mellies, J. L., Barron, A. M. S., Carmona, A. M.
(2007). Enteropathogenic and Enterohemorrhagic Escherichia coli Virulence Gene Regulation. Infect. Immun.
75: 4199-4210
[Full Text] -
Mellies, J. L., Haack, K. R., Galligan, D. C.
(2007). SOS Regulation of the Type III Secretion System of Enteropathogenic Escherichia coli. J. Bacteriol.
189: 2863-2872
[Abstract] [Full Text] -
Gyles, C. L.
(2007). Shiga toxin-producing Escherichia coli: An overview. J ANIM SCI
85: E45-E62
[Abstract] [Full Text] -
Steele, M., Ziebell, K., Zhang, Y., Benson, A., Konczy, P., Johnson, R., Gannon, V.
(2007). Identification of Escherichia coli O157:H7 Genomic Regions Conserved in Strains with a Genotype Associated with Human Infection. Appl. Environ. Microbiol.
73: 22-31
[Abstract] [Full Text] -
Willenbrock, H., Petersen, A., Sekse, C., Kiil, K., Wasteson, Y., Ussery, D. W.
(2006). Design of a Seven-Genome Escherichia coli Microarray for Comparative Genomic Profiling. J. Bacteriol.
188: 7713-7721
[Abstract] [Full Text] -
Gamage, S. D., Patton, A. K., Strasser, J. E., Chalk, C. L., Weiss, A. A.
(2006). Commensal Bacteria Influence Escherichia coli O157:H7 Persistence and Shiga Toxin Production in the Mouse Intestine. Infect. Immun.
74: 1977-1983
[Abstract] [Full Text] -
Quinones, M., Davis, B. M., Waldor, M. K.
(2006). Activation of the Vibrio cholerae SOS Response Is Not Required for Intestinal Cholera Toxin Production or Colonization. Infect. Immun.
74: 927-930
[Abstract] [Full Text] -
Creuzburg, K., Recktenwald, J., Kuhle, V., Herold, S., Hensel, M., Schmidt, H.
(2005). The Shiga Toxin 1-Converting Bacteriophage BP-4795 Encodes an NleA-Like Type III Effector Protein. J. Bacteriol.
187: 8494-8498
[Abstract] [Full Text] -
Moran, N. A., Degnan, P. H., Santos, S. R., Dunbar, H. E., Ochman, H.
(2005). Inaugural Article: The players in a mutualistic symbiosis: Insects, bacteria, viruses, and virulence genes. Proc. Natl. Acad. Sci. USA
102: 16919-16926
[Abstract] [Full Text] -
Faucher, S. P., Curtiss, R. III, Daigle, F.
(2005). Selective Capture of Salmonella enterica Serovar Typhi Genes Expressed in Macrophages That Are Absent from the Salmonella enterica Serovar Typhimurium Genome. Infect. Immun.
73: 5217-5221
[Abstract] [Full Text] -
Herold, S., Siebert, J., Huber, A., Schmidt, H.
(2005). Global Expression of Prophage Genes in Escherichia coli O157:H7 Strain EDL933 in Response to Norfloxacin. Antimicrob. Agents Chemother.
49: 931-944
[Abstract] [Full Text] -
Aertsen, A., Faster, D., Michiels, C. W.
(2005). Induction of Shiga Toxin-Converting Prophage in Escherichia coli by High Hydrostatic Pressure. Appl. Environ. Microbiol.
71: 1155-1162
[Abstract] [Full Text] -
Creuzburg, K., Kohler, B., Hempel, H., Schreier, P., Jacobs, E., Schmidt, H.
(2005). Genetic structure and chromosomal integration site of the cryptic prophage CP-1639 encoding Shiga toxin 1. Microbiology
151: 941-950
[Abstract] [Full Text] -
Gamage, S. D., Patton, A. K., Hanson, J. F., Weiss, A. A.
(2004). Diversity and Host Range of Shiga Toxin-Encoding Phage. Infect. Immun.
72: 7131-7139
[Abstract] [Full Text] -
Koudelka, A. P., Hufnagel, L. A., Koudelka, G. B.
(2004). Purification and Characterization of the Repressor of the Shiga Toxin-Encoding Bacteriophage 933W: DNA Binding, Gene Regulation, and Autocleavage. J. Bacteriol.
186: 7659-7669
[Abstract] [Full Text] -
Tyler, J. S., Mills, M. J., Friedman, D. I.
(2004). The Operator and Early Promoter Region of the Shiga Toxin Type 2-Encoding Bacteriophage 933W and Control of Toxin Expression. J. Bacteriol.
186: 7670-7679
[Abstract] [Full Text] -
Brussow, H., Canchaya, C., Hardt, W.-D.
(2004). Phages and the Evolution of Bacterial Pathogens: from Genomic Rearrangements to Lysogenic Conversion. Microbiol. Mol. Biol. Rev.
68: 560-602
[Abstract] [Full Text] -
Gamage, S. D., McGannon, C. M., Weiss, A. A.
(2004). Escherichia coli Serogroup O107/O117 Lipopolysaccharide Binds and Neutralizes Shiga Toxin 2. J. Bacteriol.
186: 5506-5512
[Abstract] [Full Text] -
Tyler, J. S., Friedman, D. I.
(2004). Characterization of a Eukaryotic-Like Tyrosine Protein Kinase Expressed by the Shiga Toxin-Encoding Bacteriophage 933W. J. Bacteriol.
186: 3472-3479
[Abstract] [Full Text] -
Sumby, P., Waldor, M. K.
(2003). Transcription of the Toxin Genes Present within the Staphylococcal Phage {phi}Sa3ms Is Intimately Linked with the Phage's Life Cycle. J. Bacteriol.
185: 6841-6851
[Abstract] [Full Text] -
Muniesa, M., de Simon, M., Prats, G., Ferrer, D., Panella, H., Jofre, J.
(2003). Shiga Toxin 2-Converting Bacteriophages Associated with Clonal Variability in Escherichia coli O157:H7 Strains of Human Origin Isolated from a Single Outbreak. Infect. Immun.
71: 4554-4562
[Abstract] [Full Text] -
Gobius, K. S., Higgs, G. M., Desmarchelier, P. M.
(2003). Presence of Activatable Shiga Toxin Genotype (stx2d) in Shiga Toxigenic Escherichia coli from Livestock Sources. J. Clin. Microbiol.
41: 3777-3783
[Abstract] [Full Text] -
Ingrey, K. T., Ren, J., Prescott, J. F.
(2003). A Fluoroquinolone Induces a Novel Mitogen-Encoding Bacteriophage in Streptococcus canis. Infect. Immun.
71: 3028-3033
[Abstract] [Full Text] -
Gamage, S. D., Strasser, J. E., Chalk, C. L., Weiss, A. A.
(2003). Nonpathogenic Escherichia coli Can Contribute to the Production of Shiga Toxin. Infect. Immun.
71: 3107-3115
[Abstract] [Full Text] -
Canchaya, C., Proux, C., Fournous, G., Bruttin, A., Brussow, H.
(2003). Prophage Genomics. Microbiol. Mol. Biol. Rev.
67: 238-276
[Abstract] [Full Text] -
Brett, K. N., Ramachandran, V., Hornitzky, M. A., Bettelheim, K. A., Walker, M. J., Djordjevic, S. P.
(2003). stx1c Is the Most Common Shiga Toxin 1 Subtype among Shiga Toxin-Producing Escherichia coli Isolates from Sheep but Not among Isolates from Cattle. J. Clin. Microbiol.
41: 926-936
[Abstract] [Full Text] -
Ritchie, J. M., Wagner, P. L., Acheson, D. W. K., Waldor, M. K.
(2003). Comparison of Shiga Toxin Production by Hemolytic-Uremic Syndrome-Associated and Bovine-Associated Shiga Toxin-Producing Escherichia coli Isolates. Appl. Environ. Microbiol.
69: 1059-1066
[Abstract] [Full Text] -
Ho, T. D., Figueroa-Bossi, N., Wang, M., Uzzau, S., Bossi, L., Slauch, J. M.
(2002). Identification of GtgE, a Novel Virulence Factor Encoded on the Gifsy-2 Bacteriophage of Salmonella enterica Serovar Typhimurium. J. Bacteriol.
184: 5234-5239
[Abstract] [Full Text] -
Wagner, P. L., Waldor, M. K.
(2002). Bacteriophage Control of Bacterial Virulence. Infect. Immun.
70: 3985-3993
[Full Text] -
Teel, L. D., Melton-Celsa, A. R., Schmitt, C. K., O'Brien, A. D.
(2002). One of Two Copies of the Gene for the Activatable Shiga Toxin Type 2d in Escherichia coli O91:H21 Strain B2F1 Is Associated with an Inducible Bacteriophage. Infect. Immun.
70: 4282-4291
[Abstract] [Full Text] -
Broudy, T. B., Pancholi, V., Fischetti, V. A.
(2002). The In Vitro Interaction of Streptococcus pyogenes with Human Pharyngeal Cells Induces a Phage-Encoded Extracellular DNase. Infect. Immun.
70: 2805-2811
[Abstract] [Full Text] -
Strauch, E., Lurz, R., Beutin, L.
(2001). Characterization of a Shiga Toxin-Encoding Temperate Bacteriophage of Shigella sonnei. Infect. Immun.
69: 7588-7595
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»