Previous Article
Journal of Bacteriology, March 2001, p. 2151-2155, Vol. 183, No. 6
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.6.2151-2155.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Analysis of Promoters Recognized by PvdS, an
Extracytoplasmic-Function Sigma Factor Protein from
Pseudomonas aeruginosa
Megan J.
Wilson,
Brendan J.
McMorran,
and
Iain
L.
Lamont*
Department of Biochemistry, University of
Otago, Dunedin, New Zealand
Received 21 August 2000/Accepted 30 November 2000
 |
ABSTRACT |
The alternative sigma factor PvdS is required by
Pseudomonas aeruginosa for initiation of transcription from
pyoverdine (pvd) promoters. Two divergent PvdS-dependent
promoters (pvdE and pvdF) were characterized by
deletion analysis, and the minimal promoter region for each included a
sequence element, the iron starvation (IS) box, that is present in
other pvd promoters. Site-directed mutagenesis showed that
the IS box elements were essential for promoter activity in vivo. Band
shift assays and in vitro transcription experiments showed that a
complex of PvdS and core RNA polymerase required the presence of an IS
box in order to bind to and initiate transcription from pvd
promoters. These results indicate that IS box elements participate in
sequence-specific recognition by PvdS to enable initiation of
transcription from pvd promoters and are likely to
represent a
35 sequence element for this sigma factor.
 |
TEXT |
Fluorescent pseudomonads are
characterized by the production of yellow-green siderophores termed
pyoverdines or pseudobactins that enable iron uptake under
conditions where little free iron is available. These molecules are
thought to be associated with biocontrol of fungal pathogens in the
biosphere (7), and pyoverdine is required for virulence of
the opportunist mammalian pathogen Pseudomonas aeruginosa
(14). Production of pyoverdine by P. aeruginosa
strain PAO is dependent on a protein, PvdS, that has been shown to be
an alternative sigma factor protein (9, 27). The presence
of PvdS is essential for the expression of all other pyoverdine
synthesis genes that have been examined, including pvdA, pvdD,
pvdE, pvcA to D, and ptxR (4, 8, 23,
24). These genes encode a variety of proteins that all
contribute to the biosynthesis of pyoverdine. PvdS is also required for
the synthesis of exotoxin A (18) and an extracellular
proteinase, PrpL (P. J. Wilderman and M. L. Vasil,
Abstr. 100th Gen. Meet. Am. Soc. Microbiol., abstr. B-331,
2000), two enzymes that are secreted by P. aeruginosa.
Expression of pvdS is regulated by the iron-responsive Fur
repressor protein such that there is no transcription of
pvdS and no production of pyoverdine or exotoxin A by cells
grown in iron-rich media (reviewed in reference 25).
The DNA sequences that are recognized by PvdS to enable transcription
from cognate promoters have not yet been identified. However, a DNA
sequence element named the iron starvation (IS) box has been identified
in the promoters of iron-regulated genes from Pseudomonas
and been shown to be required for promoter function (20).
The purpose of the experiments described here was to test the
hypothesis that this sequence element is a DNA recognition site for
PvdS. This was done through a detailed characterization of two
divergent PvdS-dependent pvd promoters, the promoters of the
pvdE and pvdF genes. Both of these genes are
essential for pyoverdine production by P. aeruginosa PAO,
with pvdE encoding an ATP binding cassette-2 type
transporter that is likely to be involved in secretion of pyoverdine or
a precursor (11) and pvdF encoding an enzyme
required for synthesis of formyl-hydroxyornithine residues that are
present in the pyoverdine produced by this strain (B. McMorran et al.,
unpublished data).
Identification of the pvdF gene transcriptional start
sites.
The strains and plasmids used in this study are described
in Table 1, and the intergenic sequence
between the pvdE and pvdF genes is shown in Fig.
1. As a prelude to promoter
characterization, it was necessary to determine the transcriptional
start site of the pvdF gene; the pvdE
transcriptional start site has been mapped previously
(20). The initiation site of the pvdF
transcript was determined by primer extension analysis (Fig.
2) using an avian myeloblastosis virus
reverse transcriptase primer extension kit (Promega). Primer extension
analysis was carried out using 5'-end-labeled oligonucleotides, primer
1 (CCGCGGGGTTTCTCAGGGACCAGATATAGGCCAG), and
primer 2 (CGCAGTCTGGTTCAGCGCCTCCACCAAGGACTCC). With both
primers, the 3' end of the major reaction product corresponded to a
cytosine residue located 87 bp upstream from the pvdE
transcript start site. No products were detected in experiments
performed with RNA from bacteria grown in iron-rich medium (Fig. 2,
lanes 2 and 5), consistent with expression of pvdF requiring
the PvdS protein, which is absent from iron-rich cells
(4).

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1.
The pvdE-pvdF intergenic promoter region. The
DNA sequence and the location of the pvdE IS box and the
pvdE transcript start site have been described previously
(20), and the sequence has been deposited with GenBank
(accession no. U07359). The positions of the pvdF IS box and
pvdF transcription start site (this work) are also shown.
Numbering above the sequence is relative to the pvdF
transcript start site, while numbering below the sequence is relative
to the pvdE transcript start site. Mutations that were
created at the IS box elements (see text) are shown in boldface
underneath the wild-type sequences.
|
|

View larger version (127K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of the 5' end of pvdF
transcript. RNA was prepared from P. aeruginosa grown in
King's B medium (6) containing the iron chelator
ethylenediamine-(o-hydroxy)phenylacetic acid (EDDA) (200 µg/ml) (lanes 1 and 4) or containing FeCl3 (60 µg/ml)
(lanes 2 and 5) and used in primer extension analysis with primers 1 and 2. Lanes 3 and 6, reactions performed without RNA. Sequencing
ladders of pvdF DNA obtained with the same oligonucleotides
are shown and allowed the precise identification of the 5' ends of the
pvdF transcript. The DNA sequence corresponding to the
transcription start site is shown, with the initiating nucleotide in
boldface.
|
|
The DNA upstream from the 5' end of the major
pvdF
transcript was examined for likely promoter sequences and
regulatory elements.
Recognition sequences have been suggested for
P. aeruginosa RpoD
and RpoN (
21), but we were
unable to identify similar sequences
upstream from
pvdF.
However, a sequence matching 7 out of 10 nucleotides
of the IS box
motif [(G/C)CTAAATCCC] (
20) was centered 33 bp
upstream of the
pvdF transcript start site (Fig.
1).
Mutational analysis of the pvdE and pvdF
promoters.
A series of 5' deletions of each promoter was
constructed in order to localize the DNA sequences necessary for
promoter function. This was done by using PCR to amplify fragments with
a shared 3' end and different lengths of 5' promoter sequence (Fig. 3A and B). The fragments were cloned into
plasmid pMP190 (22) just upstream from a promoterless
lacZ reporter gene, using XbaI and BglII restriction sites incorporated into the ends of each
PCR product. Each construct was then introduced into P. aeruginosa OT11 (19), which is a derivative of strain
PAO, and the amounts of
-galactosidase (
-Gal) produced by the
bacteria were assayed (Fig. 3).

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Promoter activities of the pvdE and
pvdF promoter deletion fragments in P. aeruginosa. The positions of the fragments are shown relative to a
map of the pvdE-pvdF promoter region, with the nucleotides
present in each fragment given relative to the transcript start site of
the relevant gene. The transcript start sites (+1) and positions of IS
box elements are also shown. The amounts of -Gal produced from each
construct in P. aeruginosa during growth in iron-deficient
( Fe) and iron-replete (+Fe) media, with standard deviations from
three independent assays in parentheses, were determined using the
method of Miller (15) as described previously (4,
20). Promoter fragments cloned into pMP190 were oriented such
that lacZ expression was dependent upon pvdE
promoter activity (A and C) or pvdF promoter activity (B and
D) as shown. Fragments with the wild-type promoter sequence (A and B)
or with mutations in the IS box sequence elements (C and D) were used.
Vector control, P. aeruginosa OT11 containing pMP190 vector
DNA. OT11pvdS, the pMP190 promoter construct was transformed
into OT11pvdS (3) and assays were carried
out.
|
|
For the
pvdE promoter the smallest fragment to have promoter
activity extended from nucleotide

38 to +4. This fragment includes
the IS box (nucleotides

14 to

23) shown previously to be required
for promoter activity (
20). The inclusion of DNA to
nucleotide

76 resulted in higher levels of promoter activity, and
this was
further increased by inclusion of DNA to nucleotide

121.
This
suggests that DNA between nucleotides

76 and

55 and

121 to

95 may contain sequence elements that are important for complete
pvdE promoter activity. The

76 to

55 region contains the
second
divergent IS box sequence (nucleotides

61 to

52), and it may
be this element that contributes to increased promoter activity.
Larger
fragments extending further 5' and/or 3' than the

121/+4
fragment did
not produce significantly different

-Gal levels
(Fig.
3A),
indicating that all of the sequences necessary for
pvdE
promoter activity were located within the

121/+4 region.
None of the
fragments had significant promoter activity when the
bacteria were
grown in iron-rich medium, consistent with previous
studies on the
iron-regulated nature of this promoter (
11) and
indicating
that all promoter activity is PvdS
dependent.
Expression from the
pvdF promoter was abolished in a
pvdS mutant, OT11
pvdS, and was very greatly
reduced in iron-rich cells
in which transcription of
pvdS is
repressed (Fig.
3B). This showed
that
pvdF promoter activity
is also PvdS dependent. The two smallest
pvdF promoter
fragments examined had low-level promoter activities
in both
iron-deficient and iron-starved cells (Fig.
3B). These
levels of
expression were not iron regulated and so did not reflect
PvdS-dependent promoter activity, as
pvdS is not transcribed
in
iron-rich cells (
4). The smallest fragment to show
iron-regulated
promoter activity extended from nucleotide

51 to +1
(Fig.
3B).
This DNA contains a sequence (nucleotides

36 to

27)
similar
to the IS box element (Fig.
1) (
20). Further
increases in promoter
activity were observed with larger fragments, and
the data indicate
that sequences in the

72 to

51 and

282 to

91
regions contribute
to promoter activity. The

72 to

51 region
contains almost all
of the IS box sequence (nucleotides

65 to

74)
shown to be important
for activity of the divergent
pvdE
promoter (Fig.
3) (
20). Thus,
this element may contribute
to the activities of both promoters.
Expression from the
pvdF promoter was further increased by the
presence of DNA
downstream from the transcriptional start site
(nucleotides +1 to +34),
indicating that a sequence element in
this region is required for
maximal expression from this promoter.
A study of the PvdS-dependent
pvdA promoter also found that DNA
downstream from the +1
site is required for promoter activity
in
P. aeruginosa
(
8). However, DNA downstream from the
pvdE transcription start site, to nucleotide +195, did not increase
pvdE promoter activity (Fig.
3A); it remains to be seen
whether
other
pvd promoters need DNA elements downstream
from the transcription
start site for maximal activity. It should be
noted that DNA downstream
from nucleotide +1 is likely to be involved
in promoter recognition
by other extracytoplasmic-function (ECF) sigma
factor proteins.
DNA from nucleotide +50 to +120 of the
crtl
promoter (a CarQ-dependent
promoter) is required for promoter activity
(
10). PCR mutagenesis
of an ECF-dependent promoter from
Escherichia coli, p
fecA, revealed
that residues
clustered around the +13 site were required for
promoter function
(
1).
Mutations were introduced into the IS box elements by PCR mutagenesis
using a protocol developed by Datta (
5) (Fig.
1)
in order
to assess their involvement in promoter activity more
directly. The
mutated fragments were cloned into pMP190 in both
orientations, the
resulting constructs were transformed into
P. aeruginosa,
and the production of

-Gal was assayed (Fig.
3C and
D). Mutation of
the IS box nearest to
pvdE reduced
pvdE promoter
activity, consistent with a previous study (
20), but had
no
effect on
pvdF promoter activity (Fig.
3C and D, mutE).
The mutation
to the IS box nearest to
pvdF abolished
expression from the
pvdF promoter and also greatly reduced
expression from the
pvdE promoter
(Fig.
3C and D, mutF).
This indicates that this IS box is important
for expression from both
promoters.
In vitro analysis of PvdS-IS box interactions.
The above data,
in conjunction with earlier studies (8, 20), indicate the
critical role of IS box sequence elements in pvd promoter
function in P. aeruginosa. These promoters are PvdS dependent and therefore must contain a PvdS recognition sequence. Furthermore, we (4) and others (8, 17) have
previously shown that pvd promoters are active in E. coli, although only if the pvdS gene is present;
promoter constructs carrying the site-directed IS box mutations were
inactive in E. coli expressing pvdS (data not
shown). Collectively, these data lead to the hypothesis that the IS box
forms part of the DNA recognition sequence of the PvdS sigma factor. To
test this hypothesis, promoter fragments containing wild-type and
mutated IS box elements were used in in vitro transcription assays.
PvdS was purified as a His-tagged protein (hPvdS) and incubated with
core RNA polymerase and plasmid templates in an in vitro transcription
assay as described previously (27). Experiments were
carried out with the pvdD promoter, in which a mutation in
the IS box abolishes promoter activity (20), as well as
the pvdE and pvdF promoters. PvdS stimulated
transcription from the pvdD promoter but failed to stimulate
transcription from the pvdD promoter if the IS box had been
mutated (Fig. 4). Mutation of the IS box nearest to pvdE
(mutE) (Fig. 4) resulted in a reduction in PvdS-mediated transcription from the pvdE-pvdF promoter
fragment, and mutating the other IS box in this fragment (mutF) (Fig.
4) virtually eliminated PvdS-mediated transcription (Fig. 4). These data are consisted with the hypothesis that the IS box forms part of
the DNA recognition sequence of the PvdS sigma factor. They also
suggest that the IS box nearest pvdF is required for
PvdS-mediated expression from both of the divergent promoters, whereas
the pvdE-proximal IS box is required only for transcription
from one promoter. This is the same pattern as that found in vivo (Fig.
3C and D).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 4.
Activities of mutant promoter fragments in vitro with
purified PvdS protein. (A) Purified hPvdS was incubated with core RNA
polymerase and different plasmid templates as shown. Templates carried
wild-type promoter fragments (pvdD [nucleotides 96 to
+39] or pvdE-pvdF [ 121 to +4 of pvdE and 92
to +34 of pvdF]) or mutations in the IS box of the
pvdD promoter (pvdDmut), the
pvdE-proximal IS box (mutE), or the pvdF-proximal
IS box (mut F) (Fig. 1; Table 1); the mutation in the pvdD
IS box is the same as that described previously (20). The
rate of RNA production from each plasmid template was measured as
described previously (27). Error bars indicate standard
deviations. (B) Fold stimulation represents the ability of hPvdS to
stimulate activity above that of core enzyme with a pvd
promoter template minus the corresponding value obtained with a vector
template, calculated using the following equation (2, 27):
fold stimulation = [(hPvdS-core hPvdS only)/core
only]pUC::pvd template [(hPvdS-core hPvdS only)/core only]pUCvector
template.
|
|
Interactions between promoter fragments and the core-PvdS complex were
also analyzed using band shift assays. Core-PvdS bound
the
pvdD wild-type promoter fragment but failed to cause any
shifting
of the corresponding fragment containing a mutated IS box
(Fig.
5). For the
pvdE-pvdF
promoter fragment, a mutation in the
pvdE-proximal
IS box
(mutE) prevented binding of core-PvdS, indicating that
PvdS requires
this sequence to bind to the
pvdE-pvdF promoter
fragment.
Core-PvdS still retarded a
pvdE-pvdF promoter fragment
containing the
pvdF IS box mutation (mutF), although
slightly
less effectively than the wild-type promoter fragment,
suggesting
that this sequence is not essential for binding of the
protein
to the promoter fragments used in these experiments. Consistent
with these results, a fragment containing only the
pvdF IS
box
(nucleotides

72 to +34 of
pvdF) failed to bind
core-PvdS, whereas
a fragment containing only the
pvdE IS
box (nucleotides

38 to
+195 of
pvdE) still showed binding
by core-PvdS in gel shift assays
(data not shown). Collectively these
results indicate that PvdS
requires the presence of an IS box to enable
binding of RNA polymerase
at both the
pvdE-pvdF and
pvdD promoter fragments.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 5.
Band shift assays with hPvdS and mutant promoters. (A)
Band shift assays were carried out as described previously
(27). Core enzyme (3.4 pmol) was incubated with hPvdS (13 pmol) and digoxigenin-labeled DNA fragments containing either the
pvdD wild-type promoter fragment (nucleotides 96 to +39)
or a pvdD promoter fragment containing a mutation in the IS
box. Following electrophoresis and transfer to a nylon membrane, the
DNA-protein complexes were detected by immunoblotting with antibodies
against digoxigenin. (B) Core and hPvdS were incubated with the
wild-type pvdE-pvdF promoter fragment ( 121/+4 with respect
to the pvdE transcription start site) or with promoter
fragments containing a mutation in either the pvdE IS box
(mutE) or the pvdF-proximal IS box (mutF), as shown. The
positions of DNA-protein complexes are indicated by arrows.
|
|
It is surprising that the mutation in the
pvdE-proximal IS
box essentially abolished binding of core-PvdS to the promoter
fragment, as this mutation had no effect on expression from the
pvdF promoter (Fig.
3D). Similarly, the mutation in the
pvdF-proximal
IS box essentially abolished activity from
both promoters (Fig.
3C and D and 4), whereas it reduced but did not
prevent binding
of core-PvdS to the promoter fragment (Fig.
5). These
apparently
conflicting data may reflect differences in the use of
linearized
DNA fragments in band shift assays, instead of the
supercoiled
plasmid templates of the in vitro transcription and in vivo
studies,
or may be a consequence of complex interactions between the
two
divergent promoters. It may also be possible that a complex of
core-PvdS bound at the
pvdE IS box is more stable in the gel
shift
assay than the complex formed at the
pvdF IS box,
reflecting a
more stringent requirement of protein-DNA binding in this
assay
than in transcription
assays.
Investigation of two other promoters,
pvdY and
ptxR, that have been shown to require PvdS for activity
(
24,
25) reveals
that they also contain IS box-like
sequences (Table
2). Thus,
all promoters
that have been shown to be PvdS dependent contain
IS box sequences,
further supporting the proposition that this
sequence motif is
recognized by PvdS during initiation of transcription
from
pvd genes. For those promoters whose transcription sites
have been mapped, the IS box is at the

35 region of the promoter
(with the exception of the
pvdE promoter), consistent with
other
ECF family members, which tend to have a recognition motif
centered
at about

35 (
10,
16). The position of the
pvdE IS box, centered
at

19, is likely to be atypical and
a consequence of the divergent
and interacting natures of the
pvdE and
pvdF promoters.
In summary, characterization of the divergently transcribed
pvdE and
pvdF promoters has allowed the minimal
promoter regions
to be determined and emphasizes the involvement of the
IS box
sequence. Gel shift and in vitro transcription data very
strongly
suggest that PvdS recognizes the IS box in pyoverdine
promoters.
Further studies will be required to unravel the complex
protein-DNA
interactions that take place at these promoters as well as
to
identify and characterize the other sequence elements that
contribute
to the activity of these
promoters.
 |
ACKNOWLEDGMENTS |
We are grateful to members of the Lamont laboratory for their
comments on a preliminary version of the manuscript.
M.J.W. and B.J.M. were supported by postgraduate scholarships from the
Health Research Council of New Zealand. This work was supported in part
by a grant from the New Zealand Lotteries Health Research Board.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, University of Otago, P.O. Box 56, Dunedin, New
Zealand. Phone: 64 3 479 7869. Fax: 64 3 479 7866. E-mail:
iain.lamont{at}stonebow.otago.ac.nz.
Present address: Centre for Molecular Biology and Biotechnology,
University of Queensland, Brisbane, Queensland, Australia.
 |
REFERENCES |
| 1.
|
Angerer, A.,
S. Enz,
M. Ochs, and V. Braun.
1995.
Transcriptional regulation of ferric citrate transport in Escherichia coli K-12. FecI belongs to a new subfamily of 70-type factors that respond to extracytoplasmic stimuli.
Mol. Microbiol.
18:163-174[CrossRef][Medline].
|
| 2.
|
Burgess, R. R., and A. A. Travers.
1971.
Purification of the RNA polymerase sigma factor.
Methods Enzymol.
21:500-506[CrossRef].
|
| 3.
|
Casabadan, M. J., and S. N. Cohen.
1980.
Analysis of gene control signals by DNA fusion cloning in Escherichia coli cells.
J. Mol. Biol.
138:179-207[CrossRef][Medline].
|
| 4.
|
Cunliffe, H. E.,
T. R. Merriman, and I. L. Lamont.
1995.
Cloning and characterization of pvdS, a gene required for pyoverdine synthesis in Pseudomonas aeruginosa: PvdS is probably an alternative sigma factor.
J. Bacteriol.
177:2744-2750[Abstract/Free Full Text].
|
| 5.
|
Datta, A. K.
1995.
Efficient amplification using `megaprimer' by asymmetric polymerase chain reaction.
Nucleic Acids Res.
23:4530-4531[Free Full Text].
|
| 6.
|
King, E. O.,
M. K. Ward, and D. E. Raney.
1954.
Two simple media for the demonstration of pyocyanin and fluorescein.
J. Lab. Med.
44:301-307[Medline].
|
| 7.
|
Leong, J.
1986.
Siderophores: their biochemistry and possible role in the biochontrol of plant pathogens.
Annu. Rev. Plant. Phyt.
26:187-209.
|
| 8.
|
Leoni, L.,
A. Ciervo,
N. Orsi, and P. Visca.
1996.
Iron-regulated transcription of the pvdA gene in Pseudomonas aeruginosa: effect of Fur and PvdS on promoter activity.
J. Bacteriol.
178:2299-2313[Abstract/Free Full Text].
|
| 9.
|
Leoni, L.,
N. Orsi,
V. de Lorenzo, and P. Visca.
2000.
Functional analysis of PvdS, an iron starvation sigma factor of Pseudomonas aeruginosa.
J. Bacteriol.
182:1481-1491[Abstract/Free Full Text].
|
| 10.
|
Marinez-Argudo, I.,
R. M. Ruiz-Vazquez, and F. J. Murillo.
1998.
The structure of an ECF- -dependent, light-inducible promoter from the bacterium Myxococcus xanthus.
Mol. Microbiol.
30:883-893[CrossRef][Medline].
|
| 11.
|
McMorran, B. J.,
M. E. Merriman,
I. T. Rombel, and I. L. Lamont.
1996.
Characterisation of the pvdE gene which is required for pyoverdine synthesis in Pseudomonas aeruginosa.
Gene
176:55-59[CrossRef][Medline].
|
| 12.
|
McMorran, B. J.
1997.
Pyoverdine promoters from P. aeruginosa. Ph.D. thesis.
University of Otago, Dunedin, New Zealand.
|
| 13.
|
Merriman, T. E.,
M. E. Merriman, and I. L. Lamont.
1995.
Nucleotide sequence of pvdD, a pyoverdine biosynthetic gene from Pseudomonas aeruginosa: PvdD has similarity to peptide synthetases.
J. Bacteriol.
177:252-258[Abstract/Free Full Text].
|
| 14.
|
Meyer, J. M.,
A. Neely,
A. Stintzi,
C. Georges, and I. A. Holder.
1996.
Pyoverdin is essential for virulence of Pseudomonas aeruginosa.
Infect. Immun.
64:518-523[Abstract].
|
| 15.
|
Miller, J. H.
1972.
Experiments in molecular genetics, p. 352-355.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 16.
|
Missiakas, D., and S. Raina.
1998.
The extracytoplasmic function sigma factors: role and regulation.
Mol. Microbiol.
28:1059-1066[CrossRef][Medline].
|
| 17.
|
Miyazaki, H.,
H. Kato,
T. Nakazawa, and M. Tsuda.
1995.
A positive regulatory gene, pvdS, for expression of pyoverdin biosynthetic genes in Pseudomonas aeruginosa PAO.
Mol. Gen. Genet.
248:17-24[CrossRef][Medline].
|
| 18.
|
Ochsner, U. A.,
Z. Johnson,
I. L. Lamont,
H. E. Cunliffe, and M. L. Vasil.
1996.
Exotoxin A production in Pseudomonas aeruginosa requires the iron-regulated pvdS gene encoding an alternative sigma factor.
Mol. Microbiol.
21:1019-1028[CrossRef][Medline].
|
| 19.
|
Rombel, I. T., and I. L. Lamont.
1992.
DNA homology between siderophore genes from fluorescent Pseudomonads.
J. Gen. Microbiol.
138:181-187[Abstract/Free Full Text].
|
| 20.
|
Rombel, I. T.,
B. J. McMorran, and I. L. Lamont.
1995.
Identification of a DNA sequence motif required for expression of iron-regulated genes in Pseudomonads.
Mol. Gen. Genet.
246:519-528[CrossRef][Medline].
|
| 21.
|
Ronald, S.,
M. A. Farinha,
B. J. Allan, and A. M. Kropinski.
1992.
Cloning and physical mapping of transcriptional regulatory (sigma) factors from Pseudomonas aeruginosa, p. 249-257.
In
E. Gaili, S. Silver, and B. Witholt (ed.), Pseudomonas: molecular biology and biotechnology. American Society for Microbiology, Washington D.C.
|
| 22.
|
Spaink, H. P.,
R. J. H. Okker,
C. A. Wiffelman,
E. Pees, and B. J. J. Lugtenberg.
1987.
Promoters in the nodulation region of the Rhizobium leguminosarum Sym plasmid pRL1J1.
Plant Mol. Biol.
9:27-39.
|
| 23.
|
Stintzi, A.,
Z. Johnson,
M. Stonehouse,
U. Ochsner,
J. Meyer,
M. L. Vasil, and K. Poole.
1999.
The pvc gene cluster of Pseudomonas aeruginosa: role in synthesis of the pyoverdine chromphore and regulation of PtxR and PvdS.
J. Bacteriol.
181:4118-4124[Abstract/Free Full Text].
|
| 24.
|
Vasil, M. L.,
U. A. Ochsner,
Z. Johnson,
J. A. Colmer, and A. N. Hamood.
1998.
The Fur-regulated gene encoding the alternative sigma factor PvdS is required for iron-dependent expression of the LysR-type regulator PtxR in Pseudomonas aeruginosa.
J. Bacteriol.
180:6784-6788[Abstract/Free Full Text].
|
| 25.
|
Vasil, M. L., and U. A. Ochsner.
1999.
The response of Pseudomonas aeruginosa to iron: genetics, biochemistry and virulence.
Mol. Microbiol.
34:399-413[CrossRef][Medline].
|
| 26.
|
Visca, P.,
A. Ciervo, and N. Orsi.
1994.
Cloning and nucleotide sequence of the pvdA gene encoding the pyoverdine biosynthesis enzyme L-ornithine N5-oxygenase in Pseudomonas aeruginosa.
J. Bacteriol.
176:1128-1140[Abstract/Free Full Text].
|
| 27.
|
Wilson, M. J., and I. L. Lamont.
2000.
Characterisation of a ECF sigma factor protein from Pseudomonas aeruginosa.
Biochem. Biophys. Res. Commun.
273:578-583[CrossRef][Medline].
|
| 28.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[CrossRef][Medline].
|
Journal of Bacteriology, March 2001, p. 2151-2155, Vol. 183, No. 6
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.6.2151-2155.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shirley, M., Lamont, I. L.
(2009). Role of TonB1 in Pyoverdine-Mediated Signaling in Pseudomonas aeruginosa. J. Bacteriol.
191: 5634-5640
[Abstract]
[Full Text]
-
Davinic, M., Carty, N. L., Colmer-Hamood, J. A., San Francisco, M., Hamood, A. N.
(2009). Role of Vfr in regulating exotoxin A production by Pseudomonas aeruginosa. Microbiology
155: 2265-2273
[Abstract]
[Full Text]
-
Spencer, M. R., Beare, P. A., Lamont, I. L.
(2008). Role of Cell Surface Signaling in Proteolysis of an Alternative Sigma Factor in Pseudomonas aeruginosa. J. Bacteriol.
190: 4865-4869
[Abstract]
[Full Text]
-
Gaines, J. M., Carty, N. L., Tiburzi, F., Davinic, M., Visca, P., Colmer-Hamood, J. A., Hamood, A. N.
(2007). Regulation of the Pseudomonas aeruginosa toxA, regA and ptxR genes by the iron-starvation sigma factor PvdS under reduced levels of oxygen. Microbiology
153: 4219-4233
[Abstract]
[Full Text]
-
Agnoli, K., Lowe, C. A., Farmer, K. L., Husnain, S. I., Thomas, M. S.
(2006). The Ornibactin Biosynthesis and Transport Genes of Burkholderia cenocepacia Are Regulated by an Extracytoplasmic Function {sigma} Factor Which Is a Part of the Fur Regulon.. J. Bacteriol.
188: 3631-3644
[Abstract]
[Full Text]
-
Lamont, I. L., Martin, L. W., Sims, T., Scott, A., Wallace, M.
(2006). Characterization of a Gene Encoding an Acetylase Required for Pyoverdine Synthesis in Pseudomonas aeruginosa.. J. Bacteriol.
188: 3149-3152
[Abstract]
[Full Text]
-
Wilson, M. J., Lamont, I. L.
(2006). Mutational analysis of an extracytoplasmic-function sigma factor to investigate its interactions with RNA polymerase and DNA.. J. Bacteriol.
188: 1935-1942
[Abstract]
[Full Text]
-
Alice, A. F., Lopez, C. S., Lowe, C. A., Ledesma, M. A., Crosa, J. H.
(2006). Genetic and Transcriptional Analysis of the Siderophore Malleobactin Biosynthesis and Transport Genes in the Human Pathogen Burkholderia pseudomallei K96243. J. Bacteriol.
188: 1551-1566
[Abstract]
[Full Text]
-
Maunsell, B., Adams, C., O'Gara, F.
(2006). Complex regulation of AprA metalloprotease in Pseudomonas fluorescens M114: evidence for the involvement of iron, the ECF sigma factor, PbrA and pseudobactin M114 siderophore. Microbiology
152: 29-42
[Abstract]
[Full Text]
-
Gaines, J. M., Carty, N. L., Colmer-Hamood, J. A., Hamood, A. N.
(2005). Effect of static growth and different levels of environmental oxygen on toxA and ptxR expression in the Pseudomonas aeruginosa strain PAO1. Microbiology
151: 2263-2275
[Abstract]
[Full Text]
-
Nouwens, A. S., Beatson, S. A., Whitchurch, C. B., Walsh, B. J., Schweizer, H. P., Mattick, J. S., Cordwell, S. J.
(2003). Proteome analysis of extracellular proteins regulated by the las and rhl quorum sensing systems in Pseudomonas aeruginosa PAO1. Microbiology
149: 1311-1322
[Abstract]
[Full Text]
-
Enz, S., Mahren, S., Menzel, C., Braun, V.
(2003). Analysis of the Ferric Citrate Transport Gene Promoter of Escherichia coli. J. Bacteriol.
185: 2387-2391
[Abstract]
[Full Text]
-
de Chial, M., Ghysels, B., Beatson, S. A., Geoffroy, V., Meyer, J. M., Pattery, T., Baysse, C., Chablain, P., Parsons, Y. N., Winstanley, C., Cordwell, S. J., Cornelis, P.
(2003). Identification of type II and type III pyoverdine receptors from Pseudomonas aeruginosa. Microbiology
149: 821-831
[Abstract]
[Full Text]
-
Lamont, I. L., Martin, L. W.
(2003). Identification and characterization of novel pyoverdine synthesis genes in Pseudomonas aeruginosa. Microbiology
149: 833-842
[Abstract]
[Full Text]
-
Redly, G. A., Poole, K.
(2003). Pyoverdine-Mediated Regulation of FpvA Synthesis in Pseudomonas aeruginosa: Involvement of a Probable Extracytoplasmic-Function Sigma Factor, FpvI. J. Bacteriol.
185: 1261-1265
[Abstract]
[Full Text]
-
Bultreys, A., Gheysen, I., Wathelet, B., Maraite, H., de Hoffmann, E.
(2003). High-Performance Liquid Chromatography Analyses of Pyoverdin Siderophores Differentiate among Phytopathogenic Fluorescent Pseudomonas Species. Appl. Environ. Microbiol.
69: 1143-1153
[Abstract]
[Full Text]
-
Wei, B., Huang, T., Dalwadi, H., Sutton, C. L., Bruckner, D., Braun, J.
(2002). Pseudomonas fluorescens Encodes the Crohn's Disease-Associated I2 Sequence and T-Cell Superantigen. Infect. Immun.
70: 6567-6575
[Abstract]
[Full Text]
-
Hunt, T. A., Peng, W.-T., Loubens, I., Storey, D. G.
(2002). The Pseudomonas aeruginosa alternative sigma factor PvdS controls exotoxin A expression and is expressed in lung infections associated with cystic fibrosis. Microbiology
148: 3183-3193
[Abstract]
[Full Text]
-
Ambrosi, C., Leoni, L., Visca, P.
(2002). Different Responses of Pyoverdine Genes to Autoinduction in Pseudomonas aeruginosa and the Group Pseudomonas fluorescens-Pseudomonas putida. Appl. Environ. Microbiol.
68: 4122-4126
[Abstract]
[Full Text]
-
Lamont, I. L., Beare, P. A., Ochsner, U., Vasil, A. I., Vasil, M. L.
(2002). Siderophore-mediated signaling regulates virulence factor production in Pseudomonasaeruginosa. Proc. Natl. Acad. Sci. USA
99: 7072-7077
[Abstract]
[Full Text]
-
Wilderman, P. J., Vasil, A. I., Johnson, Z., Wilson, M. J., Cunliffe, H. E., Lamont, I. L., Vasil, M. L.
(2001). Characterization of an Endoprotease (PrpL) Encoded by a PvdS-Regulated Gene in Pseudomonas aeruginosa. Infect. Immun.
69: 5385-5394
[Abstract]
[Full Text]