 |
TEXT |
Mycobacteria are obligate aerobes;
i.e., they require oxygen for growth. However, it has been known for
years that tubercle bacilli encounter hypoxic environments in acute
disease, as well as in latent infection (32, 34, 39, 40,
45), and the capability of tubercle bacilli to adapt to hypoxic
conditions appears to play a role in vivo (3, 29, 49).
Wayne established a link between oxygen starvation and drug resistance.
That author demonstrated that upon depletion of oxygen in culture, the
bacillus terminates growth and develops into a defined dormant form
(41-43, 47). Importantly, the dormant form of the
bacterium was found to be resistant against conventional
antimycobacterials (46, 47). Hence, hypoxic dormant
bacteria could, at least in part, be responsible for the observed
persistence of the pathogen during chemotherapy (11).
To study the dormancy response in tubercle bacilli, we applied the
dormancy culture system that was developed by Wayne for Mycobacterium tuberculosis (47) to the
attenuated BCG Pasteur ATCC 35734 strain of M. bovis
(19, 20, 24, 31). Wayne's dormancy culture system is
based on growth of the bacilli under oxygen-limited conditions in
sealed tubes with stirring. Initially, the cultures grow exponentially
and consume oxygen rapidly. A temporal oxygen gradient is generated,
and the cultures terminate growth when the oxygen concentration reaches
a hypoxic threshold level. The bacilli in the hypoxic stationary phase
are in a reversible, apparently diploid, synchronized state of low
metabolic activity, in which the cells maintain viability for extended
periods without division (24, 47); i.e., the organisms are
in a physiological state of dormancy, as defined by Kaprelyants et al.
(22).
Our knowledge of the molecules involved in the mycobacterial dormancy
response is fragmentary (5, 15, 17, 18, 26, 30, 37).
Elegant biochemical work showed that dormant bacilli adapt their
metabolism to anaerobiosis by switching to nitrate respiration
(48) and reductive amination of glyoxylate
(44). Genetic analysis demonstrated that the stringent
response plays a crucial role in the adaptation to hypoxic
stationary-phase survival (33). However, only a single
polypeptide, the
-crystallin homolog, has been shown to be
up-regulated in oxygen-starved tubercle bacilli (7, 38, 51,
52). The induction of this chaperon appears to be under control
of the sigma factor SigF (4, 9, 10, 25). In this study,
the dormancy response in BCG was analyzed using two-dimensional gel
electrophoresis (21) to identify new dormancy-induced proteins.
Detection and identification of dormancy-induced proteins.
Figure 1 (solid circles) shows the growth
curve of BCG in the Wayne dormancy culture system. Bacilli were
harvested at various time points (Fig. 1, arrows A to D); washed twice
in phosphate-buffered saline; resuspended in lysis buffer containing 9 M urea, 4%
3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS),
50 mM dithiothreitol, pefabloc at 1 mg ml
1, pepstatin at
1 µg ml
1, and leupeptin at 1 µg ml
1;
and disrupted with 0.5-mm glass beads using a Mini Bead Beater (Biospec). Protein concentrations were determined using the Bio-Rad protein assay reagents and protocols. A 100-µg sample of total protein was subjected to isoelectric focusing using pH 4 to 7 Immobiline Dry Strips and an IPGphor isoelectric focusing unit as
recommended by the manufacturer (Amersham Pharmacia) for 62,000 V-h.
For separation in the second dimension, sodium dodecyl sulfate-12.5% polyacrylamide gels were used (Protean IIxi system; Bio-Rad) and proteins were detected by silver staining. Figure
2 shows a representative set of
two-dimensional gels. Four proteins showed a drastic increase in their
steady-state level in the hypoxic stationary phase (Fig. 2, arrows 1 to
4). The proteins were not (arrows 1, 2, and 4) or weakly (arrow 3)
detectable in the extracts from exponentially growing cultures (Fig.
2A) and appeared as major spots immediately upon oxygen
starvation-induced termination of growth (Fig. 2B). Elevated levels of
the proteins were maintained throughout the hypoxic stationary phase
(Fig. 2C and D). To identify the dormancy-induced proteins, the excised
gel spots were subjected to in-gel digestion with trypsin to recover
the peptides (36). Peptide sequence tags were generated
from selected peptides by nanoelectrospray tandem mass spectrometry
using a quadrupole-time-of-flight hybrid instrument (QSTAR; PE Sciex).
Protein identity was revealed by searching sequence databases with a
combination of the peptide sequence tags and the mass information
(27, 50). Protein 1 was the
-crystallin homolog
(Rv2031c) previously reported to be induced in oxygen-starved cultures
of tubercle bacilli (51). Protein 2 was the 23-kDa
putative response regulator Rv3133c. Proteins 3 and 4 were the 32-kDa
conserved hypothetical protein Rv2623 and the 16-kDa conserved
hypothetical protein Rv2626c, respectively. (Protein names and Rv
numbers are according to the M. tuberculosis H37Rv genome
annotation [6].)

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Growth of BCG in the Wayne dormancy culture system and
in aerated roller bottles. Solid circles show the growth curve of BCG
under the oxygen-limited conditions of the Wayne dormancy culture
system. Aerobic exponential precultures were diluted to an
A600 of 0.005 with Dubos Tween-albumin broth
(Difco) and grown in sealed tubes (2 by 12.5 cm; 17-ml culture volume)
under gentle stirring at 170 rpm as described previously (12,
24). Anaerobiosis in the stationary phase was monitored using
the redox indicator methylene blue (24). Empty circles
show the growth curve of BCG under non-oxygen-limited conditions in
roller bottles. Precultures were diluted to an
A600 of 0.05 and grown in roller bottles (10 by
14 cm; 100-ml culture volume). Cultures were aerated in a roller
apparatus at 1 rpm. The roller bottles were opened daily for turbidity
measurements and to allow exchange of the air. Mean values and standard
deviations from four independent experiments are shown. Arrows indicate
the time points when samples were taken for protein and RNA analyses.
|
|

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 2.
Temporal profile of protein contents of BCG grown in the
Wayne dormancy culture system. Protein extracts were prepared at the
time points (A to D) indicated by the arrows in Fig. 1. Samples (100 µg) of total protein were prepared from 100 ml of culture at
time point A and 35 to 50 ml of culture at time points B to D
and were subjected to two-dimensional electrophoresis. Panels A to D
show silver-stained gels corresponding to the four time points. Arrows
1 to 4 indicate dormancy-induced protein spots. The arrowhead shows the
22-kDa alkyl hydroperoxide reductase (AhpC, Rv2428; 6, 35) which was
found to be down-regulated in the hypoxic stationary phase. Molecular
masses (MW) are indicated in kilodaltons. The experiment was carried
out four times with the same results. Growth phase-dependent protein
contents were also analyzed using isoelectric focusing strips at pHs 3 to 10. No additional dormancy-induced proteins were detected.
|
|
Transcript levels of dormancy-induced proteins.
To determine
whether the increase in the steady-state level of the dormancy-induced
proteins correlates with an increase in the steady-state level of their
mRNAs, total RNA was isolated from exponentially growing and hypoxic
stationary-phase cultures and subjected to Northern blot analysis as
previously described (19). Probes were isolated by PCR
using BCG genomic DNA as the template. The primers were derived from
the M. tuberculosis H37Rv genome sequence (6)
and were as follows: 1,
-crystallin homolog (GCCACCACCCTTCCCGTTCAG [nucleotides 4 to 24] and
ATGTCGTCCTCGTCAGCACCTACC [nucleotides 315 to 338]); 2, Rv3133c (TCGTAGGTGTAGGCGGGTTC [nucleotides 86 to 104] and
CGGCGATCTGCTTGTTGGT [nucleotides 496 to 514]); 3, Rv2623
(GGCAGCCGTTCCCACATTG [nucleotides 294 to 312] and
GGCTGATCGCGCACCACCAC [nucleotides 715 to 734]); 4, Rv2626c
(CCACCGCACGCGACATCAT [nucleotides 5 to 23] and
CGGAACACGGCGGACCTG [nucleotides 292 to 309]); 5, 16S rRNA
(GCCTGGGAAACTGGGTCTAA [nucleotides 149 to 168] and
TCTCCACCTACCGTCAATCC [nucleotides 467 to 486]). (The
numbers in brackets specify the primer positions in the coding
sequences of the respective genes.) The identities of the PCR fragments
were confirmed by sequencing using a Perkin-Elmer ABI Prism 377 automated sequencer. Figure 3 shows high
levels of the transcripts for all four proteins in dormant bacilli. In
exponentially growing cultures, the transcripts were not or only weakly
detectable. The dormancy-dependent increase in the mRNA levels was
confirmed by reverse transcription-PCR analysis (Fig. 3). The primers
used were the same as the primers employed to generate the probes for
the Northern analysis. Reactions were performed using an Omniscript RT
kit and a Taq polymerase kit (Qiagen) as recommended by the
supplier. PCR amplification was carried out for 25 cycles. Taken
together, these results show that the mRNA levels correlate with the
protein levels and indicate that the level of the dormancy-induced
proteins is regulated at the transcriptional level.

View larger version (93K):
[in this window]
[in a new window]
|
FIG. 3.
Steady-state levels of mRNAs encoding dormancy-induced
proteins in growing and dormant cultures. Autoradiograms of Northern
blots of total RNA from exponentially growing (lanes A, from time point
A in Fig. 1) and hypoxic stationary-phase cultures (lanes D, from time
point D in Fig. 1) grown in the Wayne dormancy culture system are
shown. The blots were hybridized with
[ -32P]dATP-labeled probes specific to the transcripts
encoding the dormancy-induced proteins: 1, -crystallin homolog; 2, 23-kDa response regulator; 3, 32-kDa conserved hypothetical protein; 4, 16-kDa conserved hypothetical protein. X-ray films were exposed for 1 day. Sizes are indicated in bases. 16S rRNA shows the blots after
rehybridization with a probe specific to 16S rRNA, demonstrating equal
loading of rRNA. Five micrograms of total RNA (prepared from 20 ml
of culture at time point A and from 35 ml of culture at time point
D) was loaded. At the bottom, the agarose gel electrophoretic analysis
of reverse transcriptase (RT) PCRs carried out with primers specific to
the dormancy-induced genes and 150 ng of total RNA is shown. Carrying
out the identical reactions but without the reverse transcription step
did not yield any bands, demonstrating that the bands generated by
reverse transcriptase PCR were derived from RNA and not from
contaminating genomic DNA. A control PCR with genomic DNA yielded bands
of the same size observed for the reverse transcriptase PCRs. Reverse
transcriptase PCRs with primers specific to 16S rRNA yielded bands of
the same intensity independent of the RNA sample; thus confirming equal
loading of total RNA into the reverse transcriptase reactions (data not
shown). All experiments were repeated once, yielding the same results.
The values on the right are numbers of nucleotides.
|
|
It should be noted that the up-regulation of the steady-state level of
the
-crystallin homolog mRNA in an oxygen-starved dormant culture is
in apparent contradiction to the results obtained by Hu and Coates
(16). Those authors observed a down-regulation of the
transcript in nonagitated cultures of the tubercle bacillus. This
discrepancy might be due to the different culture system used by those
investigators (14).
Analysis of dormancy-induced proteins in aerated stationary-phase
cultures.
Next, we determined whether the induction of the four
proteins is specific to the hypoxic stationary-phase cultures generated in the Wayne dormancy culture model, as opposed to aerated
stationary-phase cultures. Figure 1 (empty circles) shows the growth
curve of BCG in agitated roller bottles. Bacilli were harvested at
various time points (Fig. 1, arrows A to D), and 100 µg of total
protein was subjected to two-dimensional gel electrophoresis as
described above. Figure 4 shows a
representative set of gels. The
-crystallin homolog and the 16-kDa
conserved hypothetical protein were found to be induced in aerated
stationary-phase cultures. The two proteins were not detectable in
exponentially growing roller bottle cultures and appeared as major
spots immediately upon termination of growth (Fig. 4, arrows 1 and 4).
Thus, induction of the
-crystallin homolog and the 16-kDa conserved
hypothetical protein was not specific to the hypoxic dormant culture.
In contrast, the 23-kDa response regulator was not detectable in
aerated stationary-phase cultures (Fig. 4, arrow 2) and the 32-kDa
hypothetical protein maintained a level that was similar to its level
in an exponentially growing culture (Fig. 4, arrow 3). Thus, the
induction of the 23-kDa response regulator and the 32-kDa hypothetical
protein appears to be specific to the dormancy response. These results are consistent with a previous analysis of the protein contents of
aerated stationary-phase cultures employing two-dimensional gel
electrophoresis carried out by Barry and coworkers (51). Those authors found one protein, the
-crystallin homolog, to be
strongly up-regulated in stationary-phase cultures of the tubercle bacillus grown in roller bottles. However, up-regulation of the16-kDa conserved hypothetical protein was not reported. This might be due to
the parameters used by the investigators for separation of the proteins
in the second dimension. The
-crystallin homolog migrated at the
bottom of their gels. Our studies show that the 16-kDa conserved
hypothetical protein migrates below the
-crystallin homolog (Fig. 4,
arrows 1 and 4). Hence, the 16-kDa conserved hypothetical protein might
have migrated out of the gel under the running conditions employed by
those authors.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 4.
Steady-state levels of dormancy-induced proteins in
aerated roller bottle cultures. Protein extracts were prepared at the
time points (A to D) indicated by the arrows in Fig. 1. Samples of
total protein (100 µg) were prepared from 25 ml of culture at time
point A and 10 to 15 ml of culture at time points B to D and were
subjected to two-dimensional electrophoresis. Panels A to D show
silver-stained gels corresponding to the four time points. Arrows 1 to
4 indicate the migration areas of the dormancy-induced protein spots
shown in Fig. 2. The arrowhead shows the 22-kDa alkyl hydroperoxide
reductase found to be down-regulated in the aerated stationary phase.
Molecular masses (MW) are indicated in kilodaltons. The experiment was
carried out four times with the same results.
|
|
Conclusions.
In the present work, we identified four proteins
that were markedly up-regulated in hypoxic stationary-phase cultures of
BCG generated in the Wayne dormancy model. The increase in the
steady-state level of the dormancy-induced proteins correlated with an
increase in the steady-state level of their transcripts, suggesting
transcriptional control of gene expression. To determine whether
up-regulation of the four proteins was specific to the oxygen
depletion-induced stationary phase, the protein contents of aerated
stationary-phase cultures were analyzed. The
-crystallin homolog and
the 16-kDa conserved hypothetical protein were found to be induced in
aerated stationary-phase cultures. This indicates that induction of the two proteins is not specific to dormant bacilli. In contrast, the
23-kDa putative response regulator was not detectable in aerated stationary-phase cultures. The 32-kDa conserved hypothetical protein was found to maintain a level that was similar to its level observed in
exponentially growing culture. This suggests that the expression of the
two molecules is not up-regulated upon termination of growth per se.
Rather, low oxygen tension appears to be required to increase the level
of these proteins. To determine whether hypoxic conditions alone
(without concurrent termination of growth) are sufficient to induce the
level of the 23-kDa putative response regulator and the 32-kDa
conserved hypothetical protein, contents of cultures grown under mild
hypoxic conditions that allow ongoing replication have to be analyzed.
The up-regulation of the four proteins in dormant bacilli suggests that
they play roles in development of the dormant state and/or maintenance
of viability during dormancy. What could their functions be? The
-crystallin homolog belongs to the 20-kDa small heat shock protein
family and was shown to possess a chaperon function ascribed to other
members of the family. Hence, the
-crystallin homolog could play a
role in enhancing long-term protein stability and, therefore, long-term
survival of bacilli (51). The three new dormancy-induced
proteins were predicted by the M. tuberculosis H37Rv genome
project (6). However, biochemical or genetic data for
these proteins are not available. Two of the three new dormancy-induced proteins are annotated as "conserved hypothetical proteins"
(6). To predict the domain architecture of these proteins,
their sequence (derived from M. tuberculosis H37Rv genome
database TubercuList [Institut Pasteur, Paris, France;
http://genolist.pasteur.fr/TubercuList/] data release R2) was searched
against the protein domain families database Pfam (Sanger Centre
[http://www.sanger.ac.uk/Software/Pfam/]; version 5.5; 2). The
similarity search suggested that the 32-kDa conserved hypothetical
protein contains two universal stress protein domains (accession number
PF00582). This domain is found in the UspA protein in Escherichia
coli. UspA is up-regulated in stationary-phase cultures and plays
a role in the survival of growth-arrested cells (13).
Thus, it is tempting to speculate that the 32-kDa mycobacterial protein
plays a role in survival during dormancy in tubercle bacilli. However,
it is important to note that the 32-kDa protein is different from UspA
in that it is twice the size and the universal stress protein domain is
repeated twice within the molecule. The 16-kDa conserved hypothetical
protein was predicted to contain two cystathionine beta synthase (CBS)
domains (accession number PF00571). This recently discovered domain is
named after the enzyme where it was originally identified
(1). The domain is usually present as a pair, and this CBS
domain dimer associates to form a single compact structure. Pairs of
CBS domains are found in a large number of functionally diverse
proteins, such as inosine-monophosphate dehydrogenases and chloride
channels (1). Although the role of the CBS domain in these
proteins is unclear, it may be involved in protein-protein interaction
and protein regulation. In contrast to these proteins that contain a
pair of CBS domains in the context of other, unrelated domains, the
16-kDa conserved hypothetical mycobacterial protein appears to consist
of only a pair of CBS domains not fused to other domains.
Most intriguing is the apparently dormancy-specific up-regulation of
the 23-kDa putative response regulator. This molecule contains a
helix-turn-helix DNA binding domain of the LuxR family and is thus
likely to act as a phosphorylation-dependent transcription factor
(6). Response regulators, together with their respective sensor histidine protein kinase, are part of two-component signal transduction systems and play key roles in a variety of developmental and adaptive processes in bacteria (23). Thus, it is
conceivable that the 23-kDa response regulator plays a role in the
control of the mycobacterial dormancy response. Inspection of the
genomic locus surrounding the gene encoding the 23-kDa response
regulator in M. tuberculosis H37Rv showed that the gene
appears to form an operon with the gene for Rv3132c, which is a
putative sensor histidine protein kinase (6). A recent
transcriptional analysis of the gene locus suggests that the two genes
are indeed cotranscribed (8). The genomic organization in
BCG is the same (C.B. and T.D., unpublished data), which could indicate
that this putative kinase represents the sensor involved in the control
of the activity of the dormancy-induced 23-kDa response regulator.
Based on the likely cotranscription of the two genes, one might expect
dormancy-dependent coinduction of the two proteins. However, inspection
of the predicted migration area of the histidine kinase based on its
theoretical isoelectric point (pH 4.8) and molecular mass (62 kDa)
(6) did not reveal any dormancy-dependent protein spot
(Fig. 2). Whether the failure to detect up-regulation of the histidine
kinase on two-dimensional gels might be due to masking of the kinase by other proteins remains to be elucidated by the employment of
higher-resolution two-dimensional gels or kinase-specific antibodies.
Two-component systems work by phosphorylation of the response
regulator. Why is it, then, that the steady-state level of the 23-kDa
response regulator is increased upon entry into dormancy? This
phenomenon is found in numerous two-component systems. Conditions that
lead to elevated phosphorylation levels of the response regulator cause
a concomitant increase in its expression. One example is Spo0A, the
master regulator of sporulation in Bacillus subtilis (28). The response regulator mediates its own
up-regulation when the environment signals initiation of this
developmental process. It appears that the high phosphorylated response
regulator levels needed to initiate the developmental process are not
present until a threshold level of the stimulus signals autoactivation and thus amplification of the signal transduction apparatus. In this
manner, autoactivation ensures that the program is not initiated inappropriately and allows a rapid response once the appropriate conditions prevail. Whether positive autoregulation is also the mechanism underlying the dormancy-dependent up-regulation of the 23-kDa
response regulator remains to be elucidated. Genetic analyses are under
way to determine the functional roles of the response regulator, its
candidate histidine kinase, and the two conserved hypothetical proteins
in the dormancy response of tubercle bacilli.
We thank Alice Tay, Institute of Molecular and Cell Biology (IMCB)
Genome Analysis and Sequencing Laboratory: for the DNA sequence
analysis. We thank Bernadette Murugasu-Oei and Amanda Lim for comments
on the manuscript.
| 1.
|
Bateman, A.
1997.
The structure of a domain common to archaebacteria and the homocystinuria disease protein.
Trends Biochem. Sci.
22:12-13[Medline].
|
| 2.
|
Bateman, A.,
E. Birney,
R. Durbin,
S. R. Eddy,
K. L. Howe, and E. L. L. Sonnhammer.
2000.
The Pfam protein families database.
Nucleic Acids Res.
28:263-266[Abstract/Free Full Text].
|
| 3.
|
Bishai, W. R.
2000.
Lipid lunch for a persistent pathogen.
Nature
406:683-685[CrossRef][Medline].
|
| 4.
|
Chen, P.,
R. E. Ruiz,
Q. Li,
R. F. Silver, and W. R. Bishai.
2000.
Construction and characterization of a Mycobacterium tuberculosis mutant lacking the alternate sigma factor gene, sigF.
Infect. Immun.
68:5575-5580[Abstract/Free Full Text].
|
| 5.
|
Chen, P.,
J. Gomez, and W. R. Bishai.
2000.
Mycobacterial transcription regulation in stationary phase, p. 149-156.
In
G. F. Hatful, and W. R. Jacobs, Jr. (ed.), Molecular genetics of mycobacteria American Society for Microbiology, Washington, D.C.
|
| 6.
|
Cole, S. T.,
R. Brosch,
J. Parkhill,
T. Garnier,
C. Churcher,
D. Harris,
S. V. Gordon,
K. Eiglmeier,
S. Gas,
C. E. Barry, 3rd,
F. Tekaia,
K. Badcock,
D. Basham,
D. Brown,
T. Chillingworth,
R. Connor,
R. Davies,
K. Devlin,
T. Feltwell,
S. Gentles,
N. Hamlin,
S. Holroyd,
T. Hornsby,
K. Jagels,
A. Krogh,
J. McLean,
S. Moule,
L. Murphy,
K. Oliver,
J. Osborne,
M. A. Quail,
M. A. Rajandream,
J. Rogers,
S. Rutter,
K. Seeger,
J. Skelton,
S. Squares,
R. Squares,
J. E. Sulston,
K. Taylor,
S. Whitehead, and B. G. Barrell.
1998.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature
393:537-544[CrossRef][Medline].
|
| 7.
|
Cunningham, A. F., and C. L. Spreadbury.
1998.
Mycobacterial stationary phase induced by low oxygen tension: cell wall thickening and localization of the 16-kilodalton -crystallin homolog.
J. Bacteriol.
180:801-808[Abstract/Free Full Text].
|
| 8.
|
Dasgupta, N.,
V. Kapur,
K. K. Singh,
T. K. Das,
S. Sachdeva,
K. Jyothisri, and J. S. Tyagi.
2000.
Characterization of a two-component system, devR-devS, of Mycobacterium tuberculosis.
Tuber. Lung Dis.
803:141-159.
|
| 9.
|
DeMaio, J.,
Y. Zhang,
C. Ko,
D. B. Young, and W. R. Bishai.
1996.
A stationary-phase stress-response sigma factor from Mycobacterium tuberculosis.
Proc. Natl. Acad. Sci. USA
93:2790-2794[Abstract/Free Full Text].
|
| 10.
|
DeMaio, J.,
Y. Zhang,
C. Ko, and W. R. Bishai.
1997.
Mycobacterium tuberculosis sigF is part of a gene cluster with similarities to the Bacillus subtilis sigF and sigB operons.
Tuber. Lung Dis.
78:3-12[CrossRef][Medline].
|
| 11.
|
Dick, T.
2001.
Dormant tubercle bacilli: the key to more effective TB chemotherapy?
J. Antimicrob. Chemother.
47:117-118[Free Full Text].
|
| 12.
|
Dick, T.,
B. H. Lee, and B. Murugasu-Oei.
1998.
Oxygen depletion induced dormancy in Mycobacterium smegmatis.
FEMS Microbiol. Lett.
163:159-164[CrossRef][Medline].
|
| 13.
|
Diez, A.,
N. Gustavsson, and T. Nystrom.
2000.
The universal stress protein A of Escherichia coli is required for resistance to DNA damaging agents and is regulated by a RecA/FtsK-dependent regulatory pathway.
Mol. Microbiol.
36:1494-1503[CrossRef][Medline].
|
| 14.
|
Hu, Y. M.,
P. D. Butcher,
K. Sole,
D. A. Mitchison, and A. R. M. Coates.
1998.
Protein synthesis is shutdown in dormant Mycobacterium tuberculosis and is reversed by oxygen or heat shock.
FEMS Microbiol. Lett.
158:139-145[CrossRef][Medline].
|
| 15.
|
Hu, Y., and A. R. M. Coates.
1999.
Transcription of two sigma 70 homologue genes, sigA and sigB, in stationary-phase Mycobacterium tuberculosis.
J. Bacteriol.
181:469-476[Abstract/Free Full Text].
|
| 16.
|
Hu, Y., and A. R. M. Coates.
1999.
Transcription of the stationary-phase-associated hspX gene of Mycobacterium tuberculosis is inversely related to synthesis of the 16-kilodalton protein.
J. Bacteriol.
181:1380-1387[Abstract/Free Full Text].
|
| 17.
|
Hu, Y.,
P. D. Butcher,
J. A. Mangan,
M. A. Rajandream, and A. R. M. Coates.
1999.
Regulation of hmp gene transcription in Mycobacterium tuberculosis: effects of oxygen limitation and nitrosative and oxidative stress.
J. Bacteriol.
181:3486-3493[Abstract/Free Full Text].
|
| 18.
|
Hu, Y.,
J. A. Mangan,
J. Dhillon,
K. M. Sole,
D. A. Mitchison,
P. D. Butcher, and A. R. Coates.
2000.
Detection of mRNA transcripts and active transcription in persistent Mycobacterium tuberculosis induced by exposure to rifampin or pyrazinamide.
J. Bacteriol.
182:6358-6365[Abstract/Free Full Text].
|
| 19.
|
Hutter, B., and T. Dick.
1999.
Upregulation of narX, encoding a putative `fused nitrate reductase' in anaerobic dormant Mycobacterium bovis BCG.
FEMS Microbiol. Lett.
178:63-69[CrossRef][Medline].
|
| 20.
|
Hutter, B., and T. Dick.
2000.
Analysis of the dormancy-inducible narK2 promoter in Mycobacterium bovis BCG.
FEMS Microbiol. Lett.
188:141-146[CrossRef][Medline].
|
| 21.
|
Jungblut, P. R.,
U. E. Schaible,
H.-J. Mollenkopf,
U. Zimny-Arndt,
B. Raupach,
J. Mattow,
P. Halada,
S. Lamer,
K. Hagens, and S. H. E. Kaufman.
1999.
Comparative proteome analysis of Mycobacterium tuberculosis and Mycobacterium bovis BCG strains: towards functional genomics of microbial pathogens.
Mol. Microbiol.
33:1103-1117[CrossRef][Medline].
|
| 22.
|
Kaprelyants, A. S.,
J. C. Gottschal, and D. B. Kell.
1993.
Dormancy in non-sporulating bacteria.
FEMS Microbiol. Rev.
104:271-286[CrossRef].
|
| 23.
|
Lengeler, J. W., and P. W. Postma.
1999.
Global regulatory networks and signal transduction pathways, p. 491-523.
In
J. W. Lengeler, G. Drews, and H. G. Schlegel (ed.), Biology of the prokaryotes. Thieme, Stuttgart, Germany.
|
| 24.
|
Lim, A.,
M. Eleuterio,
B. Hutter,
B. Murugasu-Oei, and T. Dick.
1999.
Oxygen depletion induced dormancy in Mycobacterium bovis BCG.
J. Bacteriol.
181:2252-2256[Abstract/Free Full Text].
|
| 25.
|
Manabe, Y. C.,
J. M. Chen,
C. G. Ko,
P. Chen, and W. R. Bishai.
1999.
Conditional sigma factor expression, using the inducible acetamidase promoter, reveals that the Mycobacterium tuberculosis sigF gene modulates expression of the 16-kilodalton alpha-crystallin homologue.
J. Bacteriol.
181:7629-7633[Abstract/Free Full Text].
|
| 26.
|
Manganelli, R.,
E. Dubnau,
S. Tyagi,
F. R. Kramer, and I. Smith.
1999.
Differential expression of 10 sigma factor genes in Mycobacterium tuberculosis.
Mol. Microbiol.
31:715-724[CrossRef][Medline].
|
| 27.
|
Mann, M., and M. Wilm.
1994.
Error-tolerant identification of peptides in sequence databases by peptide sequence tags.
Anal. Chem.
66:4390-4399[Medline].
|
| 28.
|
Marahiel, M. A., and P. Zuber.
1999.
Sporulation and cell differentiation, p. 586-601.
In
J. W. Lengeler, G. Drews, and H. G. Schlegel (ed.), Biology of the prokaryotes. Thieme, Stuttgart, Germany.
|
| 29.
|
McKinney, J. D.,
K. Hoener zu Bentrup,
E. J. Munoz-Elias,
A. Miczak,
B. Chen,
W. T. Chan,
D. Swenson,
J. C. Sacchettini,
W. R. Jacobs, Jr., and D. G. Russell.
2000.
Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase.
Nature
406:735-738[CrossRef][Medline].
|
| 30.
|
Mizrahi, V.,
S. S. Dawes, and H. Rubin.
2000.
DNA replication, p. 159-172.
In
G. F. Hatful, and W. R. Jacobs Jr (ed.), Molecular genetics of mycobacteria. American Society for Microbiology, Washington, D.C.
|
| 31.
|
Murugasu-Oei, B., and T. Dick.
2000.
Bactericidal activity of nitrofurans on growing and dormant Mycobacterium bovis BCG.
J. Antimicrob. Chemother.
46:917-919[Abstract/Free Full Text].
|
| 32.
|
Parrish, N. M.,
J. D. Dick, and W. R. Bishai.
1998.
Mechanisms of latency in Mycobacterium tuberculosis.
Trends Microbiol.
6:107-112[CrossRef][Medline].
|
| 33.
|
Primm, T. P.,
S. J. Andersen,
V. Mizrahi,
D. Avarbock,
H. Rubin, and C. E. Barry, 3rd.
2000.
The stringent response of Mycobacterium tuberculosis is required for long-term survival.
J. Bacteriol.
182:4889-4898[Abstract/Free Full Text].
|
| 34.
|
Segal, W.
1984.
Growth dynamics of in vivo and in vitro grown mycobacterial pathogens, p. 547-573.
In
G. P. Kubica, and L. G. Wayne LG (ed.), The mycobacteria a source book. Marcel Dekker, Inc, New York, N.Y.
|
| 35.
|
Sherman, D. R.,
K. Mdluli,
M. J. Hickey,
C. E. Barry, 3rd, and C. K. Stover.
1999.
AhpC, oxidative stress and drug resistance in Mycobacterium tuberculosis.
Biofactors
10:211-217[Medline].
|
| 36.
|
Shevchenko, A.,
M. Wilm,
O. Vorm, and M. Mann.
1996.
Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels.
Anal. Chem.
68:850-858[Medline].
|
| 37.
|
Stover, C. K.,
P. Warrener,
D. R. Vandevanter,
D. R. Sherman,
T. M. Arain,
M. H. Langhorne,
S. W. Anderson,
J. A. Towell,
Y. Yuan,
D. N. McMurray,
B. N. Kreiswirth,
C. E. Barry, 3rd, and W. R. Baker.
2000.
A small-molecule nitroimidazopyran drug candidate for the treatment of tuberculosis.
Nature
405:962-966[CrossRef][Medline].
|
| 38.
|
Tabira, Y.,
N. Ohara,
H. Kitaura,
S. Matsumoto,
M. Naito, and T. Yamada.
1998.
The 16-kDa -crystallin-like protein of Mycobacterium bovis BCG is produced under conditions of oxygen deficiency and is associated with ribosomes.
Res. Microbiol.
149:255-264[Medline].
|
| 39.
|
Wayne, L. G., and D. Salkin.
1956.
The bacteriology of resected tuberculous pulmonary lesions. I. The effect of interval between reversal of infectiousness and subsequent surgery.
Am. Rev. Respir. Dis.
74:376-387.
|
| 40.
|
Wayne, L. G.
1960.
The bacteriology of resected tuberculous pulmonary lesions. II. Observations on bacilli which are stainable but which cannot be cultured.
Am. Rev. Respir. Dis.
82:370-377[Medline].
|
| 41.
|
Wayne, L. G.
1976.
Dynamics of submerged growth of Mycobacterium tuberculosis under aerobic and microaerophilic conditions.
Am. Rev. Respir. Dis.
114:807-811[Medline].
|
| 42.
|
Wayne, L. G.
1977.
Synchronized replication of Mycobacterium tuberculosis.
Infect. Immun.
17:528-530[Abstract/Free Full Text].
|
| 43.
|
Wayne, L. G., and H. A. Sramek.
1979.
Antigenic differences between extracts of actively replicating and synchronized resting cells of Mycobacterium tuberculosis.
Infect. Immun.
24:363-370[Abstract/Free Full Text].
|
| 44.
|
Wayne, L. G., and K. Y. Lin.
1982.
Glyoxylate metabolism and adaptation of Mycobacterium tuberculosis to survival under anaerobic conditions.
Infect. Immun.
37:1042-1049[Abstract/Free Full Text].
|
| 45.
|
Wayne, L. G.
1994.
Dormancy of Mycobacterium tuberculosis and latency of disease.
Eur. J. Clin. Microbiol. Infect. Dis.
13:908-914[CrossRef][Medline].
|
| 46.
|
Wayne, L. G., and H. A. Sramek.
1994.
Metronidazole is bactericidal to dormant cells of Mycobacterium tuberculosis.
Antimicrob. Agents Chemother.
38:2054-2058[Abstract/Free Full Text].
|
| 47.
|
Wayne, L. G., and L. G. Hayes.
1996.
An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence.
Infect. Immun.
64:2062-2069[Abstract].
|
| 48.
|
Wayne, L. G., and L. G. Hayes.
1998.
Nitrate reduction as a marker for hypoxic shift down of Mycobacterium tuberculosis.
Tubercle Lung Dis.
79:127-132.
|
| 49.
|
Weber, I.,
C. Fritz,
S. Ruttkowski,
A. Kreft, and F. C. Bange.
2000.
Anaerobic nitrate reductase (narGHJI) activity of Mycobacterium bovis BCG in vitro and its contribution to virulence in immunodeficient mice.
Mol. Microbiol.
35:1017-1025[CrossRef][Medline].
|
| 50.
|
Wilm, M.,
A. Shevchenko,
T. Houthaeve,
S. Breit,
L. Schweigerer,
T. Fotsis, and M. Mann.
1996.
Femtomole sequencing of proteins from polyacrylamide gels by nano-electrospray mass spectrometry.
Nature
379:466-469[CrossRef][Medline].
|
| 51.
|
Yuan, Y.,
D. D. Crane, and C. E. Barry, 3rd.
1996.
Stationary phase-associated protein expression in Mycobacterium tuberculosis: function of the mycobacterial -crystallin homolog.
J. Bacteriol.
178:4484-4492[Abstract/Free Full Text].
|
| 52.
|
Yuan, Y.,
D. D. Crane,
R. M. Simpson,
Y. Zhu,
M. J. Hickey,
D. R. Sherman, and C. E. Barry, 3rd.
1998.
The 16-kDa -crystallin (Acr) protein of Mycobacterium tuberculosis is required for growth in macrophages.
Proc. Natl. Acad. Sci. USA
95:9578-9583[Abstract/Free Full Text].
|