Journal of Bacteriology, May 2001, p. 2733-2745, Vol. 183, No. 9
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.9.2733-2745.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, Massachusetts 02115
Received 11 December 2000/Accepted 2 February 2001
| |
ABSTRACT |
|---|
|
|
|---|
Sequences between
332 and
39 upstream of the hilA
promoter are required for repression of hilA. An
unidentified repressor is thought to bind these upstream repressing
sequences (URS) to inhibit hilA expression. Two AraC-like
transcriptional regulators encoded on Salmonella
pathogenicity island 1 (SPI1), HilC and HilD, bind to the URS to
counteract the repression of hilA. The URS is required for
regulation of hilA by osmolarity, oxygen, PhoP/PhoQ, and
SirA/BarA. Here, we show that FadD, FliZ, PhoB, and EnvZ/OmpR also
require the URS to regulate hilA. These environmental and
regulatory factors may affect hilA expression by altering the expression or activity of HilC, HilD, or the unknown repressor. To
begin investigating these possibilities, we tested the effects of
environmental and regulatory factors on hilC and
hilD expression. We also examined hilA
regulation when hilC or hilD was disrupted or
expressed to a high level. Although hilC is regulated by
all environmental conditions and regulatory factors that modulate hilA expression, hilC is not required for the
regulation of hilA by any conditions or factors except
EnvZ/OmpR. In contrast, hilD is absolutely required for
hilA expression, but environmental conditions and
regulatory factors have little or no effect on hilD
expression. We speculate that EnvZ/OmpR regulates hilA by altering the expression and/or activity of hilC, while all
other regulatory conditions and mutations regulate hilA by
modulating hilD posttranscriptionally. We also discuss
models in which the regulation of hilA expression is
mediated by modulation of the expression or activity of one or more repressors.
| |
INTRODUCTION |
|---|
|
|
|---|
Salmonella enterica serovar Typhimurium is a gram-negative bacterium that causes various host-specific diseases. To do so, the pathogen must overcome barriers and manipulate host cells at specific sites along the course of infection. Following ingestion, the bacteria withstand the stomach's acid environment and subsequently colonize the small intestine. In calves and humans, S. enterica serovar Typhimurium induces cytokine production and neutrophil migration across the intestinal epithelium to elicit inflammatory diarrhea (69). In mice, however, the bacteria spread to systemic sites by traversing the intestinal epithelium to reach Peyer's patches, lymphatics, and the bloodstream. Before reaching the Peyer's patches, bacteria can also be intercepted by CD18+ phagocytes, which shuttle the bacteria directly to the liver and spleen (67). During systemic infection, the pathogen evades the host's immune response by residing within macrophages, causing a typhoid-like disease (19).
To execute such activities, S. enterica serovar Typhimurium produces virulence factors, including those encoded on the 40-kb Salmonella pathogenicity island 1 (SPI1) at centisome 63 (53). SPI1 genes encode several effectors and a type III secretory apparatus that translocates the effectors directly into the cytosol of intestinal epithelial cells (13, 64). There, the effectors interact with host cell proteins to rearrange the actin cytoskeleton and induce morphological changes that ultimately cause these normally nonphagocytic cells to take up the bacteria in a process called invasion (11, 21, 22, 31, 35). In addition to their roles in invasion, SPI1 invasion genes are important for intestinal colonization (55), destruction of M cells in Peyer's patches (39, 57), activation of cytokine secretion (69), and induction of neutrophil migration (24, 42, 49). Furthermore, effectors secreted by the SPI1 secretion apparatus activate proinflammatory and cytotoxic signal transduction pathways in host cells (11, 34, 35, 42, 54). Thus, the SPI1 type III secretion apparatus and its effectors may function in several ways to promote Salmonella virulence.
Virulence genes are thought to be regulated in the host such that they
are expressed only at those sites where their products are needed
(47). Unregulated production of virulence factors at
inappropriate sites may inhibit the bacteria's ability to cause disease (32). SPI1 invasion genes are regulated in vitro
by several transcription factors that may help limit SPI1 invasion gene
expression to appropriate sites in vivo. HilA, an OmpR/ToxR family
member encoded on SPI1, controls the expression of genes on SPI1, SPI4,
SPI5, and SopE
(1, 6, 12, 16). HilA directly binds to
and activates promoters of SPI1 operons encoding the type III secretory
apparatus, several secreted effectors, and InvF, an AraC-like
transcriptional regulator (46). InvF promotes expression
of HilA-activated effector genes on SPI1 by directly inducing their
transcription from a second, HilA-independent promoter
(12). InvF also appears to directly induce expression of
effector genes outside of SPI1, including
sigD(sopB) and sopE (12,
16). Because HilA directly modulates invF expression, InvF-dependent transcription of effector genes is regulated indirectly by HilA. Thus, HilA directly and/or indirectly activates the expression of genes encoding the SPI1 type III secretion apparatus and its secreted effectors, thereby playing a central role in the regulatory hierarchy controlling invasion-related gene expression.
Many two-component regulatory systems have been implicated in modulating hilA expression in vitro. One example is PhoP/PhoQ (7). PhoQ is a membrane sensor that phosphorylates its cognate transcriptional regulator PhoP only when extracellular cation levels are low (68). PhoP~P binds to and activates promoters of pags (PhoP-activated genes), including genes required for bacterial survival in macrophages (26, 27, 52). A point mutation in phoQ called pho-24 renders the sensor hyperactive, resulting in net phosphorylation of PhoP and activation of pag expression even when extracellular cation levels are high (28). The pho-24 mutation also greatly reduces hilA expression, suggesting that PhoP~P represses hilA (7). Interestingly, a disruption in the newly identified pag gene increases hilA expression, indicating that pag represses hilA (18). This suggests that the repression of hilA by PhoP/PhoQ may be mediated by pag. However, it has not yet been determined whether a disruption in pag can overcome the repression of hilA by a pho-24 mutation.
The PhoR/PhoB two-component signal transduction system may also regulate hilA expression. The PhoR sensor kinase phosphorylates PhoB when extracellular Pi levels are low (70). PhoB~P then binds to and activates promoters in the Pho regulon. However, when extracellular Pi concentrations are high, PhoR dephosphorylates PhoB~P, thereby preventing the transcriptional regulator from binding promoters and modulating gene expression. For its phosphatase activity, PhoR requires the presence of the Pst high-affinity Pi uptake system. Disruptions in the pstSCAB-phoU operon, which encodes the Pst system, result in an accumulation of PhoB~P and activation of the Pho regulon even when extracellular Pi levels are high. Such mutations also reduce hilA expression in a phoB-dependent manner, suggesting that PhoB~P represses hilA (48).
Mutant analyses also imply that BarA/SirA and EnvZ/OmpR regulate hilA. BarA and SirA are homologs of the Pseudomonas two-component regulatory factors LemA and GacA, respectively. BarA is believed to activate the transcriptional regulator SirA in response to an unknown environmental signal. Disruptions in sirA and barA repress hilA and invasion gene expression, suggesting that this putative two-component system activates hilA expression (1, 4, 38). Similarly, the EnvZ/OmpR two-component system may activate hilA expression since disruptions in envZ and ompR repress hilA (48). The sensor EnvZ modulates the activity of its cognate transcriptional regulator OmpR in response to changes in osmolarity (60).
In addition to two-component regulatory systems, small nucleoid binding proteins H-NS, HU, and Fis may modulate hilA expression. Recent genetic evidence suggests that H-NS can repress hilA under certain conditions while HU and Fis help activate hilA expression (L. M. Schechter and C. A. Lee, unpublished results, and reference 72). H-NS is a homodimeric protein that preferentially binds to and condenses curved DNA, causing local as well as global transcriptional effects (5). HU is composed of two similar but nonidentical subunits encoded by hupA and hupB. It binds DNA nonspecifically with respect to sequence and influences expression of a number of genes (59). In contrast, Fis is a site-specific DNA binding protein that induces sharp bends (58) and can behave both as an activator and a repressor of gene expression (20). It is unknown whether these proteins modulate hilA expression directly or indirectly.
hilA expression also appears to be modulated in vitro by several other factors whose roles in transcriptional regulation are not fully understood. One such factor, called CsrB, is an RNA that sequesters CsrA, which is a protein that selectively destabilizes specific mRNAs (43, 74). A disruption in csrB or expression of csrA from a plasmid represses hilA, suggesting that one of CsrA's target mRNAs encodes an activator of hilA expression (4). Loss of csrA also decreases hilA expression, suggesting that CsrA affects a repressor of hilA as well (3). A disruption in ams, which encodes RNase E, increases hilA expression, suggesting that RNase E inhibits hilA expression (18). Like CsrA, RNase E may target an RNA that induces hilA expression. Another potential inhibitor of hilA expression is a protein of unknown function called HilE. A disruption in hilE increases hilA expression, suggesting that HilE somehow represses hilA (18).
FliZ, whose function is also not well understood, appears to induce hilA. An enhancer of class II flagellar gene expression (40), FliZ is encoded in an operon with fliA (36), which encodes the alternative sigma factor required for class III flagellar gene expression (56). The fliAZY operon requires the master flagellar gene regulators, FlhD and FlhC, for expression (44). Disruptions in flhDC and fliA that reduce fliZ expression also repress hilA, and the effects of these mutations on hilA expression are complemented by a plasmid expressing fliZ from an inducible promoter (48). Furthermore, controlled expression of fliZ results in high-level expression of hilA, suggesting that FliZ somehow induces hilA expression.
Other factors promoting hilA expression may include FadD and SPI2 gene products, since disruptions in fadD and certain SPI2 genes repress hilA expression (14, 48). fadD encodes acyl coenzyme A synthetase, which is required for the uptake and degradation of long-chain fatty acids (15). SPI2 genes encode another type III secretion system required for S. enterica serovar Typhimurium's ability to survive in macrophages (33). The mechanisms whereby these factors influence hilA expression remain cryptic.
Several environmental conditions, including oxygen, osmolarity, and pH, also regulate hilA expression in vitro, but the sensors and transcription factors responsible for this environmental regulation have not yet been identified (7). Previous studies indicate that phoP is not required for regulation of hilA by any of these conditions (7). pmrA, an Fe3+-responsive regulator (73) whose expression and activity are influenced by PhoP/PhoQ and pH (29, 65), is not required for pH regulation of hilA expression (unpublished observations). Furthermore, arcA and oxrA, two transcriptional regulators known to modulate expression of many genes in response to changes in redox states (8), are not required for oxygen-mediated repression of hilA (unpublished observations). However, it is unknown whether the environmental regulation of hilA expression is mediated by two-component signal transduction systems such as PhoR/PhoB, BarA/SirA, or EnvZ/OmpR, which are known to influence hilA expression.
It is also unclear how all of these environmental and regulatory inputs
are integrated to modulate hilA expression. Recent evidence
indicates that sequences
332 to
39 upstream of the hilA
promoter are required for repression of hilA by low
osmolarity, high oxygen, the pho-24 mutation, or a
disruption in sirA (63). This suggests that the
upstream repressing sequences (URS) define a common regulatory node
where all of these conditions and mutations converge to reduce
hilA expression. It was proposed that an unknown repressor
binds to the URS under repressing conditions to reduce hilA
expression (63). Two AraC-like transcriptional regulators encoded on SPI1, HilC (also called SirC [61] or SprA
[17]) and HilD, also bind to the URS (Schechter and Lee,
unpublished results) and appear to derepress hilA expression
(63). Thus, the environmental and regulatory inputs may
affect hilA expression by altering the expression or
activity of HilC, HilD, or the unknown repressor.
Previously, we provided evidence that FadD, FliZ, PhoB, SirA, and EnvZ regulate hilA expression by independent pathways (48). In this paper, we demonstrate that these pathways require the URS to regulate hilA expression. This finding suggests that these regulatory pathways ultimately modulate the repression-derepression mechanism at this site to alter expression of hilA. Our results suggest that the EnvZ/OmpR regulatory pathway modulates hilA expression primarily by altering the expression and/or activity of hilC. In contrast, our results favor models in which all other regulatory factors and environmental conditions tested affect hilA expression by transcriptional and/or posttranscriptional modulation of hilD or by altering the expression or activity of the repressor.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains and growth conditions.
Bacterial strains
and plasmids used in this study are listed in Table
1. Unless
otherwise specified, bacterial cultures were grown at 37°C in
Luria-Bertani (LB) medium comprised of 0.5% Bacto yeast extract, 1%
Bacto tryptone, and 1% NaCl. For "no salt" growth conditions, NaCl
was omitted from the medium. When appropriate, the medium was
supplemented with 10 µg of chloramphenicol per ml, 100 µg of
ampicillin per ml, 50 µg of kanamycin per ml, or 10 µg of
tetracycline per ml. To induce genes under PBAD control, the medium was supplemented with 0.02% arabinose before bacterial inoculation. All strains containing plasmids that express
hilC or hilD from PBAD also carry a
deletion in the chromosomal araBAD operon and therefore
cannot metabolize arabinose.
-Galactosidase assays were performed on
bacterial cultures grown under low-oxygen or high-oxygen conditions as
previously described (7, 41), and activities were
quantified by the Miller method (51).
|
-Galactosidase assays were performed
on the cultures, and the
-galactosidase activity of each culture was
plotted with respect to its OD600. Data points from sister
cultures grown to different OD600s were combined to
represent the effects of growth on the
-galactosidase activity of
the strain from which the sister cultures were derived.
DNA methods. Restriction enzymes were obtained from New England Biolabs. PCR was done using Ex Taq polymerase from Takara Shuzo Co. Plasmid DNA was isolated using Qiagen columns, and chromosomal DNA was purified using the Easy-DNA kit from Invitrogen. Enzymes and kits were used according to the manufacturers' directions.
Plasmid construction. pSA4 was produced by cloning hilD downstream of PBAD in pBAD33 (S. Akbar, unpublished results). pRL692 was constructed by inserting lacZ into the hilD open reading frame (ORF) on pSA4. lacZ was cut out of pCS3 (71) using BamHI and BglII. This fragment was inserted into pSA4's unique BglII site 398 bp downstream of hilD's translational start site, creating a hilD::lacZ transcriptional fusion under PBAD control. To ensure that lacZ was in the proper orientation for a transcriptional hilD::lacZ fusion, candidates were tested for arabinose induction of lacZ expression and their plasmids were tested by restriction digests.
pLS106 was constructed by cloning the hilD promoter into pRW50 (45) upstream of lacZ. A region extending from 315 bp upstream to 13 bp downstream of hilD's translational start site was amplified from SL1344 chromosomal DNA by PCR using primers PRG2 (CGGGATCCATATACTGTTAGCGATGTC) and LS48 (CCAAGCTTACATTTTCCATATTATCCC). The resulting PCR product has a BamHI site added to its 5' end and a HindIII site added to its 3' end. It was first cloned into the BamHI and HindIII sites in pBCKS to yield pLS103. The fragment was later cut out of pLS103 using BamHI and HindIII and ligated into the BamHI and HindIII sites in pRW50, yielding pLS106.Bacterial strain construction.
Marked mutations were
transduced into different strain backgrounds by using P22. Plasmids
were passed through the r
m+ LT2 strain LB5000
(10, 62) before being electroporated into SL1344 derivatives.
DNA
replication origin and requires the
protein (encoded by
pir) to be maintained (50). The ligation was
therefore electroporated into DH5
pir, and
Ampr transformants were selected. These transformants were
also tested for Tetr, because pLD55 confers both
Ampr and Tetr. Candidate plasmids were tested
by restriction digests for insertion of
hilD::lacZ into pLD55, and of these
candidates, pRL693 was chosen for construction of RL696.
pRL693 was electroporated into the Escherichia coli strain
SM10
pir, and Ampr transformants were then
mated with SL1344. Because SL1344 lacks pir,
Ampr Salmonella conjugates contain pRL693
integrated into the chromosome. To select for these SL1344 integrants,
conjugates were restreaked on M9 minimal medium supplemented with 0.1 mM histidine, 0.2% glucose, and 25 µg of ampicillin per ml. The
integrants were subsequently restreaked on LB plates without selection
to allow recombination. The resulting colonies were restreaked on TSS
agar containing 7 µg of fusaric acid per ml to select for
Tets bacteria that had lost the plasmid from the chromosome
(9, 50). Large colonies were chosen and patched onto
LB-5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal) plates. Lac+ bacteria were selected and checked for
ampicillin and tetracycline sensitivity. Confirmation that RL696
contains the chromosomal lacZ insertion in hilD
was obtained by using PCR with primers PRG2 and LS39
(GCGGATCCTGATAGAGCGTGTTAATG) as well as primers PRG2 and CL2
(CCAGGGTTTTCCCAGTC). LS39 hybridizes to sequences 69 to 91 bp downstream of the hilD translational stop site. CL2 hybridizes to the 5' end of lacZ.
| |
RESULTS |
|---|
|
|
|---|
Multiple regulatory pathways act at a common node to modulate
hilA expression.
Because the URS is required for
regulation of hilA expression by oxygen, osmolarity,
PhoP/PhoQ, and SirA/BarA (63), we tested whether this
cis element is also required for regulation of
hilA expression by FadD, FliZ, PhoB, and EnvZ. For these
experiments, we used two pRW50 reporter plasmids, pLS50 and pLS79, to
measure the activity of the hilA promoter. In these
plasmids, portions of the hilA promoter and the 5'
untranslated region of hilA are cloned upstream of a
promoterless lacZ gene. pLS50 contains
332 to +416 of
hilA, and pLS79 contains
39 to +416 of hilA.
|
|
Regulation of mutants by oxygen and osmolarity. The apparent convergence of multiple regulatory pathways at a common site upstream of the hilA promoter could be explained in part if regulation of hilA expression by oxygen or osmolarity is mediated by one of these regulatory factors. For example, if the EnvZ/OmpR two-component system is responsible for osmoregulation of hilA expression, this would explain why both low osmolarity and a disruption in envZ require the URS to reduce hilA expression.
To test whether FadD, FliZ, PhoB, EnvZ, or SirA is responsible for the environmental regulation of hilA expression, we examined the effects of oxygen and osmolarity on hilA080::Tn5lacZY expression in mutants containing disruptions in fadD, fliA, pstS, envZ, and sirA. As expected, these mutants exhibited reduced hilA expression under activating conditions compared to wild-type bacteria (Fig. 2). However, in the mutants, hilA expression was still reduced under high-oxygen or low-osmolarity (no-salt) conditions. This suggests that these regulatory factors are not required for repression of hilA by high oxygen or low osmolarity. In support of this conclusion, we found that a disruption in phoB has no effect on the environmental regulation of hilA expression (data not shown). Furthermore, a disruption in ompR reduces hilA expression similarly to the envZ mutation under activating conditions, and hilA is still repressed by low osmolarity in an ompR mutant (data not shown). Thus, the regulatory pathways mediating environmental regulation of hilA expression appear to be distinct from those affected by FadD, FliZ, PhoB, EnvZ, and SirA.Effects of environmental conditions and regulatory mutations on hilC and hilD expression. Although the regulatory pathways modulating hilA expression appear to act independently of each other (48), their convergence at the URS suggests that they all ultimately influence a common mechanism that directly regulates hilA expression. HilC and HilD are thought to bind directly at this site to derepress the hilA promoter under activating conditions (Schechter and Lee, unpublished results). Thus, the environmental conditions and regulatory mutations that modulate hilA expression may do so by regulating expression of either hilC or hilD. HilC and HilD are encoded at different locations on SPI1 and are transcribed separately. Therefore, we examined the effects of these conditions and mutations on expression of hilC9::Tn5lacZY and hilD696::lacZ chromosomal fusions.
As shown in Fig. 3A, high-oxygen and low-osmolarity conditions mildly repressed hilD expression. Similar results were obtained with pLS106, a pRW50 reporter with lacZ expression under control of the hilD promoter (data not shown). hilC expression was also modestly reduced by low osmolarity but strongly repressed under high-oxygen conditions. Thus, it is possible that the repression of hilA expression under high-oxygen and low-osmolarity conditions is due to decreased hilD and hilC expression under these conditions.
|
Roles of hilC and hilD in regulation of hilA expression by environmental conditions and regulatory mutations. The modulation of hilC and hilD expression by oxygen and osmolarity might account for the regulation of hilA expression under these conditions. Furthermore, although the repression of hilC by fadD, fliA, pstS, envZ, and sirA mutations is mild, it is still possible that the modest effects of these mutations on hilC expression may help to cause the repression of hilA in these mutants. Similarly, although the repression of hilD in sirA and pstS mutants is very modest, it is still possible that this mild reduction in hilD expression helps mediate the repression of hilA in these mutants. Alternatively, these conditions and mutations may modulate hilC or hilD posttranscriptionally, thereby affecting hilA expression.
If environmental conditions and regulatory mutations alter hilA expression by modulating hilC or hilD transcriptionally or posttranscriptionally, we would expect that hilC or hilD would be required for regulation of hilA expression by these conditions and mutations. Therefore, we examined the effects of disruptions in hilC and hilD on the regulation of iagB87::lacZY expression by oxygen, osmolarity, and regulatory mutations. iagB is a gene downstream of and in the same operon with hilA, and the chromosomal iagB87::lacZY fusion is used as a reporter of hilA expression (48). As shown in Fig. 4A, a disruption in hilC reduced hilA expression approximately twofold under activating conditions. However, hilA expression was further repressed under high-oxygen or low-osmolarity conditions in this mutant, indicating that hilC is not required for the environmental regulation of hilA expression. Thus, the reduction in hilC expression under high-oxygen and low-osmolarity conditions cannot fully account for the repression of hilA expression under these same conditions. Furthermore, environmental regulation of hilA expression is apparently not mediated by posttranscriptional modulation of hilC, since hilA expression is still regulated by environmental conditions when hilC is absent.
|
Controlled expression of hilC or hilD abolishes regulation of hilA expression by environmental conditions and regulatory mutations. Another way to investigate whether the regulation of hilC or hilD expression plays any role in the regulation of hilA expression by environmental conditions and regulatory factors is to induce hilC or hilD expression under repressing conditions. If repression by a particular regulatory pathway is specifically overcome by expressing either hilC or hilD, it might suggest that this regulatory pathway affects hilA expression primarily by controlling hilC or hilD expression. Because certain environmental conditions and regulatory mutations affect hilC or hilD expression and appear to regulate hilA expression in a hilC- or hilD-dependent manner, we expected that controlled expression of hilC or hilD would abolish the effects of some conditions and mutations on hilA expression but not others.
For example, we expected controlled expression of hilC to overcome regulation of hilA expression by EnvZ/OmpR because hilC expression appears to be regulated by this pathway and hilC is required for EnvZ/OmpR regulation of hilA expression. However, because hilC is not required for regulation of hilA expression by any other environmental condition or regulatory mutation tested, we expected that controlled expression of hilC would not abolish the regulation of hilA expression by these other conditions and mutations. Similarly, we expected that controlled expression of hilD would not overcome the effects of the fadD, fliA, or envZ mutations of hilA expression because hilD expression is not affected by these mutations. In contrast, we expected that controlled expression of hilD might overcome regulation of hilA expression by oxygen and osmolarity because hilD expression is regulated under these conditions. To control hilD and hilC expression, we used pSA4 and pLS119, respectively. pSA4, referred to as philD, is pBAD33 with hilD cloned downstream of PBAD. pLS119, referred to as philC, is pBAD-Myc/His with hilC cloned downstream of PBAD. In the presence or absence of arabinose, the parent plasmids, pBAD33 and pBAD-Myc/His, have no effect on the regulation of hilA expression by oxygen, osmolarity, or a disruption in fadD, fliA, pstS, sirA, envZ, or hilD (data not shown). Furthermore, as shown in Fig. 5, philD and philC have no effect on osmoregulation of hilA expression in the absence of arabinose. However, arabinose-induced expression of hilC or hilD induces high levels of hilA expression under both activating and low osmolarity conditions. This suggests that controlled expression of hilC or hilD can abolish osmoregulation of hilA expression.
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Previously, Schechter et al. demonstrated that hilA
expression is repressed in the absence of hilD
(63). Because the URS is required for repression, an
unidentified repressor is thought to bind to this region, thereby
inhibiting hilA expression. When present, HilC or HilD binds
to this same site and promotes hilA expression
(63; Schechter and Lee, unpublished results). However, when this site is removed, the hilA promoter is no longer
repressed even when hilD and hilC are absent.
These results suggest a model in which HilC and HilD, unlike most other
AraC-like transcriptional regulators (23), are not
activators but instead behave as derepressors of hilA
expression (Fig. 8). In this model, the
repressor is always present but cannot inhibit hilA
expression under activating conditions because HilD (and, to a lesser
extent, HilC) displaces it from the URS. However, when hilD
is absent, the repressor can bind to this site to inhibit
hilA expression even under activating environmental
conditions.
|
Previous results as well as data from this study demonstrate that the URS is also required for modulation of hilA expression by oxygen, osmolarity, PhoP/PhoQ, FadD, FliZ, PhoB, SirA, and EnvZ (63). None of the regulatory factors affecting hilA expression appears to be responsible for regulating the expression of hilA in response to oxygen or osmolarity. Also, previous results indicate that many of these regulatory factors act independently of each other to modulate hilA expression (48). Thus, multiple independent regulatory pathways converge at the URS, suggesting that they may all modulate the repression-derepression mechanism to regulate hilA expression. Such modulation might include altering the expression or activity of HilD, HilC, or the unknown repressor.
HilD. Mutations in fadD, fliA, envZ, and hilC have no effect on hilD expression. This suggests that these mutations do not repress hilA by modulating hilD expression. However, the finding that the fliA, envZ, and hilC mutations no longer affect hilA expression in a hilD mutant suggests that they may be modulating hilA expression by posttranscriptional effects on hilD. The fadD mutation may also affect hilA expression by modulating hilD posttranscriptionally. Alternatively, regulation by all of these mutations may be mediated by modulation of the repressor (see below).
In contrast, mutations in pstS and sirA mildly repress hilD. Furthermore, hilD expression is repressed under high-oxygen and low-osmolarity conditions just as hilA expression is. This suggests that the regulation of hilA expression by these conditions and mutations might be mediated by modulating hilD expression. Consistent with this model, hilA expression is strongly repressed by a disruption in hilD, and a mutation in pstSCAB-phoU has no effect on hilA expression in a hilD mutant. However, such results are also consistent with models in which these conditions and mutations regulate hilA expression by modulating hilD posttranscriptionally. In an attempt to further investigate which pathways regulate hilA expression by modulating hilD expression, we examined the effect of controlled hilD expression on the modulation of hilA expression by environmental conditions and regulatory mutations. Unexpectedly, controlled expression of hilD overcomes the effects of all repressing conditions and mutations on hilA expression. This finding should be interpreted with caution, because many of these mutations do not affect hilD expression and presumably regulate hilA expression either by posttranscriptional effects on hilD or by hilD-independent mechanisms. Thus, arabinose-induced expression of hilD appears to do more than just compensate for decreased hilD expression under repressing conditions. Indeed, hilA expression is much higher when hilD expression is driven from the PBAD promoter than it is in bacteria expressing chromosomal hilD from its own promoter. This implies that an artificially high level of HilD is present when hilD is expressed from the PBAD promoter. Such high-level expression of hilD may increase hilA expression under repressing conditions by compensating for posttranscriptional effects on hilD. There are several ways in which hilD might be regulated posttranscriptionally, including modulation of hilD mRNA stability. A mechanism for this type of regulation may involve CsrA, which selectively destabilizes mRNAs (43). As previously discussed, both high-level expression and loss of CsrA repress hilA, suggesting that CsrA may destabilize different mRNAs that promote and inhibit hilA expression (3, 4). Alternatively, CsrA levels may directly affect the stability of hilD mRNA. In support of this idea, recent evidence demonstrates that hilD transcript levels are reduced in strains lacking or overexpressing CsrA (3). RNase E, which appears to somehow repress hilA expression (18), may affect hilD transcript stability in conjunction with CsrA. If environmental conditions and regulatory factors modulate hilA expression by affecting hilD transcript stability, high-level expression of HilD from the PBAD promoter may help compensate for hilD transcript instability, allowing expression of hilA under repressing conditions. More experiments must be done to determine whether specific environmental conditions or regulatory mutations ultimately modulate hilA expression by these mechanisms. Another possibility is that HilD protein activity is affected by particular environmental conditions or regulatory mutations. For example, HilD may interact with a ligand that is present under specific conditions, and the binding of this ligand may affect HilD's ability to bind DNA. Alternatively, HilD may be phosphorylated or otherwise modified such that its activity is modulated in response to particular conditions or mutations. If repression is mediated by modulating HilD activity, high-level expression of hilD might somehow overcome the effects of such modulation. One example of an AraC-like transcriptional regulator whose activity can be affected in this way is XylS from Pseudomonas putida. XylS is thought to exist in a dynamic equilibrium between an active and inactive state, and binding of certain effectors favors the transition from the inactive to active form (23). Normally, XylS requires the binding of these effectors to activate transcription of its target genes. However, when XylS is overproduced, XylS-dependent transcription is induced even in the absence of effectors. It is thought that when the total amount of XylS in the cell is high, the amount of active XylS in equilibrium with inactive XylS is high enough to activate transcription. HilD may also exist in an equilibrium between an active and inactive state, similar to XylS. In such a model, overproduction of HilD could yield enough active HilD in equilibrium with inactive HilD to derepress hilA expression under repressing conditions. Because arabinose-induced expression of hilD results in artificially high levels of HilD that might compensate for posttranscriptional regulation of hilD, our results cannot determine which environmental and regulatory pathways regulate hilA expression by modulating hilD expression. However, the effects of the pstS and sirA mutations on hilD expression are extremely mild, and it seems unlikely that such effects would significantly reduce hilA expression. Also, the reduction in hilA expression under high-oxygen or low-osmolarity conditions is much more dramatic than the repression of hilD expression by these conditions. Therefore, it seems unlikely that environmental regulation of hilD expression can fully account for the regulation of hilA expression by these environmental conditions. For these reasons, we favor models in which the regulation of hilA expression by environmental conditions and regulatory mutations is mediated by posttranscriptional effects on hilD or by modulating the expression or activity of a repressor (see below).HilC. Interpreting the impact of controlled hilD expression on the modulation of hilA expression was made even more complicated by the fact that hilC, when expressed to high levels, can substitute functionally for hilD. Schechter et al. found that high-level expression of hilC could derepress the hilA promoter even in the absence of hilD (63). Furthermore, we found that controlled expression of hilC overcomes repression of chromosomal hilA expression by high oxygen levels, low osmolarity, and all mutations tested (Fig. 5, 6, and 7). Arabinose-induced expression of hilC overcomes repressing conditions and mutations even when hilD is disrupted (data not shown), suggesting that HilC is directly derepressing hilA expression. In support of this hypothesis, HilC binds to the URS in vitro (Schechter and Lee, unpublished results). Thus hilC, which is also a member of the AraC family, can behave as a derepressor of hilA expression when produced at high levels.
However, Schechter et al. found that a disruption in hilC has only modest effects on S. enterica serovar Typhimurium's ability to invade HEp-2 cells, while a disruption in hilD has profound effects on invasion (63). This suggests that hilC plays a minor role in vitro compared to hilD. Our results seem to confirm this prediction. A disruption in hilC reduced iagB87::lacZY expression only 2-fold, compared with the 32-fold repression seen in a hilD mutant. Furthermore, hilC is not required for the regulation of hilA expression by oxygen, osmolarity, FadD, FliZ, PhoB, or SirA. Only EnvZ/OmpR seems to require hilC to regulate hilA expression. Thus, while EnvZ/OmpR may regulate hilA expression by modulating hilC expression and/or activity, all other conditions and regulatory factors affect hilA expression by a hilC-independent mechanism. We have concluded that SirA and HilC affect hilA expression independently, based on results which show that a hilC sirA double mutant yields much lower hilA expression than either a sirA or hilC single mutant. This conflicts with data from Rakeman et al., who found that in a sirA mutant, hilA expression was not further reduced by a disruption in sirC (hilC) (61). We suspect that the conflict between our results and those of Rakeman et al. can be explained by differences in strain backgrounds and sirA mutations used. We observed over 500 Miller units of
-galactosidase activity from
the iagB87::lacZY fusion in SL1344 under our
conditions. However, Rakeman et al. observed less than 200 Miller units
of
-galactosidase activity from the same fusion in their strain background, 14028s, indicating that hilA expression is
already somewhat repressed in their strain background
(61). Furthermore, their sirA mutation has a
stronger effect on iagB87::lacZY expression than our sirA mutation does (sixfold repression and
threefold repression, respectively). The end result of these
differences is that Rakeman et al. observed only approximately 30 Miller units of
-galactosidase activity from
iagB87::lacZY in a sirA mutant. In
this situation, the hilA promoter may already be as
repressed as it can be. Thus, the effect of the hilC
mutation on hilA expression may not be observable in the
sirA mutant, which could explain why their sirA
hilC double mutant did not exhibit lower hilA
expression than a sirA single mutant. However, since we
still have considerable hilA expression in our
sirA mutant (168 Miller units of
-galactosidase activity
from iagB87::lacZY), we can observe the
combined effects of the sirA and hilC mutations
on hilA expression in the double mutant
(iagB87::lacZY expression dropped to 29 Miller units).
Parallels between regulation of hilC and hilA expression. Rakeman et al. observed that hilC expression is reduced by a disruption in sirA (61). Our results confirm this observation, though our sirA mutation has a milder effect on hilC expression than that reported by Rakeman et al. In addition, we found that hilC expression is repressed by high-oxygen conditions, low osmolarity, and all regulatory mutations tested. Thus, although hilC is not required for the regulation of hilA expression by any of these conditions or mutations, hilC expression is regulated in a manner that parallels the regulation of hilA expression. hilC expression is unaffected by a disruption in hilA (61), but it is mildly reduced by a disruption in hilD. This suggests that the same repression-derepression mechanism that regulates hilA expression may also affect hilC expression. If so, future studies on the regulation of hilC expression by all of these environmental conditions and regulatory mutations may provide clues about how hilA expression is regulated. Interestingly, preliminary results indicate that in a hilD mutant, hilC expression is even further repressed by low-osmolarity conditions, suggesting that osmoregulation of hilC expression is hilD independent (data not shown). The same may be true for osmoregulation of hilA expression.
Repression. Although this study focused on the roles of hilC and hilD in regulating hilA expression, this regulation could also be mediated by affecting the expression or activity of a repressor. The finding that arabinose-induced expression of hilD overcomes the repression of hilA by all environmental conditions and regulatory mutations would seem to argue against this possibility. However, controlled expression of hilD from the PBAD promoter may result in such high levels of HilD that the repressor is completely outcompeted for binding at the URS. If repression by a particular condition or mutation is mediated by increasing the expression or activity of the repressor, this effect could be counteracted by flooding the system with so much HilD that the repressor is unable to bind to the URS at all. In such a situation, the abundance and activity of the repressor would become irrelevant, such that environmental conditions and regulatory mutations acting through the repressor would no longer affect hilA expression. Similarly, if hilD is absolutely required for expression of hilA, increased expression or activity of the repressor might have no effect in a hilD mutant. This might explain why hilA expression is not strongly affected by environmental conditions or regulatory mutations in the absence of hilD. Thus, our data do not rule out models in which environmental conditions and regulatory mutations modulate hilA expression by altering the expression or activity of a repressor.
Future directions. Our results have excluded hilC from playing a major role in the in vitro regulation of hilA expression by all environmental conditions and regulatory factors tested (except EnvZ/OmpR). However, regulation of hilC expression by these conditions and regulatory factors parallels the regulation of hilA expression. This implies that studies on the regulation of hilC expression may provide more clues about how hilA is regulated. In fact, something equivalent to the URS may be present upstream of the hilC promoter, and future studies must explore this possibility.
We have also shown that FadD, FliZ, and EnvZ do not regulate hilA expression by modulating hilD expression. Furthermore, we suspect that the mild effects of oxygen, osmolarity, SirA, and PhoB on hilD expression do not fully account for the effects of these conditions and mutations on hilA expression. We are left with a model in which these conditions and mutations regulate hilA expression by modulating hilD posttranscriptionally (Fig. 8). Future molecular and biochemical studies must focus on determining how posttranscriptional regulation of hilD might be achieved. Our data are also consistent with a model in which the regulation of hilA expression is mediated by modulating the expression or activity of the repressor. Future experiments to test such a model await the identification of the repressor. In fact, more than one repressor may be involved in mediating inhibition of hilA expression by different environmental conditions and regulatory mutations. One likely candidate, hns, appears to be required for repression of hilA under low-osmolarity conditions, even in the absence of hilC and hilD (Schechter and Lee, unpublished results). Another potential repressor is HilE. Fahlen et al. demonstrated that some mutations (such as hilE1, which contains a disruption in hilE) result in increased hilA expression under activating conditions (18). Thus, HilE may act as a repressor under certain circumstances. Experiments must be done to determine whether H-NS and HilE interact directly with the URS, as we would expect if they are repressors. It is unlikely that any one mechanism of regulation can account for the changes in hilA expression in the presence of various environmental conditions and regulatory mutations. Transcriptional and posttranscriptional regulation of hilD as well as modulation of the expression and activity of one or more repressors may all contribute to the regulation of hilA expression. Thus, future studies must focus on measuring how much each mechanism contributes to the regulation of hilA expression by each environmental condition and regulatory factor.| |
ACKNOWLEDGMENTS |
|---|
We are grateful to S. Akbar, L. Schechter, S. Lindgren, and B. Ahmer for sharing unpublished strains, plasmids, and results. We also thank S. Akbar and J. Day for critical reading of the manuscript.
This work was supported by the American Heart Association grant-in-aid 96006780 (C.A.L.) and NIH grant no. AI33444.
| |
ADDENDUM IN PROOF |
|---|
Iyoda et al. (S. Iyoda, T. Kamidoi, K. Hirose, K. Katsukake, and H. Watanabe, Microb. Pathog. 30:81-90, 2001) have shown that a disruption in fliZ represses hilA, confirming that FliZ positively regulates hilA expression.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Ave., Boston, MA 02115. Phone: (617) 432-4988. Fax: (617) 738-7664. E-mail: clee{at}hms.harvard.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ahmer, B. M. M., J. van Reeuwijk, P. R. Watson, T. S. Wallis, and F. Heffron. 1999. Salmonella SirA is a global regulator of genes mediating enteropathogenesis. Mol. Microbiol. 31:971-982[CrossRef][Medline]. |
| 2. |
Ailion, M.,
T. A. Bobik, and J. R. Roth.
1993.
Two global regulatory systems (Crp and Arc) control the cobalamin/propanediol regulon of Salmonella typhimurium.
J. Bacteriol.
175:7200-7208 |
| 3. |
Altier, C.,
M. Suyemoto, and S. D. Lawhon.
2000.
Regulation of Salmonella enterica serovar Typhimurium invasion genes by csrA.
Infect. Immun.
68:6790-6797 |
| 4. | Altier, C., M. Suyemoto, A. I. Ruiz, K. D. Burnham, and R. Maurer. 2000. Characterization of two novel regulatory genes affecting Salmonella invasion gene expression. Mol. Microbiol. 35:635-646[CrossRef][Medline]. |
| 5. | Atlung, T., and H. Ingmer. 1997. H-NS: a modulator of environmentally regulated gene expression. Mol. Microbiol. 24:7-17[CrossRef][Medline]. |
| 6. | Bajaj, V., C. Hwang, and C. A. Lee. 1995. hilA is a novel ompR/toxR family member that activates the expression of Salmonella typhimurium invasion genes. Mol. Microbiol. 15:749-759[CrossRef][Medline]. |
| 7. | Bajaj, V., R. L. Lucas, C. Hwang, and C. A. Lee. 1996. Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hilA expression. Mol. Microbiol. 22:703-714[CrossRef][Medline]. |
| 8. | Bauer, C. E., S. Elsen, and T. H. Bird. 1999. Mechanisms for redox control of gene expression. Annu. Rev. Microbiol. 53:495-523[CrossRef][Medline]. |
| 9. |
Bochner, B. R.,
H.-C. Huang,
G. L. Schieven, and B. N. Ames.
1980.
Positive selection for loss of tetracycline resistance.
J. Bacteriol.
143:926-933 |
| 10. |
Bullas, L. R., and J.-I. Ryu.
1983.
Salmonella typhimurium LT2 strains which are r m+ for all three chromosomally located systems of DNA restriction and modification.
J. Bacteriol.
156:471-474 |
| 11. | Chen, L. M., K. Kaniga, and J. E. Galan. 1996. Salmonella spp. are cytotoxic for cultured macrophages. Mol. Microbiol. 21:1101-1115[CrossRef][Medline]. |
| 12. |
Darwin, K. H., and V. L. Miller.
1999.
InvF is required for expression of genes encoding proteins secreted by the SPI1 type III secretion apparatus in Salmonella typhimurium.
J. Bacteriol.
181:4949-4954 |
| 13. |
Darwin, K. H., and V. L. Miller.
1999.
Molecular basis of the interaction of Salmonella with the intestinal mucosa.
Clin. Microbiol. Rev.
12:405-428 |
| 14. |
Deiwick, J.,
T. Nikolaus,
J. E. Shea,
C. Gleeson,
D. W. Holden, and M. Hensel.
1998.
Mutations in Salmonella pathogenicity island 2 (SPI2) genes affecting transcription of SPI1 genes and resistance to antimicrobial agents.
J. Bacteriol.
180:4775-4780 |
| 15. | DiRusso, C. C., P. N. Black, and J. D. Weimar. 1999. Molecular inroads into the regulation and metabolism of fatty acids, lessons from bacteria. Prog. Lipid Res. 38:129-197[CrossRef][Medline]. |
| 16. |
Eichelberg, K., and J. E. Galan.
1999.
Differential regulation of Salmonella typhimurium type III secreted proteins by pathogenicity island 1 (SPI1)-encoded transcriptional activators InvF and HilA.
Infect. Immun.
67:4099-4105 |
| 17.< |