Previous Article | Next Article 
Journal of Bacteriology, May 2001, p. 2803-2807, Vol. 183, No. 9
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.9.2803-2807.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
NreB from Achromobacter xylosoxidans 31A
Is a Nickel-Induced Transporter Conferring Nickel Resistance
Gregor
Grass,1
Bin
Fan,2
Barry P.
Rosen,2
Karin
Lemke,3
Hans-Günter
Schlegel,3 and
Christopher
Rensing1,*
Department of Soil, Water, and Environmental
Science, University of Arizona, Tucson, Arizona
857211; Department of Biochemistry and
Molecular Biology, Wayne State University, Detroit, Michigan
482012; and Institut für
Mikrobiologie, Georg-August-Universität, 37077 Göttingen,
Germany3
Received 13 December 2000/Accepted 14 February 2001
 |
ABSTRACT |
There are two distinct nickel resistance loci on plasmid pTOM9 from
Achromobacter xylosoxidans 31A, ncc and
nre. Expression of the nreB gene was
specifically induced by nickel and conferred nickel resistance on both
A. xylosoxidans 31A and Escherichia coli. E. coli cells expressing nreB showed reduced
accumulation of Ni2+, suggesting that NreB mediated nickel
efflux. The histidine-rich C-terminal region of NreB was not essential
but contributed to maximal Ni2+ resistance.
 |
INTRODUCTION |
Nickel is the 24th most abundant
element in the earth's crust and has been detected in different media
in all parts of the biosphere. Nickel is classified as a borderline
metal ion because it has both soft and hard metal properties and can
bind to sulfur, nitrogen, and oxygen groups (3). In many
bacteria, nickel is required for enzymes such as urease, CO
dehydrogenase, and hydrogenase (5, 10). However, excess
nickel is toxic. Nickel binds to proteins and nucleic acids and
frequently inhibits enzymatic activity, DNA replication, transcription,
and translation (1). Several nickel-resistant bacteria
have been isolated from heavy-metal-contaminated sites. Well-studied
examples include Ralstonia metallidurans CH34 and
Achromobacter xylosoxidans 31A (8, 24). The
determinant responsible for nickel resistance in R. metallidurans CH34, cnr (cobalt-nickel resistance),
encodes three regulatory genes (cnrY, cnrX, and
cnrH) and three structural genes encoding the subunits of
the Co-Ni efflux pump (cnrC, cnrB, and cnrA)
(8, 26). The cnr determinant is similar to the
ncc determinant (nickel-cobalt-cadmium resistance) of
A. xylosoxidans 31A. The proposed gene products for the
efflux system CnrCBA and NccCBA are largely homologous to the gene
products for the three subunits of the better-characterized CzcCBA
cation-proton antiporter and probably have a similar function (16, 17, 27). In addition to the ncc locus,
A. xylosoxidans 31A contains another distinct nickel
resistance locus, nre, located on plasmid pTOM9. The
nre locus confers low-level nickel resistance on both
Ralstonia and Escherichia coli strains
(24). The closest homologue of the deduced nreB
gene product is NrsD from Synechocystis sp. strain PCC 6803 (6). Both NreB and NrsD belong to the major facilitator
superfamily (MFS), and computer analysis indicates 12 putative
transmembrane helices in each (11, 20). Additionally, both
proteins possess histidine-rich C termini possibly implicated in metal
binding (6).
In this study, we characterized the nre locus of A. xylosoxidans 31A and showed that only nreB is required
for nickel resistance. In A. xylosoxidans, nreB was
specifically induced by nickel but not by cobalt or zinc. The
histidine-rich C terminus was not essential for NreB function but was
necessary for maximum nickel resistance. E. coli cells
harboring nreB showed reduced uptake of nickel compared to
that of wild-type cells. The data support our hypothesis that NreB is a
Ni2+ transporter responsible for Ni2+ efflux
and resistance in A. xylosoxidans 31A and E. coli.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
The strains and
plasmids used are listed in Table 1.
E. coli strains were grown in Luria-Bertani broth or agar.
Antibiotics were added, as appropriate, to the following final
concentrations: ampicillin, 100 µg/ml; tetracycline, 12.5 µg/ml;
kanamycin, 25 µg/ml for E. coli and 1 mg/ml for A. xylosoxidans. To induce gene expression under the ptetA
promoter anhydrotetracycline (AHT; 0.2 µg/ml; Sigma-Genosys) was
added. A. xylosoxidans 31A and R. metallidurans
AE104 were grown in
N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid
(TES)- or Tris-buffered mineral salt medium containing a final
concentration of 2 g of sodium gluconate per liter
(13). NiCl2 was added as indicated. For
conjugative gene transfer, overnight cultures of donor strain E. coli S17-1 (25) and recipient strain R. metallidurans AE104 or A. xylosoxidans 31A were grown
at 30°C in complex medium, mixed (1:1), and plated onto Luria-Bertani plates. After overnight growth, the bacteria were suspended in saline
(8.5 g of NaCl/liter), diluted, and plated onto selective medium as
previously described (15).
63Ni uptake.
Uptake experiments were performed
by filtration. Following growth in Luria-Bertani medium, cells were
harvested and washed once with a buffer consisting of 20 mM
3-(N-morpholino)propanesulfonic acid (MOPS) buffer (pH 7.0),
100 mM sucrose, and 100 mM potassium phosphate. Transport assays were
conducted by addition of 63Ni2+ to a final
concentration of 5 µM, with filtration at the indicated times. The
nitrocellulose filters (0.45-µm pore size; Whatman) were washed with
10 ml of the same buffer. A blank value, obtained by filtering 0.1 ml
of the assay mixture without cells and washing it with 10 ml of buffer,
was subtracted from all measured values. 63NiCl2 (1.25 µCi/ml) was from
Amersham/Pharmacia.
Genetic techniques.
Standard molecular genetic techniques
were used (21). Transposon mutagenesis was conducted as
described previously (24). Total RNA of A. xylosoxidans was isolated as described previously (8,
9). Northern blot analysis was performed as described by Große
et al. (9). PCR was performed using Pwo (Roche)
or Taq (Qiagen) DNA polymerase. DNA sequences were obtained
by the dideoxy-mediated chain termination method of Sanger et al. using 35S (22) or using an ABISEQ automatic sequencer.
Construction of the truncated nreB gene lacking the
coding region for the histidine rich C terminus.
To construct the
truncated nreB gene, PCR amplification was performed using
the primer pair
5'-GAGGAATTC2460ATGCTTGATGTATTGAAGAACCGGA-3' and
5'-CTCCTGCAG3649GATGACATCTTCGTCGCGTGACG
(the underlined sequences are restriction sites), resulting in a
fragment lacking 3' positions 3650 to 3786. The PCR fragment was then
cloned into overexpression vector pASK-IBA3 using the EcoRI
and PstI restriction sites introduced by PCR. The complete
nreB gene was amplified using the primer pair 5'
GAGGAATTC2460ATGCTTGATGTATTGAAGAACCGGA-3'
and
5'-ATTCTGCAG3780ATGCGCGTCGGGCCATCG-3' and also cloned into vector pASK-IBA3.
Reporter gene fusion.
To construct a
(nreB-lacZ) transcriptional fusion in strain A. xylosoxidans 31A, a 1,273-bp fragment, nreB'
(amplified with the primer pair
5'-CCGGTCGAC2498GTTCACGGCACAGGTGATCCC-3'
and 5'-3783ATTCTAATGCGCGTCGGGCCA-3' ),
containing the 3' end of nreB was amplified as a
SalI/PstI fragment from A. xylosoxidans 31A and cloned into pGEM T-Easy (Promega, Madison,
Wis.). A promoterless lacZ gene was cloned into the single
PstI site directly downstream of nreB'. The
lacZ gene was amplified from chromosomal DNA of E. coli W3110, introducing PstI sites at each end. The
correct orientation of lacZ was confirmed by restriction
analysis, and the
(nreB-lacZ) fragment was subcloned as a
SalI-fragment into suicide vector pLO18 taking advantage of
an additional SalI site in pGEM-T-Easy. The resulting
plasmid was used to insert the lacZ gene by recombination
immediately downstream of nreB in A. xylosoxidans
as described by Gro
e et al. (9), creating strain AX1
(nreB-lacZ). The
-galactosidase activity in
permeabilized cells was determined as described previously (14).
 |
RESULTS |
The nre locus is a second distinct nickel resistance
determinant of A. xylosoxidans 31A.
Previously, the
ncc (nickel, cobalt, cadmium) determinant on plasmid pTOM9
of A. xylosoxidans 31A was identified as a nickel resistance
determinant (23, 24). However, a 14.5-kb BamHI fragment containing not only the ncc determinant but also a
4.2-kb EcoRI fragment downstream of ncc rendered
cells of AE104 more nickel resistant than a fragment containing only
ncc (Table 2). This suggested
the presence of an additional nickel resistance determinant downstream
of ncc. Expression of this determinant is independent of
ncc, because inversion of the 4.2-kb EcoRI
fragment did not alter the resistance pattern (Table 2). The 4.2-kb
EcoRI fragment alone was able to confer nickel resistance on
both R. metallidurans AE104 and E. coli (Table
2). Sequence analysis of the 4.2-kb EcoRI fragment suggested
the presence of four open reading frames (accession no. L31491).
Subsequent subcloning (12) of this 4.2-kb EcoRI
fragment showed that only the 3' 2-kb fragment is necessary for nickel
resistance in A. xylosoxidans 31A. This distinct nickel
resistance determinant possessing two putative genes, nreA
and nreB, was termed nre (Fig.
1).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Genetic organization of the nickel resistance
determinants ncc and nre from A. xylosoxidans 31A (accession no. L31491 and L31363) on a 14.5-kb
BamHI fragment. Arrows indicate the transcriptional
orientation of the respective genes. Triangles represent loci of
Tn5 insertions (nucleotide numbering according to the
sequence with accession number L31491) as follows: 1, 2397; 2, 2535; 3, 2876; 4, 3239; 5, 3573; 6, 3703; 7, 3718. The two possible start codons
are indicated by S1 (nucleotide 2376) and S2 (nucleotide 2460). The
vertical arrow marks the 3' end of the truncated nreB gene
(nucleotides 2460 to 3649). Accession number L31363 is a 4.2-kb
EcoRI fragment (shaded), and accession number L31491 is an
8.1-kb fragment (shaded). Distances are not drawn to scale.
|
|
The nreB gene is induced by nickel but not by zinc and
cobalt in A. xylosoxidans 31A.
The nre
determinant has metal ion specificity different from that of the
ncc determinant. Whereas the ncc determinant
confers Ni2+, Co2+, and Cd2+
resistance, the nre determinant confers only
Ni2+ resistance. Regulation of nre transcription
was examined by Northern blot analysis and by a
(nreB-lacZ) operon fusion. For Northern blot analysis,
cells of A. xylosoxidans 31A were grown in Tris minimal
medium (13) to mid-log phase, at which point either NiCl2 or CoCl2 was added. As a control, a
culture was grown with no added metal. An increase in an
nreB-specific transcript was detected only after addition of
Ni2+ (Fig. 2B). Addition of
Co2+ did not result in an increase in transcription
compared to that of the control with no metal added (Fig. 2B). The
actual size of the transcript could not be determined because of
compressions due to rRNA and unstable transcripts. Transcription of a
(nreB-lacZ) operon fusion was specifically induced by
nickel. Neither zinc nor cobalt induced transcription (Fig. 2A). These
results show specific induction of nreB expression by nickel
and not by cobalt or zinc, consistent with the specificity of metal
resistance. Induction of nreB expression was also dependent
on the nickel concentration in the medium. After 1 h, the
-galactosidase activity (in Miller units) of a
(nreB-lacZ) operon fusion was 28 without added metal,
55.85 with 0.5 mM Ni2+ added, and 78.2 with 1 mM
Ni2+ added. Maximal induction was obtained after 2 h
with 3 and 0.5 mM Ni2+ and after 1 h with 1 mM
Ni2+. After 3 h, a slight decrease in nreB
transcription could be observed for all of the concentrations tested
(data not shown).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
Induction of nreB. Induction of
-galactosidase activity in an nreB-lacZ mutant strain.
(A) Cells of A. xylosoxidans AX1 containing a
(nreB-lacZ) operon fusion on plasmid pTOM9 were diluted
15-fold to an optical density at 600 nm of 0.15 into fresh medium
containing no added metal ( ) or were induced after 5 h of
growth with 0.3 mM Ni2+ ( ), Co2+ ( ), or
Zn2+ ( ). Incubation was continued with shaking at
30°C, and the -galactosidase activity was determined as Miller
units (14). (B) Northern blot analysis of nreB
transcription. Total RNA was separated by electrophoresis in 1.5%
agarose, transferred to a nylon membrane, and hybridized with an
nreB-specific probe (all lanes). Total RNA was isolated from
nreB-containing strain A. xylosoxidans 31A that
was cultivated without toxic concentrations of heavy-metal cations
(lane 1) or induced for 30 min with 300 µM Ni2+ (lane 2)
or Co2+ (lane 3). Blebs and compressions are due to the 16S
and 23S rRNAs. The original photograph was scanned with Ofoto 2.0 (Light Source Computer Images, Inc.) and processed with Adobe Photoshop
3.0 (Adobe Systems, Inc.).
|
|
NreB confers nickel resistance on E. coli.
There
are two possible ATG start codons for NreB. However, transposon
mutagenesis (Fig. 1; Table 3) and codon
usage (2) suggest that the second start codon is used.
Therefore, nreB starting with the second start codon was
cloned into the expression vector pASK-IBA3 (Sigma-Genosys, The
Woodlands, Tex.) to create pNREB. Expression of nreB in
E. coli W3110(pNREB) rendered cells more nickel resistant
than E. coli W3110(pASK-IBA3) lacking the nreB gene (Fig. 3). Although maximal nickel
resistance was obtained after addition of the inducer AHT, a
substantial increase in nickel resistance was also observed in the
absence of induction, indicating that the ptet promoter was
leaky and that only minute amounts of NreB were necessary for an
increase in nickel resistance (Fig. 3). Expression of the NreB protein
could not be visualized by silver-stained sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (data not shown).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of 3 mM Ni2+ on the growth of
E. coli W3110 containing specific constructs. Cells were
grown overnight in Luria-Bertani medium, diluted 200-fold into fresh
Luria-Bertani medium containing 3 mM NiCl2, and grown at
37°C with shaking. The optical density at 600 nm was monitored hourly
for 12 h and converted to dry weight (milligrams per milliliter)
and is presented as a semilogarithmic plot. Symbols: and ,
pASK-IBA3; and , pNREB; and , pNREB2. The inducer AHT was
either not added (open symbols) or was added to a final concentration
of 0.2 µg/ml (filled symbols).
|
|
The C-terminal histidine-rich region of NreB is not essential but
contributes to maximal nickel resistance.
The C-terminal
histidine-rich region in the homologous nrsD protein from
Synechocystis sp. strain PCC 6803 had previously been shown
to bind metals (6). To assess if the C-terminal region is
essential for NreB, the C-terminal region was deleted (amino acids 404 to 446) and the truncated NreB protein was expressed in E. coli W3110(pNREB2). The truncated NreB protein was still able to
confer a significant increase in nickel resistance compared to E. coli W3110(pASK-IBA3) (Fig. 3). Indeed, the truncated NreB protein
was able to confer nearly the same resistance as the full-length protein when induced with AHT (Fig. 3). However, a significant loss of
nickel resistance was observed when no inducer (AHT) was added (Fig.
3). These results are also in agreement with insertional mutants
generated by transposon mutagenesis. Transposon insertions into the
nreB gene at sites encoding the histidine-rich C-terminal domain resulted in only a slight decrease in nickel resistance, whereas
insertions into other parts of the gene completely abolished nickel
resistance (Table 3).
Expression of NreB is responsible for reduced uptake of
63Ni
2+ in
E. coli W3110. Since NreB
is predicted to be a cytoplasmic membrane
protein and responsible for
Ni
2+ resistance, we examined whether cells expressing
nreB exhibit
decreased Ni
2+ uptake in
E. coli W3110, reflecting increased efflux. Alternately,
resistance
could be due to binding of the metal by the C-terminal
histidine-rich
domain of NreB. Binding should increase the amount
of metal ions in
resistant cells compared to that in sensitive
ones, while efflux should
decrease the concentration of cytosolic
metal ions. When levels of
cell-bound metal ions in cells with
and without expression of
nreB were compared, resistant cells
contained only 40% of
the
63Ni
2+ that the respective control cells
contained after 25 min (Fig.
4). Thus,
expression of
nreB resulted in reduced accumulation
of
Ni
2+.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 4.
63Ni2+ uptake by E. coli W3110 expressing nreB. Cells were grown overnight
in Luria-Bertani medium and diluted 100-fold into fresh Luria-Bertani
medium. The cells were grown to an optical density at 600 nm of 0.8 and
induced with AHT at 0.2 µg/ml. After growth for 2.5 h, the cells
were washed with buffer and concentrated fourfold in buffer.
63Ni2+ was added to a final concentration of 5 µM. The cells were incubated at 37°C, and 0.1-ml aliquots were
filtered through a nitrocellulose membrane (0.45-µm pore size) at
various times and immediately washed with 10 ml of buffer. The
membranes were dried, and radioactivity was determined using a liquid
scintillation counter. The protein concentration was determined using
the bicinchoninic acid kit (Sigma), and the Ni2+
concentration per milligram of protein was calculated. E. coli W3110(pASK-IBA3), ; E. coli W3110(pNREB),
.
|
|
 |
DISCUSSION |
The results of this study suggest that NreB from A. xylosoxidans is responsible for nickel resistance by efflux. NreB
is most closely related to proteins of the DHA3 family of the MFS (TC no. 2.A.1.21.5). MFS transporters have been shown to transport small
solutes in response to a chemiosmotic gradient (20). Prior to this study, proteins of the MFS had not been shown to transport metals. The closest homolog of NreB is the NrsD protein from
Synechocystis sp. strain PCC 6803 (6). Computer
analysis of both NreB and NrsD suggests the presence of 12 transmembrane helices and histidine-rich C-termini in both proteins.
Metal binding of the histidine-rich domain from NrsD was evaluated
using metal affinity chromatography and showed that this domain has a
low specificity for metal binding (6). In this report, we
show that the histidine-rich domain is not essential for NreB function.
Transposon insertions into the nreB gene at sequences
encoding the histidine-rich domain slightly reduced nickel resistance
but did not abolish it. However, insertions into other regions of the
nreB gene resulted in complete loss of nickel resistance.
Furthermore, truncated NreB still conferred nickel resistance on
E. coli when the gene encoding it was induced with AHT.
However, in cells where nreB was not induced, there was a
significant loss of nickel resistance compared to cells producing the
complete protein. These results suggest that this domain binds nickel,
thereby making nickel transport more efficient.
The mechanism of NreB resistance is most likely the result of nickel
efflux coupled to a chemiosmotic gradient. Consistent with this
hypothesis, cells of E. coli W3110 expressing
nreB exhibited reduced uptake of nickel compared to a
control without nreB. This is the first example of an MFS
protein catalyzing metal ion transport. However, at this point, the
actual substrate of NreB is not known, as it might be the free
cation or a metal conjugate. Other nickel resistance
determinants, such as those encoded by cnr and
ncc, are close homologues of the better-studied
czc determinant from R. metallidurans CH34. The
czcCBA gene products form a membrane-bound protein complex
catalyzing Co2+, Zn2+, and Cd2+
efflux by a proton-cation antiporter in R. metallidurans
CH34 (7, 16, 19). The actual substrate transported is also
not known for CzcCBA, NccCBA, or CnrCBA. NreB is more specific for nickel, while NccCBA and CnrCBA have a broad range of metal ion substrates. In addition to nickel, they also transport cobalt and
cadmium (ncc) and cobalt and zinc (cnr)
(28). It is not known how nreB is regulated;
however, nreB is induced by nickel and not by cobalt or
zinc, consistent with the specificity of metal resistance.
Transcriptional analysis was performed with A. xylosoxidans
31A harboring both the ncc and nre determinants. Therefore, over time, the decrease in transcription of a
(nreB-lacZ) operon fusion can be attributed to nickel
efflux by NreB and NccCBA. This is similar to the self-repression of
the ars operon that occurs when the ArsAB pump extrudes the
inducer arsenite and transcript levels return to uninduced levels
(18).
 |
ACKNOWLEDGMENTS |
This work was supported by hatch project 136713 to C.R. and U.S.
Public Health Service grant GM 55425 to B.P.R.
We thank T. Schmidt for providing nreB Tn5 mutants.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Soil, Water, and Environmental Science, University of Arizona, Shantz Bldg. #38, Rm. 429, Tucson, AZ 85721. Phone: (520) 626-8482. Fax: (520)
621-1647. E-mail: rensingc{at}ag.arizona.edu.
 |
REFERENCES |
| 1.
|
Babich, H., and G. Stotzky.
1983.
Toxicity of nickel to microbes: environmental aspects.
Adv. Appl. Microbiol.
29:195-265[Medline].
|
| 2.
|
Bibb, M. J.,
P. R. Findlay, and M. W. Johnson.
1984.
The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable identification of protein-coding sequences.
Gene
30:157-166[CrossRef][Medline].
|
| 3.
|
Costa, M., and C. B. Klein.
1999.
Nickel carcinogenesis, mutation, epigenetics, or selection.
Environ. Health Perspect.
107:A438-439[Medline].
|
| 4.
|
Deretic, V.,
S. Chandrasekharappa,
J. F. Gill,
D. K. Chatterjee, and A. Chakrabarty.
1987.
A set of cassettes and improved vectors for genetic and biochemical characterization of Pseudomonas genes.
Gene
57:61-72[CrossRef][Medline].
|
| 5.
|
Friedrich, C. G.,
K. Schneider, and B. Friedrich.
1982.
Nickel is in the catalytically active hydrogenase of Alcaligenes eutrophus.
J. Bacteriol.
152:42-48[Abstract/Free Full Text].
|
| 6.
|
Garcia-Dominguez, M.,
L. Lopez-Maury,
F. J. Florencio, and J. C. Reyes.
2000.
A gene cluster involved in metal homeostasis in the cyanobacterium Synechocystis sp. strain PCC 6803.
J. Bacteriol.
182:1507-1514[Abstract/Free Full Text].
|
| 7.
|
Goldberg, M.,
T. Pribyl,
S. Juhnke, and D. H. Nies.
1999.
Energetics and topology of CzcA, a cation/proton antiporter of the resistance-nodulation-cell division protein family.
J. Biol. Chem.
274:26065-26070[Abstract/Free Full Text].
|
| 8.
|
Grass, G.,
C. Große, and D. H. Nies.
2000.
Regulation of the cnr cobalt and nickel resistance determinant from Ralstonia sp. strain CH34.
J. Bacteriol.
182:1390-1398[Abstract/Free Full Text].
|
| 9.
|
Große, C.,
G. Grass,
A. Anton,
S. Franke,
A. Navarrete Santos,
B. Lawley,
N. L. Brown, and D. H. Nies.
1999.
Transcriptional organization of the czc heavy metal homesotasis determinant from Alcaligenes eutrophus.
J. Bacteriol.
181:2385-2393[Abstract/Free Full Text].
|
| 10.
|
Hausinger, R. P.
1987.
Nickel utilization by microorganisms.
Microbiol. Rev.
51:22-42[Free Full Text].
|
| 11.
|
Kyte, J., and R. F. Doolittle.
1982.
A simple method for displaying the hydropathic character of a protein.
J. Mol. Biol.
157:105-132[CrossRef][Medline].
|
| 12.
|
Lemke, K.
1993.
Schwermetallresistenz in den zwei Alcaligenes-Stämmen A. eutrophus CH34 und A. xylosoxydans 31A: Transposonmutagenese, Klonierung und Sequenzierung. Ph. D. dissertation.
Universität Göttingen, Göttingen, Germany.
|
| 13.
|
Mergeay, M.,
D. Nies,
H. G. Schlegel,
J. Gerits,
J. Charles, and F. van Gijsegem.
1985.
Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to heavy metals.
J. Bacteriol.
162:328-334[Abstract/Free Full Text].
|
| 14.
|
Miller, J. H.
1992.
A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 15.
|
Nies, D. H.,
M. Mergeay,
B. Friedrich, and H. G. Schlegel.
1987.
Cloning of plasmid genes encoding resistance to cadmium, zinc, and cobalt in Alcaligenes eutrophus CH34.
J. Bacteriol.
169:4865-4868[Abstract/Free Full Text].
|
| 16.
|
Nies, D. H.,
A. Nies,
L. Chu, and S. Silver.
1989.
Expression and nucleotide sequence of a plasmid-determined divalent efflux system from Alcaligenes eutrophus.
Proc. Natl. Acad. Sci. USA
86:7351-7355[Abstract/Free Full Text].
|
| 17.
|
Nies, D. H.
1995.
The cobalt, zinc, and cadmium efflux system CzcABC from Alcaligenes eutrophus functions as a cation-proton antiporter in Escherichia coli.
J. Bacteriol.
177:2707-2712[Abstract/Free Full Text].
|
| 18.
|
Owolabi, J. B., and B. P. Rosen.
1990.
Differential mRNA stability controls relative gene expression within the plasmid-encoded arsenical resistance operon.
J. Bacteriol.
172:2367-2371[Abstract/Free Full Text].
|
| 19.
|
Rensing, C.,
T. Pribyl, and D. H. Nies.
1997.
New functions for the three subunits of the CzcCBA cation-proton antiporter.
J. Bacteriol.
179:6871-6879[Abstract/Free Full Text].
|
| 20.
|
Saier, M. H., Jr.,
J. T. Beatty,
A. Goffeau,
K. T. Harley,
W. H. Heijne,
S. C. Huang,
D. L. Jack,
P. S. Jahn,
K. Lew,
J. Liu,
S. S. Pao,
I. T. Paulsen,
T. T. Tseng, and P. S. Virk.
1999.
The major facilitator superfamily.
J. Mol. Microbiol. Biotechnol.
1:257-279[Medline].
|
| 21.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 22.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 23.
|
Schmidt, T.
1991.
Die plasmidkodierte Nickelresistenz von Alcaligenes xylosoxydans 31A: Klonierung und Expression beteiligter Gene. Ph. D. dissertation.
Universität Göttingen, Göttingen, Germany.
|
| 24.
|
Schmidt, T., and H. G. Schlegel.
1994.
Combined nickel-cobalt-cadmium resistance encoded by the ncc locus of Alcaligenes xylosoxidans 31A.
J. Bacteriol.
176:7045-7054[Abstract/Free Full Text].
|
| 25.
|
Simon, R.,
U. Priefer, and A. Pühler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria.
Bio/Technology
1:784-791[CrossRef].
|
| 26.
|
Tibazarwa, C.,
S. Wuertz,
M. Mergeay,
L. Wyns, and D. van der Lelie.
2000.
Regulation of the cnr cobalt and nickel resistance determinant of Ralstonia eutropha (Alcaligenes eutrophus) CH34.
J. Bacteriol.
182:1399-1409[Abstract/Free Full Text].
|
| 27.
|
Tseng, T. T.,
K. S. Gratwick,
J. Kollman,
D. Park,
D. H. Nies,
A. Goffeau, and M. H. Saier.
1999.
The RND permease superfamily: an ancient, ubiquitous and diverse family that includes human disease and development proteins.
J. Mol. Microbiol. Biotechnol.
1:107-125[Medline].
|
| 28.
|
Varma, A. K.,
C. Sensfuss, and H. G. Schlegel.
1990.
Inhibitor effects on the accumulation and efflux of nickel ions in plasmid pMOL28-harboring strains of Alcaligenes eutrophus.
Arch. Microbiol.
154:42-49[CrossRef].
|
Journal of Bacteriology, May 2001, p. 2803-2807, Vol. 183, No. 9
0021-9193/01/$04.00+0 DOI: 10.1128/JB.183.9.2803-2807.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chaintreuil, C., Rigault, F., Moulin, L., Jaffre, T., Fardoux, J., Giraud, E., Dreyfus, B., Bailly, X.
(2007). Nickel Resistance Determinants in Bradyrhizobium Strains from Nodules of the Endemic New Caledonia Legume Serianthes calycina. Appl. Environ. Microbiol.
73: 8018-8022
[Abstract]
[Full Text]
-
Mirete, S., de Figueras, C. G., Gonzalez-Pastor, J. E.
(2007). Novel Nickel Resistance Genes from the Rhizosphere Metagenome of Plants Adapted to Acid Mine Drainage. Appl. Environ. Microbiol.
73: 6001-6011
[Abstract]
[Full Text]
-
Wolfram, L., Haas, E., Bauerfeind, P.
(2006). Nickel Represses the Synthesis of the Nickel Permease NixA of Helicobacter pylori. J. Bacteriol.
188: 1245-1250
[Abstract]
[Full Text]
-
Rodrigue, A., Effantin, G., Mandrand-Berthelot, M.-A.
(2005). Identification of rcnA (yohM), a Nickel and Cobalt Resistance Gene in Escherichia coli. J. Bacteriol.
187: 2912-2916
[Abstract]
[Full Text]
-
Munkelt, D., Grass, G., Nies, D. H.
(2004). The Chromosomally Encoded Cation Diffusion Facilitator Proteins DmeF and FieF from Wautersia metallidurans CH34 Are Transporters of Broad Metal Specificity. J. Bacteriol.
186: 8036-8043
[Abstract]
[Full Text]
-
Grass, G., Thakali, K., Klebba, P. E., Thieme, D., Muller, A., Wildner, G. F., Rensing, C.
(2004). Linkage between Catecholate Siderophores and the Multicopper Oxidase CueO in Escherichia coli. J. Bacteriol.
186: 5826-5833
[Abstract]
[Full Text]
-
Heddle, J., Scott, D. J., Unzai, S., Park, S.-Y., Tame, J. R. H.
(2003). Crystal Structures of the Liganded and Unliganded Nickel-binding Protein NikA from Escherichia coli. J. Biol. Chem.
278: 50322-50329
[Abstract]
[Full Text]