This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brodsky, I. E.
Right arrow Articles by Falkow, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brodsky, I. E.
Right arrow Articles by Falkow, S.

 Previous Article  |  Next Article 

Journal of Bacteriology, June 2002, p. 3203-3213, Vol. 184, No. 12
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.12.3203-3213.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

mig-14 Is a Salmonella Gene That Plays a Role in Bacterial Resistance to Antimicrobial Peptides

Igor E. Brodsky,1* Robert K. Ernst,2 Samuel I. Miller,2 and Stanley Falkow1

Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, California 94305,1 Departments of Microbiology and Medicine, University of Washington, Seattle, Washington 981952

Received 29 January 2002/ Accepted 25 March 2002


arrow
ABSTRACT
 
It was previously demonstrated that the mig-14 gene of Salmonella enterica serovar Typhimurium is necessary for bacterial proliferation in the liver and spleen of mice following intragastric inoculation and that mig-14 expression, which is induced within macrophages, is under the control of the global regulator PhoP. Here we demonstrate that the mig-14 promoter is induced by growth in minimal medium containing low magnesium or acidic pH, consistent with regulation by PhoP. In addition, mig-14 is strongly induced by polymyxin B, protamine, and the mammalian antimicrobial peptide protegrin-1. While phoP is necessary for the induction of mig-14 in response to protamine and protegrin, mig-14 is still induced by polymyxin B in a phoP background. We also demonstrate that mig-14 is necessary for resistance of S. enterica serovar Typhimurium to both polymyxin B and protegrin-1. Gram-negative resistance to a variety of antimicrobial peptides has been correlated with modifications of lipopolysaccharide structure. However, we show that mig-14 is not required for one of these modifications, the addition of 4-aminoarabinose to lipid A. Additionally, sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of wild-type and mig-14 lipopolysaccharide also shows no detectable differences between the two strains. Therefore, mig-14 contributes to Salmonella resistance to antimicrobial peptides by a mechanism that is not yet fully understood.


arrow
INTRODUCTION
 
Salmonella enterica serovar Typhimurium is a gram-negative facultative intracellular pathogen that causes self-limiting gastroenteritis in humans and a disease resembling systemic typhoid fever in mice. After being ingested, Salmonella traverses the stomach and invades M cells in the Peyer's patches of the small intestinal epithelium (46). After invasion, the bacteria are engulfed by host macrophages (5, 22) in which they survive and replicate within a specialized compartment known as the Salmonella-containing vacuole (2). The two-component regulatory system encoded by the phoPQ operon is required for the ability of Salmonella to survive and replicate within these phagocytes (7, 29).

Gram-negative bacteria frequently utilize two-component systems consisting of a sensor kinase and a DNA binding component to sense and respond to a variety of conditions, including changes in pH, ion concentration, and osmolarity. The survival of Salmonella in different host environments requires coordinate regulation of many gene products in response to these changing environmental conditions. The PhoQ sensor kinase responds to changes in the concentration of Mg2+ ions and phosphorylates its cognate response regulator PhoP in environments containing micromolar concentrations of Mg2+ (10, 41). PhoP in turn activates a number of genes, including those necessary for intracellular survival and antimicrobial peptide resistance (8, 31).

Antimicrobial peptides are an essential aspect of host innate immune defense and are produced by macrophages, neutrophils, and mucosal epithelial cells (18). These peptides are small (2 to 4 kDa) cationic molecules of various structural classes that bind to and permeabilize bacterial membranes. Within host tissues, Salmonella is likely to encounter antimicrobial peptides in the intestine, where Paneth cells constitutively secrete them, as well as within the host cell phagosomes that fuse with antimicrobial peptide-containing vesicles (34, 38). The ability of pathogenic bacteria to resist killing by host antimicrobial peptides present in different host niches may therefore contribute to their virulence.

Salmonella resistance to antimicrobial peptides is frequently mediated by modifications to the lipopolysaccharide (LPS) component of the bacterial outer membrane. Complete LPS consists of an endotoxic component, lipid A, which is linked to a polysaccharide molecule consisting of a core oligosaccharide and a repeating sugar structure known as the O antigen (35). Environmentally induced modifications to the structure of lipid A are correlated with resistance to several classes of antimicrobial peptides. For example, substitution of the 4' phosphate with 4-aminoarabinose has been shown to be important for resistance to the antimicrobial peptide polymyxin B (PB) (13). Recently, it has been demonstrated that both 4' and 1 phosphates can be substituted with aminoarabinose (47), although substitution at the 4' phosphate is what has been correlated with resistance. PB is an amphipathic cationic molecule that binds to LPS and permeabilizes the outer and inner membranes of gram-negative bacteria by a mechanism thought to be similar to that of antimicrobial peptides (44, 49). Thus, resistance to PB often confers cross-resistance to some classes of mammalian antimicrobial peptides in vitro (39) and correlates with increased survival of Salmonella in neutrophils (43).

4-Aminoarabinose addition to lipid A and the addition of ethanolamine are controlled by a second two-component regulatory system encoded by pmrAB (13). The response regulator PmrA is regulated indirectly by PhoP through the PmrD protein (26). In addition, the PhoP-PhoQ system coordinately regulates several other unlinked loci involved in different LPS modifications that confer resistance to a number of structurally unrelated antimicrobial peptides (16, 17). Therefore, phoP mutants of Salmonella are highly sensitive to multiple classes of antimicrobial peptides due to an inability to generate several modified forms of LPS. In addition to LPS modifications, changes in expression of outer membrane proteins also play a role in conferring resistance to antimicrobial peptides. For example, the outer membrane protease PgtE has been shown to cleave alpha-helical antimicrobial peptides and is also regulated by the PhoP-PhoQ system (12). Furthermore, the rck gene found on the S. enterica serovar Typhimurium virulence plasmid encodes an outer membrane protein that confers increased resistance to complement killing when overexpressed in Escherichia coli (19). A recent screen in our laboratory for genes that can restore PB resistance to the mig-14 mutant identified rck (unpublished data). Although rck is not known to be regulated by PhoP, it is coexpressed in vitro with Salmonella genes that are induced within the macrophage vacuole (C. Detweiler and S. Falkow, unpublished data).

We examined the regulation and function of the Salmonella gene mig-14, which is dependent on PhoP for transcriptional activation within cultured macrophages (53) and contributes to oral virulence in mice (51). We demonstrate here that the mig-14 promoter is activated in minimal medium containing limiting concentrations of magnesium, low pH, or antimicrobial cationic peptides. The mig-14 promoter is upregulated in response to PB in a phoP-independent manner, suggesting the existence of additional regulators of mig-14. The mig-14 strain shows increased sensitivity to the antimicrobial peptides PB and protegrin-1 (PG-1), indicating that regulation of mig-14 by these peptides is functionally important. Analysis of mig-14 lipid A by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) and crude LPS preparations by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) showed no differences from the isogenic wild-type strain. Therefore, the mechanism by which Mig-14 contributes to antimicrobial peptide resistance remains to be elucidated.


arrow
MATERIALS AND METHODS
 
Media and culture conditions. Bacteria were grown overnight at 37°C with aeration in the N minimal medium of Nelson and Kennedy containing 10 mM MgCl2 (32) with modifications as previously described (40), except where otherwise indicated. The pH of the medium was buffered with either 100 mM Tris-HCl, pH 7.4, or 10 mM methyl-ethyl sulfanilamide, pH 5.8. All marked mutations were moved into the SL1344 background by transduction with P22HT by standard methods (27). The strains and plasmids used in this study are listed in Table 1.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Bacterial strains and plasmids used in this study

PB sensitivity assay. This assay was performed essentially as previously described (11). Briefly, bacterial strains were inoculated into modified N minimal medium at pH 7.4 containing 10 mM MgCl2. Stationary-phase cultures were harvested and washed three times in N minimal medium, pH 7.4, without MgCl2. Strains were then diluted 1:100 into one of four N minimal media: 10 mM MgCl2, pH 7.4; 10 µM MgCl2, pH 7.4; 10 mM MgCl2, pH 5.8; or 10 µM MgCl2, pH 5.8. Bacteria were incubated for 3 h at 37°C with aeration. Bacteria (5 x 104 to 1 x 105 per ml) from each culture condition were inoculated into Luria broth (LB) containing 2.5 µg of PB (8,070 U/g) (Sigma)/ml and grown for 1 h at 37°C with aeration. Serial dilutions of each culture were made in phosphate-buffered saline (PBS) and plated on selective agar. Percent survival was calculated either relative to the initial input or relative to the growth of each strain in LB in the absence of PB, as indicated in the text.

PG-1 sensitivity assay. Bacterial strains were grown as described above for the PB sensitivity assay. After the 3-h growth period, 5 x 104 to 1 x 105 bacteria per ml were added to 96-well plates containing 200 µl of LB with the appropriate concentration of peptide. Each 96-well plate was placed at 37°C on a platform shaker and gently agitated for 1 h. Each strain and peptide concentration was tested in triplicate. Appropriate dilutions were made in PBS and plated for CFU. Percent survival was calculated relative to bacteria treated in the absence of peptide.

Lipid A purification and MALDI-TOF analysis. Strains were grown overnight in the indicated medium, and LPS was purified by the Mg2+-ethanol precipitation method as previously described (4). Lipid A was purified by hydrolysis in 1% SDS at pH 4.5 (3). Before being applied on a sample plate, the lyophilized lipid A was dissolved in 5 µl of 5-chloro-2-mercaptobenzothiazole MALDI matrix in chloroform-methanol (1:1). Negative-ion MALDI-TOF was performed as described previously (6).

Construction of pmrD reporter plasmids. The promoter regions of pmrD (290 bases upstream of the start ATG) and pmrC (208 bases upstream of the start ATG) were amplified in a Stratagene RoboCycler with PCRSupermix (Gibco BRL) and standard PCR conditions. The primers used for pmrD were pmrD5', GCGAATTCAGTTTGGTC-ATCGTCCCGTTG, and pmrD3', GCGGATCCGTTTCACGCTGATTGTTCATAAC. The primers used for pmrC were pmrC5', GCGAATTCTCGAATTCGATCACCGCGCTG, and pmrC3', GCGGATCCGACTTCGGTGACGCTAATCGTG. The PCR products were cloned into the EcoRI-BamHI sites of the green fluorescent protein (GFP) reporter plasmid pFPV25 (52) to generate ppmrD::GFP and ppmrC::GFP.

Fluorescence-activated cell sorter-based analysis of promoter activity. Bacterial strains harboring reporter constructs were grown overnight in N minimal medium, pH 7.4, plus 10 mM MgCl2, harvested, washed in N minimal medium, pH 7.4, without MgCl2, and diluted 1:100 into minimal medium, pH 7.4, plus 10 mM MgCl2. Mid-log-phase bacteria (optical density at 600 nm, 0.5 to 0.6) were then inoculated into the indicated media and grown for 3 h to allow expression of GFP. Bacteria were diluted into PBS and analyzed by flow cytometry with a Becton Dickinson FACSCalibur and CellQuest acquisition and analysis software as previously described (52).


arrow
RESULTS
 
mig-14 is induced by low Mg2+ concentrations. In order to increase our understanding of mig-14 regulation and investigate the role of mig-14 in virulence, we used a mig-14::GFP transcriptional reporter fusion to determine the conditions necessary for induction or repression of mig-14. Previous work in our laboratory has demonstrated that mig-14 expression in macrophages requires the two-component regulatory system PhoP-PhoQ (53). Since this system is activated by low Mg2+ concentrations (10), we first examined expression of mig-14 in medium containing limiting concentrations of Mg2+. For comparison to other PhoP-regulated genes involved in antimicrobial peptide resistance, we made reporter fusions to the pmrC and pmrD promoters. pmrD is activated by PhoP, and the PmrD protein is thought to posttranscriptionally regulate the activity of PmrA (26). pmrC is the first gene of the pmrCAB operon and is cotranscribed with pmrAB (14). The pmrC promoter has been shown to be regulated by both PhoP and PmrA (14, 55). Therefore, the transcriptional activity of pmrD should be PhoP dependent but PmrA independent, whereas the activity of pmrC should be both PhoP and PmrA dependent.

Transcription from the mig-14 promoter was induced approximately 10-fold more in 10 µM MgCl2 than in 10 mM MgCl2 (Fig. 1A and Table 2). The pmrC and pmrD promoters were similarly induced in this low-magnesium medium. These data indicate that, like other PhoP-activated genes, mig-14 is induced by low concentrations of Mg2+. Also like other PhoP-activated genes, mig-14 promoter activity was constitutively induced to high levels in a strain containing constitutively activated PhoP even in medium with 10 mM MgCl2 (data not shown).



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 1. Fluorescence-activated cell-sorter analysis of wild-type (SL1344) S. enterica serovar Typhimurium harboring GFP reporter constructs (indicated at the top) grown in various conditions (listed on the right). The light histograms represent bacteria grown in N minimal medium, pH 7.4, and 10 mM MgCl2; the bold histograms represent bacteria grown in identical N minimal medium with additions or modifications as indicated. The activity of all three promoters is significantly induced by low Mg2+ and by antimicrobial peptides. (A) Induction by low Mg, low pH, and cationic antimicrobial peptides. (B) Induction by membrane-active detergents.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Fold induction of promoter activity in indicated medium conditiona

Because mig-14 is induced in the macrophage phagosome, we asked whether low pH would also induce mig-14 transcription. Indeed, we observed that low pH in the absence of low Mg2+ could induce mig-14 expression, albeit at lower levels than medium containing low Mg2+ alone (Table 2). There was no synergistic effect between magnesium and pH, as pH 5.8 medium also containing low Mg2+ did not show a greater fold induction of mig-14 than the low Mg2+ medium alone (data not shown).

mig-14 is induced by antimicrobial peptides. Recent work has demonstrated that PhoP activates a number of genes, including the two-component response regulator encoded by pmrA, that are important in Salmonella resistance to PB and some mammalian antimicrobial peptides (13). It is likely that Salmonella encounters antimicrobial peptides within host microenvironments during in vivo infection. These peptides may contribute to environmental signals that trigger changes in bacterial gene expression. We therefore examined the cationic peptides PB, protamine, and PG-1 to determine whether any or all of these could stimulate mig-14 gene expression. Protamine is a polycationic molecule present in sperm nuclei, and PG-1 is a mammalian antimicrobial peptide originally isolated from porcine leukocytes (25). In all cases, we observed that expression of GFP from the mig-14 reporter fusion was significantly higher in medium containing antimicrobial peptide than in medium without peptide. Similarly, the pmrC and pmrD reporters were also induced in media containing these antimicrobial peptides (Fig. 1A and Table 2). PB induced the greatest level of expression in all cases, with the pmrC promoter exhibiting the highest overall levels of induction. Expression of the phoP-independent gene rpsM was unaltered in all of the above conditions, demonstrating that these conditions specifically induce the expression of genes that are PhoP regulated (data not shown).

Exposure of bacteria to high concentrations of cationic peptides in most cases results in membrane damage and bacterial death. We therefore examined the membrane-active detergents Triton X-100 and SDS to determine whether exposure to membrane-damaging agents per se would induce expression of the mig-14 and pmr GFP reporters. In contrast to both pmrC and pmrD, mig-14 was only slightly induced by these detergents (Fig. 1B and Table 2). Interestingly, pmrC was markedly induced in the presence of SDS. phoP was required for the induction of these reporters in Triton X-100 and SDS, as this activation was not observed in the phoP::Tn10 mutant (Fig. 2B). However, we found that induction of the reporter fusions by these detergents was only observed in log-phase-grown bacteria. The nondetergent conditions induced expression of all three reporters regardless of the growth phase (data not shown). This is consistent with previous results that PhoP-regulated genes do not play a role in resistance to killing by Triton X-100 or SDS (54). These data suggest that in addition to pmrA, pmrD, and other PhoP-regulated genes, mig-14 may play a role in adaptive responses to membrane perturbations caused specifically by antimicrobial peptides.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 2. The phoP::Tn10 strain was used for the analysis described in the legend to Fig. 1. phoP is required for activation of all promoters by all conditions except for that of pmrC by low pH and mig-14 and pmrD by PB.

PB induces mig-14 in a phoP-independent manner. phoP was previously shown to be required for the induction of mig-14 in macrophages. We therefore asked whether phoP was also required for the induction of mig-14 in response to these in vitro conditions. As expected, we found that in a phoP::Tn10 strain background, expression of all three PhoP-regulated genes was reduced compared to that of the wild type (compare Fig. 1A and 2A; Table 2). We also found that phoP was required for induction of all three reporter constructs in low Mg2+, protamine, and PG-1. pmrC was still induced by low pH in a phoP::Tn10 background, consistent with previous results that the PmrA-PmrB system responds to low pH independently of PhoP-PhoQ (42). We also found that in contrast to the other antimicrobial peptides, PB induced expression of both mig-14 and pmrD reporter constructs even in the phoP::Tn10 background, although absolute levels of induction were lower than in the isogenic wild type (Fig. 2A and Table 2). This suggests that an additional system regulates gene expression in response to PB and possibly other antimicrobial peptides.

pmrA is not required for regulation of mig-14. It has been demonstrated that a subset of PhoP-regulated genes is directly controlled by an alternate two-component regulatory system encoded by pmrAB. We therefore examined the transcriptional responses of the mig-14, pmrC, and pmrD reporter fusions in a pmrA::Kan strain background. We found that induction of mig-14 and pmrD still occurred, in contrast to the pmrC reporter, which was no longer induced under any of the conditions tested (Fig. 3A). PmrB has been shown to sense both iron and pH, and it activates PmrA in response to high iron (56). We did not see induction of mig-14 in the presence of iron, confirming that mig-14 is not regulated directly by PmrA-PmrB (data not shown). However, in the case of the mig-14 reporter, expression levels in low Mg2+ and PB were significantly higher in the pmrA::Kan strain than in the wild type (Table 2). Furthermore, uninduced levels of pmrD were approximately twofold higher than in the wild-type strain. These data suggest that although pmrA is not required for induction of mig-14 or pmrD, it may be involved in feedback regulation.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 3. The pmrA::Kan strain was used for the analysis described in the legend to Fig. 1. pmrA is required for the activation of the pmrC promoter but not of the pmrD or mig-14 promoters.

mig-14 is necessary for inducible polymyxin resistance. We next investigated the functional significance of the ability of antimicrobial peptides to induce mig-14 promoter activity by examining the resistance of the mig-14::Kan strain to PB. Figure 4 shows survival data for Salmonella strains grown in various conditions followed by a 1-h exposure to 2.5 µg of PB/ml. Consistent with previously reported results, we observed that the wild-type strain, SL1344, was resistant to PB after growth in medium containing low concentrations (10 µM) of Mg2+. The mig-14::Kan mutant was approximately 5-fold more sensitive to PB in low-pH medium containing low Mg2+ and approximately 20-fold more sensitive in low-Mg2+ medium alone than the wild-type strain. As expected, the isogenic phoP::Tn10 strain was completely susceptible to PB challenge following growth in all of the conditions tested. Nearly 100% of the phoP::Tn10 strains were killed within the first 15 min of PB challenge (data not shown).



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 4. Survival of S. enterica serovar Typhimurium strains after a 1-h PB challenge. Bacterial strains were exposed to 2.5 µg of PB/ml in LB for 1 h after being grown in the following N minimal media: 10 µM MgCl2, pH 5.8 (dark grey bars); 10 mM MgCl2, pH 5.8 (white bars); 10 µM MgCl2, pH 7.4 (lined bars); and 10 mM MgCl2, pH 7.4 (light grey bars). WT refers to the SL1344 strain. Data are expressed relative to the input bacterial CFU. For ease of analysis, Mg2+ and pH conditions are indicated below the corresponding bars. For Mg2+, a plus sign refers to 10 mM and a minus sign refers to 10 µM MgCl2. For pH, a plus sign indicates pH 7.4 and a minus sign indicates pH 5.8. The mig-14::Kan strain is 10- to 20-fold more sensitive to polymyxin than the corresponding wild-type strain. The survival of the phoP::Tn10 strain was less than 1% for all conditions. Experiments were performed at least three times in triplicate, and the data presented are from a representative experiment.

mig-14::Kan sensitivity to polymyxin is complemented by overexpression of PmrD. Previous work has shown that overexpression of pmrD confers increased resistance to PB (37). This has been hypothesized to be due to increased expression of genes regulated by PmrA, which is positively regulated by PmrD (26). We transformed SL1344, mig-14::Kan, and pmrA::Kan strains with a plasmid, pKR301, that expresses pmrD from its native promoter to determine whether pmrD overexpression could restore wild-type levels of PB resistance to the mig-14 and pmrA strains. Overexpression of pmrD did indeed restore nearly wild-type levels of resistance to the mig-14::Kan mutant strain (Fig. 5). This effect was not due to nonspecific activity of the plasmid, since overexpression of pmrD failed to complement the pmrA::Kan strain, and the parent plasmid pHSG576 also did not confer increased PB resistance. The ability of pmrD overexpression to complement the PB sensitivity of the mig-14 strain suggests that mig-14 could participate in modification of LPS along with other genes regulated by PhoP-PhoQ and PmrA-PmrB. Alternatively, the complementation could be due to overexpression of genes regulated by PmrD and PmrA-PmrB which can bypass the defect in the mig-14 strain. In addition to restoring PB resistance with pmrD, we could also partially restore PB resistance to the mig-14 strain with a mig-14-expressing plasmid (data not shown). This plasmid had been previously used to complement the mig-14 mutant for virulence in oral infection of mice (51).



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 5. Survival of S. enterica serovar Typhimurium strains overexpressing pmrD after a 1-h PB challenge. Data are expressed relative to identical strains grown without PB for 1 h. Dark grey bars, 10 µM MgCl2, pH 5.8; white bars, 10 mM MgCl2, pH 5.8; lined bars, 10 µM MgCl2, pH 7.4; light grey bars, 10 mM MgCl2, pH 7.4. Bacterial strains harboring the pmrD-expressing plasmid pKR301 were treated as described in Materials and Methods. Overexpression of pmrD restored PB resistance to the mig-14::Kan strain but not to the pmrA::Kan mutant.

mig-14 is not required for addition of 4-aminoarabinose to LPS. A major mechanism of resistance to PB that is controlled by the PmrA-PmrB system is the addition of 4-aminoarabinose to the 4' phosphate group of lipid A (13, 20), though some evidence suggests that PB resistance can be restored to a sensitive mutant even in the absence of 4-aminoarabinose (13). To examine if Mig-14 participates in the addition of 4-aminoarabinose to lipid A, we analyzed lipid A of wild-type and mig-14 mutant strains by MALDI-TOF mass spectrometry as described in Materials and Methods. Lipid A was isolated from wild-type and isogenic mig-14::Kan strains after growth in N minimal medium containing 1 mM or 8 µM MgCl2. As expected, neither SL1344 nor mig-14::Kan strains grown in 1 mM MgCl2 contained detectable amounts of 4-aminoarabinose-modified LPS (Fig. 6A and C). However, when grown in limiting Mg2+ conditions, both strains synthesized 4-aminoarabinose lipid A as indicated by the presence of peaks at m/z of 1,945 and 2,183 (Fig. 6B and D). These data suggest that the increased sensitivity of the mig-14::Kan strain to PB is not due to a defect in 4-aminoarabinose modification of lipid A. Because MALDI-TOF (mass spectrometry) analysis is not quantitative, it is formally possible that there may be an overall reduction in the amount of 4-aminoarabinose containing lipid A in the outer membrane of the mig-14::Kan mutant strain.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 6. MALDI-TOF mass spectra of purified lipid A from wild-type (SL1344) and mig-14::Kan (mig14) strains. Strains were grown in N minimal medium containing either 1 mM (A and C) or 8 µM (B and D) MgCl2. The growth of both strains in 1 mM MgCl2 shows the expected peaks at an m/z of 2,036 (hepta-acylated wild-type LPS) and at an m/z of 1,797 (hexa-acylated LPS lacking palmitate). Analysis of LPS from the wild-type and mig-14::Kan strains grown in 8 µM MgCl2 yielded peaks at m/z of 2,183 and 1,929, which is consistent with the presence of hepta- and hexa-acylated forms of LPS containing the 4-aminoarabinose modification (B and D).

We next examined the global LPS profiles of the mig-14::Kan mutant by SDS-PAGE of crude bacterial preparations from wild-type, mig-14, phoP, and galE strains as described by Tsai and Frasch (48). Once again, no detectable differences in the LPS profiles of the wild-type and mig-14 strains were observed (data not shown). It is possible that there are other differences in the LPS structure or differences in the expression of outer membrane proteins that could account for the observed sensitivity of the mig-14::Kan strain to PB.

mig-14 is necessary for resistance to mammalian peptide PG-1. Sensitivity of Salmonella to PB has been shown to correlate with sensitivity to mammalian antimicrobial peptides. This finding has significant consequences for the infection process of this pathogen, as it encounters various antimicrobial peptides throughout the process of colonization within its host. It was recently demonstrated that strains of Proteus mirabilis selected for PB sensitivity also had increased sensitivity to PG-1 as well as defects in LPS structure (28). We therefore examined the sensitivity of wild-type, mig-14::Kan, and phoP::Tn10 strains to a panel of PG-1 concentrations. We observed a marked loss of resistance to PG-1 in the phoP mutant strain and saw intermediate levels of sensitivity to PG-1 in the mig-14 mutant (Fig. 7). While not as dramatic as that of the phoP strain, the sensitivity of the mig-14 mutant was nonetheless significantly lower than that of the isogenic wild-type strain, even at the lowest peptide concentration examined. The results were similar whether bacteria were grown in low Mg2+ alone or both in low Mg2+ and at low pH (data not shown). These results indicate that mig-14 is regulated by antimicrobial peptides and low-Mg2+ conditions that are likely to be present in some host microenvironments, and they suggest a functional link between this regulation and a role for mig-14 in resistance of S. enterica serovar Typhimurium to antimicrobial peptides.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 7. Sensitivity of S. enterica serovar Typhimurium strains to PG-1. Wild-type ({blacklozenge}), mig-14::Kan ({blacksquare}), and phoP::Tn10 ({blacktriangleup}) strains were grown overnight as described, washed, diluted in N minimal medium, pH 7.4, and 10 µM MgCl2, and grown for 3 h prior to being inoculated into LB containing the indicated concentrations of PG-1. The experiment was performed 3 times in triplicate, and the data shown are from a representative experiment. Data are expressed relative to bacteria treated without PG-1. mig-14::Kan is markedly attenuated in its ability to survive PG-1 treatment compared to the wild type, although not as drastically as phoP::Tn10.


arrow
DISCUSSION
 
mig-14 is a PhoP-activated gene of S. enterica serovar Typhimurium required for virulence in orally infected mice (51). It is induced within the macrophage vacuole in a phoP-dependent manner but is not required for bacterial survival and replication within macrophages in tissue culture (53). To better understand the role of mig-14 in Salmonella pathogenesis, we have characterized the regulation of mig-14 in a variety of in vitro conditions. mig-14 expression, as measured by mig-14::GFP reporter activity, was most strongly upregulated in medium containing low Mg2+ and cationic antimicrobial peptides such as PB, protamine, and PG-1. It is interesting that protamine as well as PB and PG-1 induced the expression of the reporter constructs, as it has been suggested that the antimicrobial action of protamine is mechanistically different than the membrane permeabilizing activity of PB and PG-1 (1).

The upregulation of mig-14::GFP and pmrD::GFP by PB showed a phoP-independent component as induction occurred even in the absence of an intact PhoP-PhoQ system. This observation suggests that other regulatory systems may activate mig-14, and perhaps other antimicrobial peptide resistance genes, directly in response to the presence of antimicrobial peptides. We further demonstrate that in addition to being induced by antimicrobial peptides, mig-14 is also required for bacterial resistance to killing by PB and PG-1.

The results of our PB resistance assays indicated that growth of bacteria in low Mg2+ was the strongest signal to induce PB-resistant adaptations, as we did not see significant resistance in bacteria grown at pH 5.8 in high Mg2+ (Fig. 4). This is in contrast to the results of Groisman et al. (11), who observed significant levels of resistance in pH 5.8 medium alone. The reasons for these differences are not fully understood, but one possible explanation is that there are subtle strain-specific differences in response to low-pH conditions. It is possible that these conditions did not produce optimal induction of the pH-responsive PmrA-PmrB system in our strain, resulting in reduced resistance. This is supported by the regulation studies, where we observed significantly higher levels of induction by Mg2+ than by low pH, even of the pmrC::GFP reporter, suggesting that we may not have achieved maximal induction of the pmrAB regulon. In the complementation experiments overexpressing pmrD, we did in fact observe significant levels of resistance in pH 5.8 medium alone. Regardless of the reasons for this subtle difference, the mig-14::Kan strain showed attenuated resistance to antimicrobial peptides in comparison to the wild type in all of our assays. Together, our data suggest that mig-14 participates with other PhoP-regulated genes in the adaptive responses of Salmonella to environmental conditions that include magnesium depletion and damage by cationic peptides.

PhoP and PhoQ comprise a two-component system that regulates a large number of genes in S. enterica serovar Typhimurium in response to a variety of nutrient starvation conditions (24). It has been appreciated for a number of years that the phoPQ regulon is necessary for Salmonella replication in macrophages and virulence in mouse models of infection (8, 29). Investigators also demonstrated that phoP-null mutants were attenuated in resistance to a number of antimicrobial peptides (7, 31). More recently, it has become clear that one of the functions of PhoP-regulated genes is to remodel the bacterial envelope in response to changing environmental conditions. This remodeling occurs both at the level of outer membrane protein expression (12, 30) and at the level of structural modifications of LPS (16). Both phoP mutants that are fixed in the constitutively active state and phoP-null mutants are unable to remodel the outer membrane in response to environmental signals and are avirulent in animal infections (30), suggesting that this remodeling is crucial for survival within the host environment.

A consensus PhoP binding site has been identified in E. coli by using the promoters of the genes mgtA and mgrB (23). We were not able to identify this consensus sequence in the promoter region of mig-14, suggesting that PhoP could regulate mig-14 indirectly. A number of PhoP-regulated genes, several of which are regulated indirectly through a second two-component system, PmrA-PmrB (14, 42) also lack this consensus sequence (41). PhoP activates PmrA via PmrD, which is thought to posttranscriptionally activate PmrA (26). Our results indicated that mig-14 is not regulated by PmrA-PmrB (Fig. 3). This suggests either that PhoP directly regulates mig-14 and binds to the mig-14 promoter at an uncharacterized binding site or that mig-14 may be regulated by as-yet-unidentified upstream regulatory genes. The induction of mig-14 by PB in a phoP background indicates that it is likely that there are other regulators of mig-14.

The PhoP-PhoQ and PmrA-PmrB regulatory systems participate in activating the transcription of gene products that generate several different modified forms of LPS. Substitution of lipid A with 4-aminoarabinose at one of the two phosphate groups is directly controlled by PmrA-PmrB and is an important mechanism of resistance to PB and several other antimicrobial peptides. Our data indicate that mig-14 is not required for the addition of 4-aminoarabinose to lipid A. Furthermore, we observed no changes in global LPS profiles of mig-14 bacteria by SDS-PAGE and silver staining (data not shown). This suggests that another mechanism is responsible for the contribution of the Mig-14 protein to antimicrobial resistance. Mig-14 could be involved in the addition of ethanolamine to the LPS core, which has also been shown to correlate with polymyxin resistance (20, 50). However, as ethanolamine addition takes place in E. coli K-12 (33, 57), which does not possess mig-14 (51), it is at least the case that ethanolamine addition can take place in the absence of mig-14 function.

While mig-14 is not necessary for colonization of the Peyer's patches, it plays a role in colonization of the spleen and liver following oral inoculation in a mouse model of typhoid (51). This observation and our results that mig-14 strains are more sensitive to antimicrobial peptides are consistent with the findings of Gunn et al., who demonstrate that certain polymyxin-sensitive mutants of Salmonella were strongly out-competed in replication by the wild-type strain in the liver and spleen following oral infection (15). The reduced virulence of the mig-14::Kan mutant is therefore consistent with the idea that the Mig-14 protein is necessary for resistance to killing by antimicrobial peptides within the host environment and contributes to Salmonella survival during in vivo infection. The sensitivity of the mig-14 strain to antimicrobial peptides could account for the attenuation of its virulence in mice following oral infection.

The precise role of Mig-14 in conferring protection from antimicrobial peptides is as yet unknown. However, our data suggest that mig-14 is likely to contribute to antimicrobial peptide resistance via a mechanism other than direct modification of LPS. A sequence present in Mig-14 shares homology with the helix-loop-helix motif of the AraC family of transcriptional regulatory proteins, suggesting that it could be a regulatory protein. Interestingly, a large number of AraC family members are involved in antibiotic resistance, stress response, and carbohydrate metabolism (9). We are pursuing further studies to establish the precise function of the Mig-14 protein and determine the mechanism by which it contributes to antimicrobial peptide resistance.


arrow
ACKNOWLEDGMENTS
 
We thank Corrie Detweiler, Erin Gaynor, Denise Monack, Scotty Merrell, and Sunny Shin for critical readings of the manuscript and members of the Falkow lab for helpful discussion. Michael Starnbach was very helpful in providing protocols for SDS-PAGE analysis of LPS. S. enterica serovar Typhimurium strain JKS 1379 and the pKR301 plasmid were generously provided by Kenneth Roland (Meganhealth, Inc.). pHSG576 was kindly provided by Jeff Stock (Princeton University). PG-1 was a kind gift of Tom Parr and Tim Falla (Intrabiotics).

This work was supported by grant AI26195 from the National Institutes of Health to S.F., grant RO1 AI30479 to R.K.E. and S.I.M., and Molecular Basis of Host Parasite Interaction training grant 5 T32 AI07328 to I.E.B.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305. Phone: (650) 723-2671. Fax: (650) 723-1837. E-mail: ibrodsky{at}leland.stanford.edu. Back


arrow
REFERENCES
 
    1
  1. Aspedon, A., and E. A. Groisman. 1996. The antibacterial action of protamine: evidence for disruption of cytoplasmic membrane energization in Salmonella typhimurium. Microbiology 142:3389-3397.[Abstract/Free Full Text]
    2. 2
  2. Buchmeier, N. A., and F. Heffron. 1991. Inhibition of macrophage phagosome-lysosome fusion by Salmonella typhimurium. Infect. Immun. 59:2232-2238.[Abstract/Free Full Text]
    3. 3
  3. Caroff, M., A. Tacken, and L. Szabo. 1988. Detergent-accelerated hydrolysis of bacterial endotoxins and determination of the anomeric configuration of the glycosyl phosphate present in the "isolated lipid A" fragment of the Bordetella pertussis endotoxin. Carbohydr. Res. 175:273-282.[CrossRef][Medline]
    4. 4
  4. Darveau, R. P., and R. E. Hancock. 1983. Procedure for isolation of bacterial lipopolysaccharides from both smooth and rough Pseudomonas aeruginosa and Salmonella typhimurium strains. J. Bacteriol. 155:831-838.[Abstract/Free Full Text]
    5. 5
  5. Darwin, K. H., and V. L. Miller. 1999. Molecular basis of the interaction of Salmonella with the intestinal mucosa. Clin. Microbiol. Rev. 12:405-428.[Abstract/Free Full Text]
    6. 6
  6. Ernst, R. K., E. C. Yi, L. Guo, K. B. Lim, J. L. Burns, M. Hackett, and S. I. Miller. 1999. Specific lipopolysaccharide found in cystic fibrosis airway Pseudomonas aeruginosa. Science 286:1561-1565.[Abstract/Free Full Text]
    7. 7
  7. Fields, P. I., E. A. Groisman, and F. Heffron. 1989. A Salmonella locus that controls resistance to microbicidal proteins from phagocytic cells. Science 243:1059-1062.[Abstract/Free Full Text]
    8. 8
  8. Fields, P. I., R. V. Swanson, C. G. Haidaris, and F. Heffron. 1986. Mutants of Salmonella typhimurium that cannot survive within the macrophage are avirulent. Proc. Natl. Acad. Sci. USA 83:5189-5193.[Abstract/Free Full Text]
    9. 9
  9. Gallegos, M. T., R. Schleif, A. Bairoch, K. Hofmann, and J. L. Ramos. 1997. Arac/XylS family of transcriptional regulators. Microbiol. Mol. Biol. Rev. 61:393-410.[Abstract]
    10. 10
  10. Garcia Vescovi, E., F. C. Soncini, and E. A. Groisman. 1996. Mg2+ as an extracellular signal: environmental regulation of Salmonella virulence. Cell 84:165-174.[CrossRef][Medline]
    11. 11
  11. Groisman, E. A., J. Kayser, and F. C. Soncini. 1997. Regulation of polymyxin resistance and adaptation to low-Mg2+ environments. J. Bacteriol. 179:7040-7045.[Abstract/Free Full Text]
    12. 12
  12. Guina, T., E. C. Yi, H. Wang, M. Hackett, and S. I. Miller. 2000. A PhoP-regulated outer membrane protease of Salmonella enterica serovar Typhimurium promotes resistance to alpha-helical antimicrobial peptides. J. Bacteriol. 182:4077-4086.[Abstract/Free Full Text]
    13. 13
  13. Gunn, J. S., K. B. Lim, J. Krueger, K. Kim, L. Guo, M. Hackett, and S. I. Miller. 1998. PmrA-PmrB-regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance. Mol. Microbiol. 27:1171-1182.[CrossRef][Medline]
    14. 14
  14. Gunn, J. S., and S. I. Miller. 1996. PhoP-PhoQ activates transcription of pmrAB, encoding a two-component regulatory system involved in Salmonella typhimurium antimicrobial peptide resistance. J. Bacteriol. 178:6857-6864.[Abstract/Free Full Text]
    15. 15
  15. Gunn, J. S., S. S. Ryan, J. C. Van Velkinburgh, R. K. Ernst, and S. I. Miller. 2000. Genetic and functional analysis of a PmrA-PmrB-regulated locus necessary for lipopolysaccharide modification, antimicrobial peptide resistance, and oral virulence of Salmonella enterica serovar Typhimurium. Infect. Immun. 68:6139-6146.[Abstract/Free Full Text]
    16. 16
  16. Guo, L., K. B. Lim, J. S. Gunn, B. Bainbridge, R. P. Darveau, M. Hackett, and S. I. Miller. 1997. Regulation of lipid A modifications by Salmonella typhimurium virulence genes phoP-phoQ. Science 276:250-253.[Abstract/Free Full Text]
    17. 17
  17. Guo, L., K. B. Lim, C. M. Poduje, M. Daniel, J. S. Gunn, M. Hackett, and S. I. Miller. 1998. Lipid A acylation and bacterial resistance against vertebrate antimicrobial peptides. Cell 95:189-198.[CrossRef][Medline]
    18. 18
  18. Hancock, R. E., and M. G. Scott. 2000. The role of antimicrobial peptides in animal defenses. Proc. Natl. Acad. Sci. USA 97:8856-8861.[Abstract/Free Full Text]
    19. 19
  19. Heffernan, E. J., J. Harwood, J. Fierer, and D. Guiney. 1992. The Salmonella typhimurium virulence plasmid complement resistance gene rck is homologous to a family of virulence-related outer membrane protein genes, including pagC and ail. J. Bacteriol. 174:84-91.[Abstract/Free Full Text]
    20. 20
  20. Helander, I. M., I. Kilpelainen, and M. Vaara. 1994. Increased substitution of phosphate groups in lipopolysaccharides and lipid A of the polymyxin-resistant pmrA mutants of Salmonella typhimurium: a 31P-NMR study. Mol. Microbiol. 11:481-487.[CrossRef][Medline]
    21. 21
  21. Hoiseth, S. K., and B. A. Stocker. 1981. Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature 291:238-239.[CrossRef][Medline]
    22. 22
  22. Jones, B. D., and S. Falkow. 1996. Salmonellosis: host immune responses and bacterial virulence determinants. Annu. Rev. Immunol. 14:533-561.[CrossRef][Medline]
    23. 23
  23. Kato, A., H. Tanabe, and R. Utsumi. 1999. Molecular characterization of the PhoP-PhoQ two-component system in Escherichia coli K-12: identification of extracellular Mg2+-responsive promoters. J. Bacteriol. 181:5516-5520.[Abstract/Free Full Text]
    24. 24
  24. Kier, L. D., R. M. Weppelman, and B. N. Ames. 1979. Regulation of nonspecific acid phosphatase in Salmonella: phoN and phoP genes. J. Bacteriol. 138:155-161.[Abstract/Free Full Text]
    25. 25
  25. Kokryakov, V. N., S. S. Harwig, E. A. Panyutich, A. A. Shevchenko, G. M. Aleshina, O. V. Shamova, H. A. Korneva, and R. I. Lehrer. 1993. Protegrins: leukocyte antimicrobial peptides that combine features of corticostatic defensins and tachyplesins. FEBS Lett. 327:231-236.[CrossRef][Medline]
    26. 26
  26. Kox, L. F., M. M. Wosten, and E. A. Groisman. 2000. A small protein that mediates the activation of a two-component system by another two-component system. EMBO J. 19:1861-1872.[CrossRef][Medline]
    27. 27
  27. Maloy, S. R., V. J. Stewart, and R. K. Taylor. 1996. Genetic analysis of pathogenic bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
    28. 28
  28. McCoy, A. J., H. Liu, T. J. Falla, and J. S. Gunn. 2001. Identification of Proteus mirabilis mutants with increased sensitivity to antimicrobial peptides. Antimicrob. Agents Chemother. 45:2030-2037.[Abstract/Free Full Text]
    29. 29
  29. Miller, S. I., A. M. Kukral, and J. J. Mekalanos. 1989. A two-component regulatory system (phoP phoQ) controls Salmonella typhimurium virulence. Proc. Natl. Acad. Sci. USA 86:5054-5058.[Abstract/Free Full Text]
    30. 30
  30. Miller, S. I., and J. J. Mekalanos. 1990. Constitutive expression of the phoP regulon attenuates Salmonella virulence and survival within macrophages. J. Bacteriol. 172:2485-2490.[Abstract/Free Full Text]
    31. 31
  31. Miller, S. I., W. S. Pulkkinen, M. E. Selsted, and J. J. Mekalanos. 1990. Characterization of defensin resistance phenotypes associated with mutations in the phoP virulence regulon of Salmonella typhimurium. Infect. Immun. 58:3706-3710.[Abstract/Free Full Text]
    32. 32
  32. Nelson, D. L., and E. P. Kennedy. 1971. Magnesium transport in Escherichia coli. Inhibition by cobaltous ion. J. Biol. Chem. 246:3042-3049.[Abstract/Free Full Text]
    33. 33
  33. Nummila, K., I. Kilpelainen, U. Zahringer, M. Vaara, and I. M. Helander. 1995. Lipopolysaccharides of polymyxin B-resistant mutants of Escherichia coli are extensively substituted by 2-aminoethyl pyrophosphate and contain aminoarabinose in lipid A. Mol. Microbiol. 16:271-278.[CrossRef][Medline]
    34. 34
  34. Ouellette, A. J. 1997. Paneth cells and innate immunity in the crypt microenvironment. Gastroenterology 113:1779-1784.[CrossRef][Medline]
    35. 35
  35. Raetz, C. R. 1996. Bacterial lipopolysaccharides: a remarkable family of bioactive amphiphiles, p. 1035-1063. In F. C. Neidhardt, R. Curtis III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
    36. 36
  36. Rathman, M., M. D. Sjaastad, and S. Falkow. 1996. Acidification of phagosomes containing Salmonella typhimurium in murine macrophages. Infect. Immun. 64:2765-2773.[Abstract]
    37. 37
  37. Roland, K. L., C. R. Esther, and J. K. Spitznagel. 1994. Isolation and characterization of a gene, pmrD, from Salmonella typhimurium that confers resistance to polymyxin when expressed in multiple copies. J. Bacteriol. 176:3589-3597.[Abstract/Free Full Text]
    38. 38
  38. Selsted, M. E., D. M. Brown, R. J. DeLange, and R. I. Lehrer. 1983. Primary structures of MCP-1 and MCP-2, natural peptide antibiotics of rabbit lung macrophages. J. Biol. Chem. 258:14485-14489.[Abstract/Free Full Text]
    39. 39
  39. Shafer, W. M., S. G. Casey, and J. K. Spitznagel. 1984. Lipid A and resistance of Salmonella typhimurium to antimicrobial granule proteins of human neutrophil granulocytes. Infect. Immun. 43:834-838.[Abstract/Free Full Text]
    40. 40
  40. Snavely, M. D., S. A. Gravina, T. T. Cheung, C. G. Miller, and M. E. Maguire. 1991. Magnesium transport in Salmonella typhimurium. Regulation of mgtA and mgtB expression. J. Biol. Chem. 266:824-829.[Abstract/Free Full Text]
    41. 41
  41. Soncini, F. C., E. Garcia Vescovi, F. Solomon, and E. A. Groisman. 1996. Molecular basis of the magnesium deprivation response in Salmonella typhimurium: identification of PhoP-regulated genes. J. Bacteriol. 178:5092-5099.[Abstract/Free Full Text]
    42. 42
  42. Soncini, F. C., and E. A. Groisman. 1996. Two-component regulatory systems can interact to process multiple environmental signals. J. Bacteriol. 178:6796-6801.[Abstract/Free Full Text]
    43. 43
  43. Stinavage, P., L. E. Martin, and J. K. Spitznagel. 1989. O antigen and lipid A phosphoryl groups in resistance of Salmonella typhimurium LT-2 to nonoxidative killing in human polymorphonuclear neutrophils. Infect. Immun. 57:3894-3900.[Abstract/Free Full Text]
    44. 44
  44. Storm, D. R., K. S. Rosenthal, and P. E. Swanson. 1977. Polymyxin and related peptide antibiotics. Annu. Rev. Biochem. 46:723-763.[CrossRef][Medline]
    45. 45
  45. Takeshita, S., M. Sato, M. Toba, W. Masahashi, and T. Hashimoto-Gotoh. 1987. High-copy-number and low-copy-number plasmid vectors for lacZ alpha-complementation and chloramphenicol- or kanamycin-resistance selection. Gene 61:63-74.[CrossRef][Medline]
    46. 46
  46. Takeuchi, A. 1967. Electron microscope studies of experimental Salmonella infection. I. Penetration into the intestinal epithelium by Salmonella typhimurium. Am. J. Pathol. 50:109-136.[Medline]
    47. 47
  47. Trent, M. S., A. A. Ribeiro, S. Lin, R. J. Cotter, and C. R. Raetz. 2001. An inner membrane enzyme in Salmonella and Escherichia coli that transfers 4-amino-4-deoxy-L-arabinose to lipid A: induction on polymyxin-resistant mutants and role of a novel lipid-linked donor. J. Biol. Chem. 276:43122-43131.[Abstract/Free Full Text]
    48. 48
  48. Tsai, C. M., and C. E. Frasch. 1982. A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal. Biochem. 119:115-119.[CrossRef][Medline]
    49. 49
  49. Vaara, M. 1992. Agents that increase the permeability of the outer membrane. Microbiol. Rev. 56:395-411.[Abstract/Free Full Text]
    50. 50
  50. Vaara, M., T. Vaara, M. Jensen, I. Helander, M. Nurminen, E. T. Rietschel, and P. H. Makela. 1981. Characterization of the lipopolysaccharide from the polymyxin-resistant pmrA mutants of Salmonella typhimurium. FEBS Lett. 129:145-149.[CrossRef][Medline]
    51. 51
  51. Valdivia, R. H., D. M. Cirillo, A. K. Lee, D. M. Bouley, and S. Falkow. 2000. mig-14 is a horizontally acquired, host-induced gene required for Salmonella enterica lethal infection in the murine model of typhoid fever. Infect. Immun. 68:7126-7131.[Abstract/Free Full Text]
    52. 52
  52. Valdivia, R. H., and S. Falkow. 1996. Bacterial genetics by flow cytometry: rapid isolation of Salmonella typhimurium acid-inducible promoters by differential fluorescence induction. Mol. Microbiol. 22:367-378.[CrossRef][Medline]
    53. 53
  53. Valdivia, R. H., and S. Falkow. 1997. Fluorescence-based isolation of bacterial genes expressed within host cells. Science 277:2007-2011.[Abstract/Free Full Text]
    54. 54
  54. van Velkinburgh, J. C., and J. S. Gunn. 1999. PhoP-PhoQ-regulated loci are required for enhanced bile resistance in Salmonella spp. Infect. Immun. 67:1614-1622.[Abstract/Free Full Text]
    55. 55
  55. Wosten, M. M., and E. A. Groisman. 1999. Molecular characterization of the PmrA regulon. J. Biol. Chem. 274:27185-27190.[Abstract/Free Full Text]
    56. 56
  56. Wosten, M. M., L. F. Kox, S. Chamnongpol, F. C. Soncini, and E. A. Groisman. 2000. A signal transduction system that responds to extracellular iron. Cell 103:113-125.[CrossRef][Medline]
    57. 57
  57. Zhou, Z., S. Lin, R. J. Cotter, and C. R. Raetz. 1999. Lipid A modifications characteristic of Salmonella typhimurium are induced by NH4VO3 in Escherichia coli K12. Detection of 4-amino-4-deoxy-L-arabinose, phosphoethanolamine and palmitate. J. Biol. Chem. 274:18503-18514.[Abstract/Free Full Text]

Journal of Bacteriology, June 2002, p. 3203-3213, Vol. 184, No. 12
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.12.3203-3213.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Wang, W.-B., Chen, I-C., Jiang, S.-S., Chen, H.-R., Hsu, C.-Y., Hsueh, P.-R., Hsu, W.-B., Liaw, S.-J. (2008). Role of RppA in the Regulation of Polymyxin B Susceptibility, Swarming, and Virulence Factor Expression in Proteus mirabilis. Infect. Immun. 76: 2051-2062 [Abstract] [Full Text]  
  • Eswarappa, S. M., Panguluri, K. K., Hensel, M., Chakravortty, D. (2008). The yejABEF operon of Salmonella confers resistance to antimicrobial peptides and contributes to its virulence. Microbiology 154: 666-678 [Abstract] [Full Text]  
  • Zavascki, A. P., Goldani, L. Z., Li, J., Nation, R. L. (2007). Polymyxin B for the treatment of multidrug-resistant pathogens: a critical review. J Antimicrob Chemother 60: 1206-1215 [Abstract] [Full Text]  
  • Alaniz, R. C., Cummings, L. A., Bergman, M. A., Rassoulian-Barrett, S. L., Cookson, B. T. (2006). Salmonella typhimurium Coordinately Regulates FliC Location and Reduces Dendritic Cell Activation and Antigen Presentation to CD4+ T cells. J. Immunol. 177: 3983-3993 [Abstract] [Full Text]  
  • Faucher, Séb. P., Porwollik, S., Dozois, C. M., McClelland, M., Daigle, F. (2006). Transcriptome of Salmonella enterica serovar Typhi within macrophages revealed through the selective capture of transcribed sequences. Proc. Natl. Acad. Sci. USA 103: 1906-1911 [Abstract] [Full Text]  
  • Brodsky, I. E., Gunn, J. S. (2005). A Bacterial Sensory System that Activates Resistance to Innate Immune Defenses: Potential Targets for Antimicrobial Therapeutics. Mol. Interv. 5: 335-337 [Abstract] [Full Text]  
  • Deslouches, B., Islam, K., Craigo, J. K., Paranjape, S. M., Montelaro, R. C., Mietzner, T. A. (2005). Activity of the De Novo Engineered Antimicrobial Peptide WLBU2 against Pseudomonas aeruginosa in Human Serum and Whole Blood: Implications for Systemic Applications. Antimicrob. Agents Chemother. 49: 3208-3216 [Abstract] [Full Text]  
  • Kim, W., Killam, T., Sood, V., Surette, M. G. (2003). Swarm-Cell Differentiation in Salmonellaenterica Serovar Typhimurium Results in Elevated Resistance to Multiple Antibiotics. J. Bacteriol. 185: 3111-3117 [Abstract] [Full Text]  
  • Wiese, A., Gutsmann, T., Seydel, U. (2003). Review: Towards antibacterial strategies: studies on the mechanisms of interaction between antibacterial peptides and model membranes. Innate Immunity 9: 67-84 [Abstract]  
  • Yeaman, M. R., Yount, N. Y. (2003). Mechanisms of Antimicrobial Peptide Action and Resistance. Pharmacol. Rev. 55: 27-55 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brodsky, I. E.
Right arrow Articles by Falkow, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brodsky, I. E.
Right arrow Articles by Falkow, S.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»