Previous Article | Next Article 
Journal of Bacteriology, August 2002, p. 4071-4080, Vol. 184, No. 15
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.15.4071-4080.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Rhizobium leguminosarum Has a Second General Amino Acid Permease with Unusually Broad Substrate Specificity and High Similarity to Branched-Chain Amino Acid Transporters (Bra/LIV) of the ABC Family
A. H. F. Hosie, D. Allaway, C. S. Galloway, H. A. Dunsby, and P. S. Poole*
School of Animal and Microbial Sciences, University of Reading, Reading RG6 6AJ, United Kingdom
Received 12 February 2002/
Accepted 2 May 2002

ABSTRACT
Amino acid uptake by
Rhizobium leguminosarum is dominated by
two ABC transporters, the general amino acid permease (Aap)
and the branched-chain amino acid permease (Bra
Rl). Characterization
of the solute specificity of Bra
Rl shows it to be the second
general amino acid permease of
R. leguminosarum. Although Bra
Rl has high sequence identity to members of the family of hydrophobic
amino acid transporters (HAAT), it transports a broad range
of solutes, including acidic and basic polar amino acids (
L-glutamate,
L-arginine, and
L-histidine), in addition to neutral amino acids
(
L-alanine and
L-leucine). While amino and carboxyl groups are
required for transport, solutes do not have to be

-amino acids.
Consistent with this, Bra
Rl is the first ABC transporter to
be shown to transport

-aminobutyric acid (GABA). All previously
identified bacterial GABA transporters are secondary carriers
of the amino acid-polyamine-organocation (APC) superfamily.
Also, transport by Bra
Rl does not appear to be stereospecific
as
D amino acids cause significant inhibition of uptake of
L-glutamate
and
L-leucine. Unlike all other solutes tested,
L-alanine uptake
is not dependent on solute binding protein BraC
Rl. Therefore,
a second, unidentified solute binding protein may interact with
the BraDEFG
Rl membrane complex during
L-alanine uptake. Overall,
the data indicate that Bra
Rl is a general amino acid permease
of the HAAT family. Furthermore, Bra
Rl has the broadest solute
specificity of any characterized bacterial amino acid transporter.

INTRODUCTION
The ABC superfamily is a large ubiquitous group of transporters
which possess a common minimum structure consisting of four
domains: two hydrophobic integral membrane domains and two ATP-binding
domains (
15,
20). The genome sequences indicate that humans
possess 48 ABC transporters (
9), while some bacteria have in
excess of 150 (
13,
57). Bacterial ABC transporters are involved
in a number of diverse processes, including multidrug resistance
(
53), protein secretion (
58), quorum sensing (
52), and nutrient
uptake (
16). The properties of a number of these transporters
are also being exploited as scientific tools, for example, for
vaccine development (
14) and as environmental biosensors (
4).
A subfamily of ABC transporters that are responsible for the uptake of solutes is found exclusively in prokaryotes (49). The members of this family can be distinguished from other ABC transporters by the presence of a solute binding protein (SBP), in addition to integral membrane domains and ATP-binding domains. This SBP is located in the periplasm of gram-negative bacteria and is attached to the cell membrane in gram-positive bacteria and Archaea (20). The SBP ABC transporters are required for the uptake of a variety of small molecules (including amino acids, metal ions, and sugars) and can accumulate solutes against very large concentration gradients (>10,000-fold) (15).
There are two main classes of ABC transporters of amino acids, the polar amino acid transporter (PAAT; transporter classification [T.C.] 3.A.1.3) and the hydrophobic amino acid transporter (HAAT; T.C. 3.A.1.4) families (25, 47). The PAAT family is one of the best-defined subclasses of SBP ABC transporters and includes the first ABC transporter to be sequenced, the histidine permease of Salmonella enterica serovar Typhimurium (17, 18). The ATP-binding protein of the His permease was also the first for which a crystal structure became available (26). In contrast, the HAAT family is poorly characterized, with only two recognized subclasses: the branched-chain amino acid transporters of Pseudomonas aeruginosa (BraPa) and Escherichia coli (LivEc; T.C. 3.A.1.4.1) (22, 33) and the neutral amino acid permease (Nat) of Synechococcus sp. strain PCC6903 (T.C. 3.A.1.4.2) (36). Although the membership of HAAT is increasing as the microbial genome sequencing projects are completed (25), the experimental characterization of these transporters is rarely carried out.
The rhizobia, a group of
-proteobacteria which includes Rhizobium, Mesorhizobium, Sinorhizobium, Bradyrhizobium, and Azorhizobium species, form a species-specific symbiotic relationship with leguminous plants in which the plant provides the bacteroid (symbiotic bacteria) a carbon source (C4-dicarboxylic acid), while the plant receives reduced atmospheric nitrogen from the bacteroid (8, 38). Prior to the establishment of a Rhizobium-legume symbiosis, bacteria must thrive in the soil environment, competing with many organisms for nutrients. Transporters of key nutrients, such as amino acids, may give a competitive advantage to rhizobia, allowing them to better colonize roots. This may account for the large number of high-affinity ABC transporters present in Sinorhizobium meliloti, Mesorhizobium loti, and Agrobacterium tumefaciens (13, 31, 57).
Uptake of amino acids by Rhizobium leguminosarum has been found to be due in part to the general amino acid permease (Aap; T.C. 3.A.1.3.8). This permease is a member of the PAAT subfamily of ABC transporters but is unusual in that it transports a broad range of amino acids (55). Typically members of PAAT will only transport a single amino acid or a group of structurally related amino acids (25, 54). For example, the ArtPIQMJ system of E. coli is very specific for arginine, while the HisJQMP system of S. enterica serovar Typhimurium will transport histidine and arginine (17, 56). The glutamate, glutamine, aspartate, and asparagine transporter (BztABCD) of Rhodobacter capsulatus (T.C. 3.A.1.3.7) is the only other reported broad-specificity transporter of the PAAT family (59).
Although mutation of aap significantly reduces the rate of uptake of most amino acids, a considerable rate is retained (55), indicating the presence of other transporters of these solutes in this organism. While studying the bidirectional transport of solutes by SBP ABC transporters, we identified a second high-affinity transporter of amino acids in R. leguminosarum (BraRl) (24). The braRl operon encodes five products, an SBP (BraCRl), two integral membrane proteins (BraDRl and BraERl), and two ATP-binding proteins (BraFRl and BraGRl). On the basis of sequence similarity, BraRl can be classified as a member of the HAAT family and is expected to transport neutral and aliphatic amino acids. For example, the similar LIV-I transporters of E. coli and P. aeruginosa transport neutral amino acids (i.e., leucine, isoleucine, valine, alanine, threonine, and possibly serine) (1, 23, 33, 41, 43). However, in this study we report that BraRl can transport a broad range of solutes, including polar amino acids and
-aminobutyric acid (GABA), in addition to hydrophobic and neutral amino acids. Therefore, BraRl is the second general amino acid permease of R. leguminosarum. Indeed, we show that D amino acids significantly inhibit uptake of solutes by BraRl, indicating that it may be a global amino acid transporter.

MATERIALS AND METHODS
Bacterial strains, plasmids, and culture conditions.
The bacterial strains and plasmids used in this study are detailed
in Table
1.
R. leguminosarum strains were grown at 28°C
on either tryptone-yeast extract (TY) (
5), acid minimal salts
medium (AMS), or acid minimal salts agar (AMA) (
40) with 10
mM
D-glucose and 10 mM ammonium chloride or 10 mM
L-glutamate
as the sole source of carbon and nitrogen. Antibiotics were
used at the following concentrations: streptomycin, 500 µg
ml
-1; kanamycin, 40 µg ml
-1; tetracycline, 2 (in AMS)
and 5 µg ml
-1 (in TY); gentamicin, 20 µg ml
-1; spectinomycin,
100 µg ml
-1.
Identification of HAAT genes in genomic sequences.
The
Sinorhizobium meliloti 1021,
Mesorhizobium loti MAFF303099,
and
Agrobacterium tumefaciens C58 genome sequences were searched
for HAAT orthologues by BLAST (
3) with
braCRl,
braFRl, and
braGRl as the query sequences. The searches were conducted by using
the facility provided at each of the relevant genome annotation
databases (
http://sequence.toulouse.inra.fr/meliloti.html,
http://www.kazusa.or.jp/rhizobase/,
and
http://cancer.lbi.ic.unicamp.br/agroC58/).
Genetic modification of bacterial strains.
Plasmids were conjugated into R. leguminosarum as described previously (40). The region of the bra operon located on the plasmids and cosmids and the sites of transposon insertion for mutants used in this study are shown in Fig. 1. Cosmid pIJ1427 was mutagenized as described by Simon et al. (50). Chromosomal braC mutations were made by conjugation of the mutated cosmid (pRU3158) into either A34 or RU1356. After purification, incompatible plasmid pPHJI1 was conjugated into each strain and the homogenotes were isolated by the technique of Ruvkun and Ausubel (45).
For complementation studies,
braC was amplified by PCR using
primers P273 (TTAGTGATGGTGATGGTGATGTGTCCCATAAAGGGGAGCGA) and
P274 (TCCGTGTCATCGTCTTGCTCTTAGG), cloned with a Zero Blunt TOPO
PCR cloning kit (Invitrogen Life Technologies), and subcloned
as an
EcoRI fragment into broad-host-range vector pRK415-1 (
32)
to form pRU826. A 5-kb
HpaI/
EcoRI fragment containing
braDEFG was cloned from pIJ1427 into pBluescript II SK(-) (Stratagene)
and transferred into pRK415-1 as a
KpnI fragment to form pRU733.
Transport assays.
R. leguminosarum uptake assays were performed by the rapid-filtration method as previously described (39). The final concentration of solute was 25 µM (0.125 µCi of 14C), and competing solutes were added to 0.5 mM. The kinetics of solute uptake by R. leguminosarum strains were determined by using various 14C-solute concentrations in standard uptake assays. All cultures were grown on liquid minimal salts with glucose and ammonium chloride.
Nucleotide sequence accession numbers.
The sequences of the regions of the R. leguminosarum genome containing the bra and bra2 operons were submitted to EMBL under accession no. AJ272047 and AJ427840, respectively.

RESULTS
Growth of R. leguminosarum strains on glutamate as the sole C and N source.
In previous studies we showed that strains of
R. leguminosarum that lack Aap are unable to grow on solid minimal media (AMA)
containing
L-glutamate (10 mM) as the sole source of carbon
and nitrogen (
55). Conversely, mutation of
bra (RU1131) did
not affect growth on solid minimal salts with
L-glutamate (10
mM) as the sole carbon and nitrogen source. However, during
preliminary studies to investigate the regulation of
aap and
bra, control cultures of an
aap mutant (RU1356) were observed
to grow on liquid minimal medium (AMS) with
L-glutamate (10
mM) as the sole carbon and nitrogen source, although RU1356
has a higher doubling time than the wild-type strain (19.8 ±
1.1 versus 8.7 ± 0.1 h, respectively). Also, the
bra mutant RU1131 did not grow as well as the wild-type strain on
liquid minimal salts with
L-glutamate (doubling time, 13.8 ±
0.4 h), and growth on
L-glutamate was eliminated in RU1357,
an
aap bra double mutant. The reason for the apparent contradiction
between growth on solid and liquid minimal salts media containing
L-glutamate is unknown. However, the data indicate that both
Aap and Bra
Rl are involved in the uptake of
L-glutamate in liquid
medium. This implies that the solute specificity of Bra
Rl is
not restricted to hydrophobic or neutral amino acids.
Although BraRl does not support growth on solid minimal salts medium with L-glutamate in an aap mutant, this may be due to insufficient expression of bra. To investigate this, the effect of increased gene copy number on growth was determined. When the cosmid containing the complete bra operon (pIJ1427) was present in aap mutants (RU1356 and RU1357), growth on L-glutamate was restored, while the same cosmid containing a transposon insertion in braE (pBIO206) did not restore growth. Similar restoration of growth was observed in aap mutants when plasmid pRU733, which contains braDEFG but which lacks braC, the SBP gene, was present. Therefore, BraRl can complement aap mutations for growth on solid minimal salts with L-glutamate, but only when the copy numbers of genes encoding the membrane-associated transport components are enhanced.
Uptake of amino acids by BraRl.
As BraRl allows growth on liquid minimal salts with L-glutamate and, in multicopy, allows growth on solid minimal salts with L-glutamate, it was considered possible that this permease might have a broader specificity than previously characterized members of HAAT. Therefore, the specificity of solute transport by BraRl was investigated by using a representative set of L amino acids (glutamate,
-aminoisobutyric acid [AIB], histidine, leucine, alanine, and arginine). Uptake of each of these amino acids in aap and braE mutants (RU1356 and RU1131, respectively) was decreased, with only negligible uptake in the aap braE double mutant (RU1357; Fig. 2A). Cosmids containing either aap (pRU3024) or bra (pIJ1427) were able to compensate for this loss of amino acid uptake, raising uptake rates for each amino acid above those observed in the wild-type strain, while control cosmids containing mutations in bra did not elevate the rate of amino acid transport (Fig. 2B). Strains containing braC mutations (RU1470 and RU1472) gave results similar to those for braE mutants, except that the rate of transport of L-alanine remained unchanged (Fig. 2). Therefore, transport of L-glutamate, AIB, L-histidine, L-leucine, and L-arginine is dependent on braC but L-alanine uptake is not. These data suggest that R. leguminosarum has an unidentified SBP, which interacts with the membrane components of BraRl during L-alanine uptake.
braC carried on a plasmid (pRU826) restored
L-glutamate,
L-histidine,
L-leucine,
L-arginine, and AIB uptake levels in RU1472 (
braC aap) to those of the unmutated strain (RU1356; Fig.
3B). In
plasmid pRU826,
braC is transcribed divergently from the vector
lac promoter, suggesting that a promoter for this gene is present
in the
braG-braC intergenic region. Also, complementation studies
confirmed that
braDEFG (pRU733) is sufficient to restore uptake
rates in
braE mutants for each amino acid tested (RU1357; Fig.
3A). If no promoter were present in the
braG-braC intergenic
region,
braDEFG alone would not be expected to complement
braE::Tn
5 (Fig.
3), as this mutation would be polar on
braC. A
braC promoter
would also be consistent with the large (498-bp) intergenic
region between
braG and
braC, while the genes encoding the other
transport components are probably cotranscribed from a promoter
upstream of
braD, as they are separated by only between 2 and
7 nucleotides.
The specificity of Bra
Rl was further investigated by uptake
competition experiments.
L-Leucine and
L-glutamate were selected,
as they represent high- and low-affinity solutes of Bra
Rl (see
below). Therefore, the relative affinities of competing solutes
(added at a 20-fold excess concentration) could be determined.
Strain RU1356 was used in these studies as the presence of Aap
in the wild-type strain would confound the results. Uptake of
L-[
14C]leucine was inhibited by the addition of all
L amino
acids tested, except
L-glutamate,
L-aspartate,
L-glutamine,
L-asparagine, and
L-arginine (Fig.
4A). However, the uptake
of
L-[
14C]glutamate was inhibited by all
L amino acids, including
those that did not inhibit
L-leucine uptake (Fig.
4B). This
difference between the inhibition of
L-leucine uptake and the
inhibition of
L-glutamate uptake most probably reflects a lower
affinity of Bra
Rl for
L-glutamate,
L-aspartate,
L-glutamine,
L-asparagine, and
L-arginine. Therefore, Bra
Rl has at least
as broad a solute specificity as Aap and is able to transport
polar amino acids as well as aliphatic amino acids.
Uptake of GABA by BraRl.
Nodules and
Rhizobium bacteroids contain high concentrations
of GABA (
44,
51), and this solute can be used as the sole carbon
and nitrogen source by rhizobia in vitro (
11,
29). However,
no transporter of GABA has been reported in rhizobia. Therefore,
the possible role of Aap or Bra in GABA uptake was investigated.
R. leguminosarum (A34) transported [
3H]GABA at a rate comparable
to that for amino acids tested (compare Fig.
5 and
2A). GABA
uptake in RU1131 (
bra mutant) was undetectable, and mutation
of
aap (RU1356) had no effect, indicating that Bra
Rl, but not
Aap, transports GABA. In uptake competition assays, GABA inhibited
the uptake of
L-leucine and
L-glutamate by Bra
Rl (Fig.
4A and B).
Similarly, solutes that inhibit uptake of
L-leucine and
L-glutamate also inhibit the uptake of GABA (Fig.
4C), confirming
that Bra
Rl transports GABA and thus that the reduced uptake
of GABA is not due to a secondary effect of a mutation of Bra
Rl on a separate GABA transporter.
Constraints on the solute specificity of BraRl.
To determine what constraints there are on solute structure
for transport by Bra
Rl, the effect of a range of solutes on
L-glutamate and
L-leucine uptake was determined (Fig.
4). Solutes
of Bra
Rl must possess both amino and carboxyl groups, as butyrate,
propionate, and butylamine did not inhibit
L-glutamate uptake.
The position of the amino group in relation to the carboxyl
group is not critical, as Bra
Rl can transport GABA, a

-amino
acid. Therefore, the specificity of Bra
Rl is not restricted
to

-amino acids, but the apparent affinity is highest for
L-

-amino
acids, as
L-

-aminobutyrate is a better inhibitor of
L-glutamate
and
L-leucine uptake than GABA.
The stereospecificity of characterized HAAT transporters has not been fully determined, and available data are ambiguous. Preliminary characterization of LivEc indicated that it could transport D-leucine but with a higher Km and lower Vmax than those for the L isomer (41). However, no data were presented in this initial report to substantiate these claims. In contrast, characterization of the binding properties of BraCPa indicated that a 100-fold excess of D-leucine did not inhibit the binding of L-leucine (21). Therefore, to determine the stereospecificity of BraRl, representative D amino acids (D-leucine, D-glutamate, D-alanine, D-histidine, and D-
-aminobutyrate) were used in competition uptake assays. Uptake of L-glutamate was inhibited by D-leucine, D-alanine, D-histidine, and D-
-aminobutyrate, but not by D-glutamate. L-Leucine uptake was inhibited by D-leucine and D-
-aminobutyrate (Fig. 4). Therefore, BraRl has a significant affinity for D amino acids but the affinity is lower than that for the corresponding L isomer. Furthermore, the apparent affinity for most D amino acids tested is greater than that for physiologically relevant solutes such as L-glutamate.
An SBP ABC transporter of urea and short-chain amides with similarity to branched-chain amino acid transporters of the HAAT family has been identified in Methylophilus methylotrophus (35). However, the solutes of this transporter (urea, acetamide, and formamide) had no effect on uptake of L-leucine or L-glutamate by BraRl (Fig. 4). Therefore, the solute specificity of BraRl is distinct from that of the urea and amide transporter.
Kinetics of solute uptake.
The kinetic constants of uptake confirm that BraRl is a high-affinity transporter of amino acids for which Km values are between 78 nM and 56 µM (Table 2). The Km for L-histidine uptake (78 nM) is lower than that for L-leucine uptake (205 nM), and the Vmax for L-glutamate uptake (17 nmol mg of protein-1 min-1) is the highest of those for the solutes tested. Therefore, these solutes are transported by BraRl under physiologically relevant conditions. The Km for L-glutamate uptake (56 µM) confirms that BraRl has a much lower affinity for this solute than for others tested, explaining its inability to inhibit uptake of L-leucine and GABA (Fig. 4A and C). The Km values for L-leucine, L-alanine, AIB, and L-histidine are each significantly lower for BraRl than for Aap (Table 2).
Growth of aap and bra mutants on amino acids as the sole carbon and nitrogen source.
Since the physiological relevance of Bra
Rl to
L-glutamate metabolism
was first revealed by growth studies, we examined the phenotypes
for the growth of
aap,
bra, and
aap bra mutants on amino acids
as the sole carbon and nitrogen sources in liquid culture. Although
single
aap and
bra mutants were able to grow on
L-glutamate,
L-glutamine,
L-asparagine,
L-proline,
L-serine,
L-arginine,
and
L-citrulline, the rate of growth was lower than that of
the wild-type strain. Mutation of both
aap and
bra abolished
growth on these solutes (Table
3). Therefore, both Bra
Rl and
Aap have an important physiological role in growth on a broad
range of amino acids. Also, the lack of growth of
bra mutants
on GABA confirmed that Bra
Rl is the main route of GABA uptake
in free-living
R. leguminosarum. Growth on
L-alanine and
L-histidine
was unaffected by mutation of
aap and
bra (Table
3), indicating
that
R. leguminosarum has other transporters of these solutes.
View this table:
[in this window]
[in a new window]
|
TABLE 3. Growth of R. leguminosarum strains following 7 days of incubation at 28°C on AMS liquid media containing various solutesa
|
Preliminary characterization of a second HAAT permease from R. leguminosarum.
During the course of these studies, the coding sequence for
a second HAAT-like permease of
R. leguminosarum (Bra2
Rl) was
identified on cosmid pRU3131. The partial sequence of this operon
(accession no.
AJ427840) indicated that it encoded at least
one SBP (Bra2C), two integral membrane proteins (Bra2DE), and
two nucleotide-binding proteins (Bra2FG), each with significant
homology to the corresponding proteins of other HAAT members
(e.g., see Bra2F
Rl in Fig.
6). However, mutation of this transport
operon did not affect uptake of
L-leucine or
L-alanine (data
not shown). Also, overexpression in RU1357 (
aap bra mutant)
did not result in increased uptake of any amino acid tested
(Fig.
2). Therefore,
R. leguminosarum has at least two HAAT
paralogues with different transport specificities or expression
profiles.
Comparison of BraRl and related sequences.
The completion of microbial genome sequences has revealed that
some species contain multiple HAAT paralogues. For example,
a search of the
Deinococcus radiodurans and
Archaeoglobus fulgidus sequences revealed four HAAT paralogues in each (
25). Therefore,
the incidence of HAAT proteins in rhizobia was investigated.
A search of the complete genome sequences of
S. meliloti and
M. loti indicated that each has at least five complete operons
resembling HAAT operons and three or four "orphan" BraC-like
binding proteins (allocated gene no. mll1986, mlr7182, mlr7721,
mlr9716, Sma0576, SMc00078, and Smc00513; see
http://sequence.toulouse.inra.fr/meliloti.html and
http://www.kazusa.or.jp/rhizobase/). A similar search of
the
Agrobacterium tumefaciens genome sequence revealed seven
complete operons resembling HAAT operons, with two located on
the At plasmid and the remainder distributed on the two chromosomes.
The sequences of BraFRl and BraGRl were aligned with the HAAT-like ABC proteins from S. meliloti, M. loti, Agrobacterium tumefaciens, P. aeruginosa, and E. coli (Fig. 6). The resulting tree indicates that BraRl has the highest identity to the LivEc and BraPa transporters, with orthologues in the sequenced rhizobia and Agrobacterium tumefaciens (SMc01948/9, mll3974/5, and Atu2424/5).

DISCUSSION
These data indicate that Bra
Rl is the second general amino acid
permease present in
R. leguminosarum. The previously described
Aap belongs to one subfamily of ABC transporters, PAAT, while
Bra
Rl belongs to the other main subfamily of ABC transporters
of amino acids, HAAT. Although the affinities of Aap and Bra
Rl for solutes differ (Table
2), these two transporters have overlapping
solute specificities, with each permease able to transport polar
amino acids (e.g.,
L-glutamate,
L-histidine, and
L-arginine)
and branched-chain amino acids (e.g.,
L-leucine) (Fig.
2). A
significant difference between Aap and Bra
Rl is their stereospecificities;
Aap is specific for
L amino acids (
39,
55), whereas Bra
Rl also
has significant affinity for
D amino acids (Fig.
4). As butylamine,
butyrate, and propionate do not inhibit uptake of Bra
Rl solutes,
solutes of Bra
Rl must possess amino and carboxyl groups. However,
the specificity of Bra
Rl is not restricted to

-amino acids as
GABA, a

-amino acid, is transported. Indeed, Bra
Rl is the first
ABC transporter to be shown to transport GABA. All previously
identified bacterial transporters of GABA, which include GabP
of
E. coli (
37) and GadC of
Lactococcus lactis (
48), are secondary
carriers of the amino acid-polyamine-organocation (APC) superfamily
and function as solute/cation symporters or solute/solute antiporters
(
27).
Both BraRl and Aap contribute to the ability of R. leguminosarum to grow on amino acids as the sole source of carbon and nitrogen, but growth of aap bra double mutants on L-alanine and L-histidine indicates that unidentified transporters of amino acids are present in this species (Table 3). A histidine transporter (HutXWV) of the quaternary amine uptake transporter family has been identified in S. meliloti (6). However, this permease is not present in all rhizobia as no apparent orthologue of hutXWV is present in the complete genome sequence of M. loti. An alternative candidate L-histidine transporter is the uncharacterized homologue of the HisJQMP permease of S. enterica serovar Typhimurium (17, 18), which has been identified in R. leguminosarum (25).
L-Alanine is clearly transported by BraRl, as mutation or overexpression of braDEFG alters the rate of uptake of this solute (Fig. 2). However, unlike that of other solutes, uptake of L-alanine is not dependent on BraCRl. Our present understanding of solute transport by SBP ABC transporters indicates that it is unlikely that the membrane components of this permease transport L-alanine without interaction with an SBP (16). Therefore, it is probable that another BraC-like SBP is involved in L-alanine uptake. However, no BraC-like genes are present in the immediate vicinity of the braRl operon (Fig. 1). The S. meliloti genome contains three orphan braC homologues that are not located near other transport components. It is possible that the proteins encoded by these genes interact with HAAT transporters encoded by genes located elsewhere on the genome. Although no such orphan braC-like genes have yet been identified in R. leguminosarum, an orphan L-alanine binding protein may interact with BraDEFGRl. The interaction of multiple SBPs with the membrane complex of ABC transporters is well established. For example, in S. enterica serovar Typhimurium hisJ and argT encode a histidine binding protein and an arginine, lysine, and ornithine binding protein, respectively (17), which interact with HisQMP, and in E. coli livK and livJ encode a leucine-specific binding protein and a leucine, isoleucine, and valine binding protein, respectively, which interact with LivHMGF (33).
The closely related branched-chain amino acid transporters in E. coli (LivEc; T.C. 3.A.1.4.1) and P. aeruginosa (BraPa) are the best-characterized members of the HAAT family. Although these transporters are referred to as branched-chain amino acid or LIV transporters, their specificity is broader than these names suggest. One of the two periplasmic binding proteins of LivEc (LivJ) binds L-threonine, L-alanine, and L-serine in addition to L-leucine, L-isoleucine, and L-valine, although the affinity for the former three solutes is lower than that for the latter three (41). Indeed, an investigation of L-alanine transport in E. coli confirmed that it is transported by LivEc (43). Also, the membrane complex of BraPa has been solubilized and reconstituted into proteoliposomes, and the transport of L-alanine and L-threonine by this permease was confirmed. However, the affinities of BraCPa for L-alanine and L-threonine (Kd, 3 to 5 µM) are much lower than those for L-leucine, L-isoleucine, and L-valine (Kd, 0.3 to 0.5 µM), indicating a preference for the transport of branched-chain amino acids (23). The reported specificity of BraPa is not as broad as that reported here for BraRl, as no significant uptake of L-glutamate or L-proline could be detected in proteoliposomes containing BraPa. Also, uptake of L-[14C]leucine was not inhibited by L-histidine, L-glutamate, L-glutamine, or L-proline (23). However, as the BraPa uptake assays were carried out with a final solute concentration of only 10 µM and as the competition experiments were performed with only a high-affinity solute (i.e., L-leucine), BraPa may have lower, but significant, affinity for other amino acids.
An investigation of amino acid uptake in cyanobacteria identified two open reading frames (ORFs) of Synechocystis sp. strain PCC 6803 (slr0467 and slr0559; T.C. 3.A.1.4.2) which, when mutated, produced a decreased rate of amino acid uptake. The product of ORF slr0467 (renamed natA) has 40% identity to BraFPa, and the product of slr0559 (natB) has 26% identity to BraCPa. Mutation of these genes resulted in an almost total impairment of uptake of a broad range of neutral amino acids (i.e., L-alanine, glycine, L-leucine, L-phenylalanine, L-proline, and L-serine), in addition to a 70% decrease in L-aspartate uptake and a 30% decrease in L-histidine uptake. Mutation of natA also decreased L-glutamate uptake by 30 to 50% (36). Since the characterization of this transporter relied exclusively on mutation analysis, further characterization is required to confirm the solute specificity, as mutation of natA and natB may have a secondary effect on the expression of other transporters. Nevertheless, the data suggest that the Nat permease of Synechocystis spp. is a broad-specificity amino acid transporter of the HAAT family. However, a comparison of the natA and the R. leguminosarum braF and braG sequences indicates that the Nat permease is more distantly related to LivEc and BraPa (Fig. 6). Mutation of a second ORF of Synechocystis sp. strain PCC 6803 with high sequence identity to ABC binding proteins of the HAAT family (sll0374) had no effect on the uptake of the 12 amino acids tested (36). Therefore, Synechocystis sp. strain PCC 6803 contains at least one member of the HAAT family with an apparent broad specificity for amino acids and another that is not involved in the uptake of amino acids under the conditions tested.
A high-affinity SBP ABC transporter of short-chain amides and urea has been identified in Methylophilus methylotrophus (35). The partial sequence of the operon encoding this transporter revealed three genes, fmdDEF, which encode an SBP and two integral membrane proteins, each with significant similarity to the corresponding proteins of LivEc and BraPa. So, although FmdDEF is involved in the uptake of urea and short-chain amides, it is a member of the HAAT family of ABC transporters. Thus, the solute specificities of transporters of the HAAT family extends beyond amino acids and includes short-chain amides and urea. However, the solute specificities of BraRl and Fmd do not overlap as urea, acetamide, and formamide do not inhibit solute uptake by BraRl (Fig. 4B). Therefore, the urea and amide transporters are a distinct subclass of the HAAT family.
The complete genome sequences of S. meliloti, M. loti, and Agrobacterium tumefaciens have revealed that these organisms contain a number of HAAT paralogues, and this work reports two R. leguminosarum HAAT permeases. It has been noted that S. meliloti has a high degree of paralogy, with many ancient gene duplications giving rise to a rich array of transport and regulatory proteins (13). This raises the question of the functions of the different paralogues. Do the HAAT paralogues differ in solute specificity and/or expression profile? The expression of one HAAT operon of S. meliloti (encoding SMb20602 to SMb20605 and SMb21707) is induced during nitrogen deprivation (34), and in Pseudomonas fluorescens, a HAAT operon is induced by growth in the plant rhizosphere (42). Therefore, some HAAT paralogues clearly function under specific physiological conditions. However, the data presented here caution against assigning solute specificity on the basis of homology to previously characterized transporters. Further research is required to gain a full understanding of the role of this ABC transporter family in bacterial physiology.
A general amino acid permease (Gap1) in Saccharomyces cerevisiae has been described (28). However, this is a secondary carrier of the amino acid/auxin permease family and is unique to eukaryotes (46). The general amino acid permeases of R. leguminosarum, Aap and BraRl, are the only characterized broad-host-range amino acid transporters of the ABC superfamily. Indeed, the characterization of BraRl has indicated that it has the broadest specificity of any characterized bacterial transporter of amino acids.

ACKNOWLEDGMENTS
This work was funded by the Biotechnology and Biological Sciences
Research Council of the United Kingdom.

FOOTNOTES
* Corresponding author. Mailing address: School of Animal and Microbial Sciences, University of Reading, Whiteknights, P.O. Box 228, Reading RG6 6AJ, United Kingdom. Phone: (44) 118 931 8895. Fax: (44) 118 931 6671. E-mail:
p.s.poole{at}reading.ac.uk.


REFERENCES
1 - Adams, M. D., L. M. Wagner, T. J. Graddis, R. Landick, and T. K. Antonucci. 1990. Nucleotide sequence and genetic characterization reveal six essential genes for the LIV-I and LS transport systems of Escherichia coli. J. Biol. Chem. 265:11436-11443.[Abstract/Free Full Text]
2 - Allaway, D., E. Lodwig, L. A. Crompton, M. Wood, T. R. Parsons, T. Wheeler, and P. S. Poole. 2000. Identification of alanine dehydrogenase and its role in mixed secretion of ammonium and alanine by pea bacteroids. Mol. Microbiol. 36:508-515.[CrossRef][Medline]
3 - Altschul, S. F., T. L. Madden, A. A. Schaffer, J. H. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
4 - Benson, D. E., D. W. Conrad, R. M. de Lorimer, S. A. Trammell, and H. W. Hellinga. 2001. Design of bioelectronic interfaces by exploiting hinge-bending motions in proteins. Science 293:1641-1644.[Abstract/Free Full Text]
5 - Beringer, J. E. 1974. R factor transfer in Rhizobium leguminosarum. J. Gen. Microbiol. 84:188-198.[Abstract/Free Full Text]
6 - Boncompagni, E., L. Dupont, T. Mignot, M. Osteras, A. Lambert, M. C. Poggi, and D. Le Rudulier. 2000. Characterization of a Sinorhizobium meliloti ATP-binding cassette histidine transporter also involved in betaine and proline uptake. J. Bacteriol. 182:3717-3725.[Abstract/Free Full Text]
7 - Borthakur, D., R. F. Barker, J. W. Latchford, L. Rossen, and A. W. B. Johnston. 1988. Analysis of pss genes of Rhizobium leguminosarum required for exopolysaccharide synthesis and nodulation of peas: their primary structure and their interaction with psi and other nodulation genes. Mol. Gen. Genet. 213:155-162.[CrossRef][Medline]
8 - Day, D. A., P. S. Poole, S. D. Tyerman, and L. Rosendahl. 2001. Ammonia and amino acid transport across symbiotic membranes in nitrogen-fixing legume nodules. Cell. Mol. Life Sci. 58:61-71.[CrossRef][Medline]
9 - Dean, M., A. Rzhetsky, and R. Allikmets. 2001. The human ATP-binding cassette (ABC) transporter superfamily. Genome Res. 11:1156-1166.[Abstract/Free Full Text]
10 - Downie, J. A., Q. S. Ma, C. D. Knight, G. Hombrecher, and A. W. B. Johnston. 1983. Cloning of the symbiotic region of Rhizobium leguminosarumthe nodulation genes are between the nitrogenase genes and a nifA-like gene. EMBO J. 2:947-952.[Medline]
11 - Dunn, M. F., G. Araiza, M. A. Cevallos, and J. Mora. 1997. Regulation of pyruvate carboxylase in Rhizobium etli. FEMS Microbiol. Lett. 157:301-306.[CrossRef][Medline]
12 - Freidman, A. M., S. R. Long, S. E. Brown, W. J. Buikema, and F. M. Ausubel. 1982. Construction of the broad host range cosmid cloning vector and its use in the genetic analysis of Rhizobium mutants. Gene 18:289-296.[CrossRef][Medline]
13 - Galibert, F., T. M. Finan, S. R. Long, A. Puhler, P. Abola, F. Ampe, F. Barloy-Hubler, M. J. Barnett, A. Becker, P. Boistard, G. Bothe, M. Boutry, L. Bowser, J. Buhrmester, E. Cadieu, D. Capela, P. Chain, A. Cowie, R. W. Davis, S. Dreano, N. A. Federspiel, R. F. Fisher, S. Gloux, T. Godrie, A. Goffeau, B. Golding, J. Gouzy, M. Gurjal, I. Hernandez-Lucas, A. Hong, L. Huizar, R. W. Hyman, T. Jones, D. Kahn, M. L. Kahn, S. Kalman, D. H. Keating, E. Kiss, C. Komp, V. Lalaure, D. Masuy, C. Palm, M. C. Peck, T. M. Pohl, D. Portetelle, B. Purnelle, U. Ramsperger, R. Surzycki, P. Thebault, M. Vandenbol, F. J. Vorholter, S. Weidner, D. H. Wells, K. Wong, K. C. Yeh, and J. Batut. 2001. The composite genome of the legume symbiont Sinorhizobium meliloti. Science 293:668-672.[Abstract/Free Full Text]
14 - Gentschev, I., G. Dietrich, and W. Goebel. 2002. The E. coli alpha-hemolysin secretion system and its use in vaccine development. Trends Microbiol. 10:39-45.[CrossRef][Medline]
15 - Higgins, C. F. 1992. ABC transporters: from microorganisms to man. Annu. Rev. Cell Biol. 8:67-113.[CrossRef]
16 - Higgins, C. F. 2001. ABC transporters: physiology, structure and mechanisman overview. Res. Microbiol. 152:205-210.[Medline]
17 - Higgins, C. F., and G. F.-L. Ames. 1981. Two periplasmic proteins which interact with a common membrane receptor show extensive homology: complete nucleotide sequences. Proc. Natl. Acad. Sci. USA 78:6038-6042.[Abstract/Free Full Text]
18 - Higgins, C. F., P. D. Haag, K. Nikaido, F. Ardeshir, G. Garcia, and G. F.-L. Ames. 1982. Complete nucleotide sequence and identification of membrane components of the histidine transport operon of S. typhimurium. Nature 298:723-727.[CrossRef][Medline]
19 - Hirsch, P. R., and J. E. Beringer. 1984. A physical map of pPH1JI and pJB4JI. Plasmid 12:139-141.[CrossRef][Medline]
20 - Holland, I. B., and M. A. Blight. 1999. ABC-ATPases, adaptable energy generators fuelling transmembrane movement of a variety of molecules in organisms from bacteria to humans. J. Mol. Biol. 293:381-399.[CrossRef][Medline]
21 - Hoshino, T., and M. Kageyama. 1980. Purification and properties of a binding protein for branched-chain amino acids in Pseudomonas aeruginosa. J. Bacteriol. 141:1055-1063.[Abstract/Free Full Text]
22 - Hoshino, T., and K. Kose. 1990. Cloning, nucleotide-sequences, and identification of products of the Pseudomonas aeruginosa PAO bra genes, which encode the high-affinity branched-chain amino acid transport system. J. Bacteriol. 172:5531-5539.[Abstract/Free Full Text]
23 - Hoshino, T., K. Koseterai, and K. Sato. 1992. Solubilization and reconstitution of the Pseudomonas aeruginosa high-affinity branched chain amino acid transport system. J. Biol. Chem. 267:21313-21318.[Abstract/Free Full Text]
24 - Hosie, A. H. F., D. Allaway, M. A. Jones, D. L. Walshaw, A. W. B. Johnston, and P. S. Poole. 2001. Solute-binding protein-dependent ABC transporters are responsible for solute efflux in addition to solute uptake. Mol. Microbiol. 40:1449-1459.[CrossRef][Medline]
25 - Hosie, A. H. F., and P. S. Poole. 2001. Bacterial ABC transporters of amino acids. Res. Microbiol. 152:259-270.[Medline]
26 - Hung, L. W., I. X. Y. Wang, K. Nikaido, P. Q. Liu, G. F. L. Ames, and S. H. Kim. 1998. Crystal structure of the ATP-binding subunit of an ABC transporter. Nature 396:703-707.[CrossRef][Medline]
27 - Jack, D. L., I. T. Paulsen, and M. H. Saier. 2000. The amino acid/polyamine/organocation (APC) superfamily of transporters specific for amino acids, polyamines and organocations. Microbiology 146:1797-1814.[Abstract/Free Full Text]
28 - Jauniaux, J. C., and M. Grenson. 1990. GAP1, the general amino acid permease gene of Saccharomyces cerevisiae. Nucleotide sequence, protein similarity with the other bakers yeast amino acid permeases, and nitrogen catabolite repression. Eur. J. Biochem. 190:39-44.[Medline]
29 - Jin, H. N., M. J. Dilworth, and A. R. Glenn. 1990. 4-Aminobutyrate is not available to bacteroids of cowpea Rhizobium MNF2030 in snake bean nodules. Arch. Microbiol. 153:455-462.[CrossRef]
30 - Johnston, A. W. B., and J. E. Beringer. 1975. Identification of the Rhizobium strains in pea root nodules using genetic markers. J. Gen. Microbiol. 87:343-350.[Abstract/Free Full Text]
31 - Kaneko, T., Y. Nakamura, S. Sato, E. Asamizu, T. Kato, S. Sasamoto, A. Watanabe, K. Idesawa, A. Ishikawa, K. Kawashima, T. Kimura, Y. Kishida, C. Kiyokawa, M. Kohara, M. Matsumoto, A. Matsuno, Y. Mochizuki, S. Nakayama, N. Nakazaki, S. Shimpo, M. Sugimoto, C. Takeuchi, M. Yamada, and S. Tabata. 2000. Complete genome structure of the nitrogen-fixing symbiotic bacterium Mesorhizobium loti. DNA Res. 7:331-338.[Abstract]
32 - Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70:191-197.[CrossRef][Medline]
33 - Landick, R., and D. L. Oxender. 1985. The complete nucleotide sequences of the Escherichia coli liv-bp and ls-bp genes. Implications for the mechanism of high-affinity branched-chain amino acid transport. J. Biol. Chem. 260:8257-8261.[Abstract/Free Full Text]
34 - Milcamps, A., D. M. Ragatz, P. Lim, K. A. Berger, and F. J. deBruijn. 1998. Isolation of carbon- and nitrogen-deprivation-induced loci of Sinorhizobium meliloti 1021 by Tn5-luxAB mutagenesis. Microbiology 144:3205-3218.[Abstract/Free Full Text]
35 - Mills, J., N. R. Wyborn, J. A. Greenwood, S. G. Williams, and C. W. Jones. 1998. Characterisation of a binding-protein-dependent, active transport system for short-chain amides and urea in the methylotrophic bacterium Methylophilus methylotrophus. Eur. J. Biochem. 251:45-53.[Medline]
36 - Montesinos, M. L., A. Herrero, and E. Flores. 1997. Amino acid transport in taxonomically diverse cyanobacteria and identification of two genes encoding elements of a neutral amino acid permease putatively involved in recapture of leaked hydrophobic amino acids. J. Bacteriol. 179:853-862.[Abstract/Free Full Text]
37 - Niegemann, E., A. Schulz, and K. Bartsch. 1993. Molecular organization of the Escherichia coli gab cluster: nucleotide sequence of the structural genes gabD and gabP and expression of the GABA permease gene. Arch. Microbiol. 160:454-460.[CrossRef][Medline]
38 - Poole, P. S., and D. A. Allaway. 2000. Carbon and nitrogen metabolism in Rhizobium. Adv. Microb. Physiol. 43:117-163.[Medline]
39 - Poole, P. S., M. Franklin, A. R. Glenn, and M. J. Dilworth. 1985. The transport of L-glutamate by Rhizobium leguminosarum involves a common amino acid carrier. J. Gen. Microbiol. 131:1441-1448.
40 - Poole, P. S., N. A. Schofield, C. J. Reid, E. M. Drew, and D. L. Walshaw. 1994. Identification of chromosomal genes located downstream of dctD that affect the requirement for calcium and the lipopolysaccharide layer of Rhizobium leguminosarum. Microbiology 140:2797-2809.[Abstract/Free Full Text]
41 - Rahmanian, M., D. R. Claus, and D. L. Oxender. 1973. Multiplicity of leucine transport systems in Escerichia coli K-12. J. Bacteriol. 116:1258-1266.[Abstract/Free Full Text]
42 - Rainey, P. B. 1999. Adaptation of Pseudomonas fluorescens to the plant rhizosphere. Environ. Microbiol. 1:243-257.[CrossRef][Medline]
43 - Robbins, J. C., and D. L. Oxender. 1973. Transport systems for alanine, serine and glycine in Escherichia coli K-12. J. Bacteriol. 116:12-18.[Abstract/Free Full Text]
44 - Rosendahl, L., C. P. Vance, and W. B. Pedersen. 1990. Products of dark CO2 fixation in pea root nodules support bacteroid metabolism. Plant Physiol. 93:12-19.[Abstract/Free Full Text]
45 - Ruvkun, G. B., and F. M. Ausubel. 1981. A general method for site-directed mutagenesis in prokaryotes. Nature 289:85-88.[CrossRef][Medline]
46 - Saier, M. H. 2000. Families of transmembrane transporters selective for amino acids and their derivatives. Microbiology 146:1775-1795.[Free Full Text]
47 - Saier, M. H. 2000. A functional-phylogenetic classification system for transmembrane solute transporters. Microbiol. Mol. Biol. Rev. 64:354-411.[Abstract/Free Full Text]
48 - Sanders, J. W., K. Leenhouts, J. Burghoorn, J. R. Brands, G. Venema, and J. Kok. 1998. A chloride-inducible acid resistance mechanism in Lactococcus lactis and its regulation. Mol. Microbiol. 27:299-310.[CrossRef][Medline]
49 - Saurin, W., M. Hofnung, and E. Dassa. 1999. Getting in or out: early segregation between importers and exporters in the evolution of ATP-binding cassette (ABC) transporters. J. Mol. Evol. 48:22-41.[CrossRef][Medline]
50 - Simon, R., U. Priefer, and A. Pühler. 1983. A broad host-range mobilization system for in vivo genetic engineering: transposon mutagenesis of gram-negative bacteria. Bio/Technology 1:784-791.[CrossRef]
51 - Streeter, J. G. 1987. Carbohydrate, organic acid, and amino acid composition of bacteroids and cytosol from soybean nodules. Plant Physiol. 85:768-773.[Abstract/Free Full Text]
52 - Taga, M. E., J. L. Semmelhack, and B. L. Bassler. 2001. The LuxS-dependent autoinducer Al-2 controls the expression of an ABC transporter that functions in Al-2 uptake in Salmonella typhimurium. Mol. Microbiol. 42:777-793.[CrossRef][Medline]
53 - van Veen, H. W., and W. N. Konings. 1998. The ABC family of multidrug transporters in microorganisms. Biochim. Biophys. Acta 1365:31-36.[Medline]
54 - Walshaw, D. L., S. Lowthorpe, A. East, and P. S. Poole. 1997. Distribution of a sub-class of bacterial ABC polar amino acid transporter and identification of an N-terminal region involved in solute specificity. FEBS Lett. 414:397-401.[CrossRef][Medline]
55 - Walshaw, D. L., and P. S. Poole. 1996. The general L-amino acid permease of Rhizobium leguminosarum is an ABC uptake system that influences efflux of solutes. Mol. Microbiol. 21:1239-1252.[CrossRef][Medline]
56 - Wissenbach, U., S. Six, J. Bongaerts, D. Ternes, S. Steinwachs, and G. Unden. 1995. A third periplasmic transport system for L-arginine in Escherichia coli: molecular characterization of the artPIQMJ genes, arginine binding and transport. Mol. Microbiol. 17:675-686.[CrossRef][Medline]
57 - Wood, D. W., J. C. Setubal, R. Kaul, D. E. Monks, J. P. Kitajima, V. K. Okura, Y. Zhou, L. Chen, G. E. Wood, N. F. Almeida, L. Woo, Y. C. Chen, I. T. Paulsen, J. A. Eisen, P. D. Karp, D. Bovee, P. Chapman, J. Clendenning, G. Deatherage, W. Gillet, C. Grant, T. Kutyavin, R. Levy, M. J. Li, E. McClelland, A. Palmieri, C. Raymond, G. Rouse, C. Saenphimmachak, Z. N. Wu, P. Romero, D. Gordon, S. P. Zhang, H. Y. Yoo, Y. M. Tao, P. Biddle, M. Jung, W. Krespan, M. Perry, B. Gordon-Kamm, L. Liao, S. Kim, C. Hendrick, Z. Y. Zhao, M. Dolan, F. Chumley, S. V. Tingey, J. F. Tomb, M. P. Gordon, M. V. Olson, and E. W. Nester. 2001. The genome of the natural genetic engineer Agrobacterium tumefaciens C58. Science 294:2317-2323.[Abstract/Free Full Text]
58 - Young, J., and I. B. Holland. 1999. ABC transporters: bacterial exporters-revisited five years on. Biochim. Biophys. Acta 1461:177-200.[Medline]
59 - Zheng, S., and R. Haselkorn. 1996. A glutamate/glutamine/aspartate/asparagine transport operon in Rhodobacter capsulatus. Mol. Microbiol. 20:1001-1011.[CrossRef][Medline]
Journal of Bacteriology, August 2002, p. 4071-4080, Vol. 184, No. 15
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.15.4071-4080.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Haudecoeur, E., Planamente, S., Cirou, A., Tannieres, M., Shelp, B. J., Morera, S., Faure, D.
(2009). Proline antagonizes GABA-induced quenching of quorum-sensing in Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA
106: 14587-14592
[Abstract]
[Full Text]
-
Prell, J., White, J. P., Bourdes, A., Bunnewell, S., Bongaerts, R. J., Poole, P. S.
(2009). Legumes regulate Rhizobium bacteroid development and persistence by the supply of branched-chain amino acids. Proc. Natl. Acad. Sci. USA
106: 12477-12482
[Abstract]
[Full Text]
-
Prell, J., Bourdes, A., Karunakaran, R., Lopez-Gomez, M., Poole, P.
(2009). Pathway of {gamma}-Aminobutyrate Metabolism in Rhizobium leguminosarum 3841 and Its Role in Symbiosis. J. Bacteriol.
191: 2177-2186
[Abstract]
[Full Text]
-
White, J. P., Prell, J., Ramachandran, V. K., Poole, P. S.
(2009). Characterization of a {gamma}-Aminobutyric Acid Transport System of Rhizobium leguminosarum bv. viciae 3841. J. Bacteriol.
191: 1547-1555
[Abstract]
[Full Text]
-
Webb, A. J., Homer, K. A., Hosie, A. H. F.
(2008). Two Closely Related ABC Transporters in Streptococcus mutans Are Involved in Disaccharide and/or Oligosaccharide Uptake. J. Bacteriol.
190: 168-178
[Abstract]
[Full Text]
-
Webb, A. J., Hosie, A. H. F.
(2006). A Member of the Second Carbohydrate Uptake Subfamily of ATP-Binding Cassette Transporters Is Responsible for Ribonucleoside Uptake in Streptococcus mutans. J. Bacteriol.
188: 8005-8012
[Abstract]
[Full Text]
-
Fox, M. A., White, J. P., Hosie, A. H. F., Lodwig, E. M., Poole, P. S.
(2006). Osmotic Upshift Transiently Inhibits Uptake via ABC Transporters in Gram-Negative Bacteria.. J. Bacteriol.
188: 5304-5307
[Abstract]
[Full Text]
-
Chevrot, R., Rosen, R., Haudecoeur, E., Cirou, A., Shelp, B. J., Ron, E., Faure, D.
(2006). GABA controls the level of quorum-sensing signal in Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA
103: 7460-7464
[Abstract]
[Full Text]
-
Meyer, A., Eskandari, S., Grallath, S., Rentsch, D.
(2006). AtGAT1, a High Affinity Transporter for {gamma}-Aminobutyric Acid in Arabidopsis thaliana. J. Biol. Chem.
281: 7197-7204
[Abstract]
[Full Text]
-
Revelles, O., Espinosa-Urgel, M., Molin, S., Ramos, J. L.
(2004). The davDT Operon of Pseudomonas putida, Involved in Lysine Catabolism, Is Induced in Response to the Pathway Intermediate {delta}-Aminovaleric Acid. J. Bacteriol.
186: 3439-3446
[Abstract]
[Full Text]
-
Hosie, A. H. F., Allaway, D., Poole, P. S.
(2002). A Monocarboxylate Permease of Rhizobium leguminosarum Is the First Member of a New Subfamily of Transporters. J. Bacteriol.
184: 5436-5448
[Abstract]
[Full Text]