Rhizobium leguminosarum Has a Second General Amino Acid Permease with Unusually Broad Substrate Specificity and High Similarity to Branched-Chain Amino Acid Transporters (Bra/LIV) of the ABC Family

Amino acid uptake by Rhizobium leguminosarum is dominated bytwo ABC transporters, the general amino acid permease (Aap)and the branched-chain amino acid permease (Bra_Rl). Characterizationof the solute specificity of Bra_Rl shows it to be the secondgeneral amino acid permease of R. leguminosarum. Although Bra_Rlhas high sequence identity to members of the family of hydrophobicamino acid transporters (HAAT), it transports a broad rangeof solutes, including acidic and basic polar amino acids (L-glutamate,L-arginine, and L-histidine), in addition to neutral amino acids(L-alanine and L-leucine). While amino and carboxyl groups arerequired for transport, solutes do not have to be ${alpha}$ -amino acids.Consistent with this, Bra_Rl is the first ABC transporter tobe shown to transport ${gamma}$ -aminobutyric acid (GABA). All previouslyidentified bacterial GABA transporters are secondary carriersof the amino acid-polyamine-organocation (APC) superfamily.Also, transport by Bra_Rl does not appear to be stereospecificas D amino acids cause significant inhibition of uptake of L-glutamateand L-leucine. Unlike all other solutes tested, L-alanine uptakeis not dependent on solute binding protein BraC_Rl. Therefore,a second, unidentified solute binding protein may interact withthe BraDEFG_Rl membrane complex during L-alanine uptake. Overall,the data indicate that Bra_Rl is a general amino acid permeaseof the HAAT family. Furthermore, Bra_Rl has the broadest solutespecificity of any characterized bacterial amino acid transporter.

INTRODUCTION

Top

Introduction

The ABC superfamily is a large ubiquitous group of transporterswhich possess a common minimum structure consisting of fourdomains: two hydrophobic integral membrane domains and two ATP-bindingdomains (15, 20). The genome sequences indicate that humanspossess 48 ABC transporters (9), while some bacteria have inexcess of 150 (13, 57). Bacterial ABC transporters are involvedin a number of diverse processes, including multidrug resistance(53), protein secretion (58), quorum sensing (52), and nutrientuptake (16). The properties of a number of these transportersare also being exploited as scientific tools, for example, forvaccine development (14) and as environmental biosensors (4).

A subfamily of ABC transporters that are responsible for theuptake of solutes is found exclusively in prokaryotes (49).The members of this family can be distinguished from other ABCtransporters by the presence of a solute binding protein (SBP),in addition to integral membrane domains and ATP-binding domains.This SBP is located in the periplasm of gram-negative bacteriaand is attached to the cell membrane in gram-positive bacteriaand Archaea (20). The SBP ABC transporters are required forthe uptake of a variety of small molecules (including aminoacids, metal ions, and sugars) and can accumulate solutes againstvery large concentration gradients (>10,000-fold) (15).

There are two main classes of ABC transporters of amino acids,the polar amino acid transporter (PAAT; transporter classification[T.C.] 3.A.1.3) and the hydrophobic amino acid transporter (HAAT;T.C. 3.A.1.4) families (25, 47). The PAAT family is one of thebest-defined subclasses of SBP ABC transporters and includesthe first ABC transporter to be sequenced, the histidine permeaseof Salmonella enterica serovar Typhimurium (17, 18). The ATP-bindingprotein of the His permease was also the first for which a crystalstructure became available (26). In contrast, the HAAT familyis poorly characterized, with only two recognized subclasses:the branched-chain amino acid transporters of Pseudomonas aeruginosa(Bra_Pa) and Escherichia coli (Liv_Ec; T.C. 3.A.1.4.1) (22, 33)and the neutral amino acid permease (Nat) of Synechococcus sp.strain PCC6903 (T.C. 3.A.1.4.2) (36). Although the membershipof HAAT is increasing as the microbial genome sequencing projectsare completed (25), the experimental characterization of thesetransporters is rarely carried out.

The rhizobia, a group of ${alpha}$ -proteobacteria which includes Rhizobium,Mesorhizobium, Sinorhizobium, Bradyrhizobium, and Azorhizobiumspecies, form a species-specific symbiotic relationship withleguminous plants in which the plant provides the bacteroid(symbiotic bacteria) a carbon source (C₄-dicarboxylic acid),while the plant receives reduced atmospheric nitrogen from thebacteroid (8, 38). Prior to the establishment of a Rhizobium-legumesymbiosis, bacteria must thrive in the soil environment, competingwith many organisms for nutrients. Transporters of key nutrients,such as amino acids, may give a competitive advantage to rhizobia,allowing them to better colonize roots. This may account forthe large number of high-affinity ABC transporters present inSinorhizobium meliloti, Mesorhizobium loti, and Agrobacteriumtumefaciens (13, 31, 57).

Uptake of amino acids by Rhizobium leguminosarum has been foundto be due in part to the general amino acid permease (Aap; T.C.3.A.1.3.8). This permease is a member of the PAAT subfamilyof ABC transporters but is unusual in that it transports a broadrange of amino acids (55). Typically members of PAAT will onlytransport a single amino acid or a group of structurally relatedamino acids (25, 54). For example, the ArtPIQMJ system of E.coli is very specific for arginine, while the HisJQMP systemof S. enterica serovar Typhimurium will transport histidineand arginine (17, 56). The glutamate, glutamine, aspartate,and asparagine transporter (BztABCD) of Rhodobacter capsulatus(T.C. 3.A.1.3.7) is the only other reported broad-specificitytransporter of the PAAT family (59).

Although mutation of aap significantly reduces the rate of uptakeof most amino acids, a considerable rate is retained (55), indicatingthe presence of other transporters of these solutes in thisorganism. While studying the bidirectional transport of solutesby SBP ABC transporters, we identified a second high-affinitytransporter of amino acids in R. leguminosarum (Bra_Rl) (24).The bra_Rl operon encodes five products, an SBP (BraC_Rl), twointegral membrane proteins (BraD_Rl and BraE_Rl), and two ATP-bindingproteins (BraF_Rl and BraG_Rl). On the basis of sequence similarity,Bra_Rl can be classified as a member of the HAAT family and isexpected to transport neutral and aliphatic amino acids. Forexample, the similar LIV-I transporters of E. coli and P. aeruginosatransport neutral amino acids (i.e., leucine, isoleucine, valine,alanine, threonine, and possibly serine) (1, 23, 33, 41, 43).However, in this study we report that Bra_Rl can transport abroad range of solutes, including polar amino acids and ${gamma}$ -aminobutyricacid (GABA), in addition to hydrophobic and neutral amino acids.Therefore, Bra_Rl is the second general amino acid permease ofR. leguminosarum. Indeed, we show that D amino acids significantlyinhibit uptake of solutes by Bra_Rl, indicating that it may bea global amino acid transporter.

MATERIALS AND METHODS

Top

Materials and Methods

Bacterial strains, plasmids, and culture conditions. The bacterial strains and plasmids used in this study are detailedin Table 1. R. leguminosarum strains were grown at 28°Con either tryptone-yeast extract (TY) (5), acid minimal saltsmedium (AMS), or acid minimal salts agar (AMA) (40) with 10mM D-glucose and 10 mM ammonium chloride or 10 mM L-glutamateas the sole source of carbon and nitrogen. Antibiotics wereused at the following concentrations: streptomycin, 500 µgml^-1; kanamycin, 40 µg ml^-1; tetracycline, 2 (in AMS)and 5 µg ml^-1 (in TY); gentamicin, 20 µg ml^-1; spectinomycin,100 µg ml^-1.

View this table:
[in this window]
[in a new window]
TABLE 1. Bacterial strains, cosmids, and plasmids used in this study

Identification of HAAT genes in genomic sequences. The Sinorhizobium meliloti 1021, Mesorhizobium loti MAFF303099,and Agrobacterium tumefaciens C58 genome sequences were searchedfor HAAT orthologues by BLAST (3) with braC_Rl, braF_Rl, and braG_Rlas the query sequences. The searches were conducted by usingthe facility provided at each of the relevant genome annotationdatabases (http://sequence.toulouse.inra.fr/meliloti.html, http://www.kazusa.or.jp/rhizobase/,and http://cancer.lbi.ic.unicamp.br/agroC58/).

Genetic modification of bacterial strains. Plasmids were conjugated into R. leguminosarum as describedpreviously (40). The region of the bra operon located on theplasmids and cosmids and the sites of transposon insertion formutants used in this study are shown in Fig. 1. Cosmid pIJ1427was mutagenized as described by Simon et al. (50). ChromosomalbraC mutations were made by conjugation of the mutated cosmid(pRU3158) into either A34 or RU1356. After purification, incompatibleplasmid pPHJI1 was conjugated into each strain and the homogenoteswere isolated by the technique of Ruvkun and Ausubel (45).

View larger version (16K):
[in this window]
[in a new window]
FIG. 1. Map of the bra operon. The region of the R. leguminosarum genome containing the bra operon is represented. Thin arrows, locations of the transposon insertions used to construct mutants used in this study. The orientations of the transposons are indicated by the directions of the arrows, representing the directions of transcription of the phoA and lacZ genes. The lines beneath the operon indicate the regions located on the cosmids or plasmids used in this study.

For complementation studies, braC was amplified by PCR usingprimers P273 (TTAGTGATGGTGATGGTGATGTGTCCCATAAAGGGGAGCGA) andP274 (TCCGTGTCATCGTCTTGCTCTTAGG), cloned with a Zero Blunt TOPOPCR cloning kit (Invitrogen Life Technologies), and subclonedas an EcoRI fragment into broad-host-range vector pRK415-1 (32)to form pRU826. A 5-kb HpaI/EcoRI fragment containing braDEFGwas cloned from pIJ1427 into pBluescript II SK(-) (Stratagene)and transferred into pRK415-1 as a KpnI fragment to form pRU733.

Transport assays. R. leguminosarum uptake assays were performed by the rapid-filtrationmethod as previously described (39). The final concentrationof solute was 25 µM (0.125 µCi of ¹⁴C), and competingsolutes were added to 0.5 mM. The kinetics of solute uptakeby R. leguminosarum strains were determined by using various¹⁴C-solute concentrations in standard uptake assays. All cultureswere grown on liquid minimal salts with glucose and ammoniumchloride.

Nucleotide sequence accession numbers. The sequences of the regions of the R. leguminosarum genomecontaining the bra and bra2 operons were submitted to EMBL underaccession no. AJ272047 and AJ427840, respectively.

RESULTS

Top

Results

Growth of R. leguminosarum strains on glutamate as the sole C and N source. In previous studies we showed that strains of R. leguminosarumthat lack Aap are unable to grow on solid minimal media (AMA)containing L-glutamate (10 mM) as the sole source of carbonand nitrogen (55). Conversely, mutation of bra (RU1131) didnot affect growth on solid minimal salts with L-glutamate (10mM) as the sole carbon and nitrogen source. However, duringpreliminary studies to investigate the regulation of aap andbra, control cultures of an aap mutant (RU1356) were observedto grow on liquid minimal medium (AMS) with L-glutamate (10mM) as the sole carbon and nitrogen source, although RU1356has a higher doubling time than the wild-type strain (19.8 ±1.1 versus 8.7 ± 0.1 h, respectively). Also, the bramutant RU1131 did not grow as well as the wild-type strain onliquid minimal salts with L-glutamate (doubling time, 13.8 ±0.4 h), and growth on L-glutamate was eliminated in RU1357,an aap bra double mutant. The reason for the apparent contradictionbetween growth on solid and liquid minimal salts media containingL-glutamate is unknown. However, the data indicate that bothAap and Bra_Rl are involved in the uptake of L-glutamate in liquidmedium. This implies that the solute specificity of Bra_Rl isnot restricted to hydrophobic or neutral amino acids.

Although Bra_Rl does not support growth on solid minimal saltsmedium with L-glutamate in an aap mutant, this may be due toinsufficient expression of bra. To investigate this, the effectof increased gene copy number on growth was determined. Whenthe cosmid containing the complete bra operon (pIJ1427) waspresent in aap mutants (RU1356 and RU1357), growth on L-glutamatewas restored, while the same cosmid containing a transposoninsertion in braE (pBIO206) did not restore growth. Similarrestoration of growth was observed in aap mutants when plasmidpRU733, which contains braDEFG but which lacks braC, the SBPgene, was present. Therefore, Bra_Rl can complement aap mutationsfor growth on solid minimal salts with L-glutamate, but onlywhen the copy numbers of genes encoding the membrane-associatedtransport components are enhanced.

Uptake of amino acids by Bra_Rl. As Bra_Rl allows growth on liquid minimal salts with L-glutamateand, in multicopy, allows growth on solid minimal salts withL-glutamate, it was considered possible that this permease mighthave a broader specificity than previously characterized membersof HAAT. Therefore, the specificity of solute transport by Bra_Rlwas investigated by using a representative set of L amino acids(glutamate, ${alpha}$ -aminoisobutyric acid [AIB], histidine, leucine,alanine, and arginine). Uptake of each of these amino acidsin aap and braE mutants (RU1356 and RU1131, respectively) wasdecreased, with only negligible uptake in the aap braE doublemutant (RU1357; Fig. 2A). Cosmids containing either aap (pRU3024)or bra (pIJ1427) were able to compensate for this loss of aminoacid uptake, raising uptake rates for each amino acid abovethose observed in the wild-type strain, while control cosmidscontaining mutations in bra did not elevate the rate of aminoacid transport (Fig. 2B). Strains containing braC mutations(RU1470 and RU1472) gave results similar to those for braE mutants,except that the rate of transport of L-alanine remained unchanged(Fig. 2). Therefore, transport of L-glutamate, AIB, L-histidine,L-leucine, and L-arginine is dependent on braC but L-alanineuptake is not. These data suggest that R. leguminosarum hasan unidentified SBP, which interacts with the membrane componentsof Bra_Rl during L-alanine uptake.

View larger version (27K):
[in this window]
[in a new window]
FIG. 2. Uptake of amino acids by mutated strains of R. leguminosarum. The uptake rates of L-glutamate, AIB, L-histidine, L-leucine, L-alanine, and L-arginine (respectively represented by the bars, left to right, within each group) were determined for a number of mutant strains of A34 (A) and mutated strains containing cosmids (B).

braC carried on a plasmid (pRU826) restored L-glutamate, L-histidine,L-leucine, L-arginine, and AIB uptake levels in RU1472 (braCaap) to those of the unmutated strain (RU1356; Fig. 3B). Inplasmid pRU826, braC is transcribed divergently from the vectorlac promoter, suggesting that a promoter for this gene is presentin the braG-braC intergenic region. Also, complementation studiesconfirmed that braDEFG (pRU733) is sufficient to restore uptakerates in braE mutants for each amino acid tested (RU1357; Fig.3A). If no promoter were present in the braG-braC intergenicregion, braDEFG alone would not be expected to complement braE::Tn5(Fig. 3), as this mutation would be polar on braC. A braC promoterwould also be consistent with the large (498-bp) intergenicregion between braG and braC, while the genes encoding the othertransport components are probably cotranscribed from a promoterupstream of braD, as they are separated by only between 2 and7 nucleotides.

View larger version (20K):
[in this window]
[in a new window]
FIG. 3. Complementation of aap and bra transport mutants. The uptake rates of L-glutamate, AIB, L-histidine, L-leucine, L-alanine, and L-arginine (respectively represented by the bars, left to right, within each group) were determined for RU1357- (aap braE mutant; A) and RU1472 (aap braC mutant; B)-derived strains containing plasmids carrying a number of transport component genes.

The specificity of Bra_Rl was further investigated by uptakecompetition experiments. L-Leucine and L-glutamate were selected,as they represent high- and low-affinity solutes of Bra_Rl (seebelow). Therefore, the relative affinities of competing solutes(added at a 20-fold excess concentration) could be determined.Strain RU1356 was used in these studies as the presence of Aapin the wild-type strain would confound the results. Uptake ofL-[¹⁴C]leucine was inhibited by the addition of all L aminoacids tested, except L-glutamate, L-aspartate, L-glutamine,L-asparagine, and L-arginine (Fig. 4A). However, the uptakeof L-[¹⁴C]glutamate was inhibited by all L amino acids, includingthose that did not inhibit L-leucine uptake (Fig. 4B). Thisdifference between the inhibition of L-leucine uptake and theinhibition of L-glutamate uptake most probably reflects a loweraffinity of Bra_Rl for L-glutamate, L-aspartate, L-glutamine,L-asparagine, and L-arginine. Therefore, Bra_Rl has at leastas broad a solute specificity as Aap and is able to transportpolar amino acids as well as aliphatic amino acids.

View larger version (30K):
[in this window]
[in a new window]
FIG. 4. Inhibition of leucine, glutamate, and GABA uptake by other solutes. Uptake of 25 µM (0.125 µCi) L-[¹⁴C]leucine (A), L-[¹⁴C]glutamate (B), and [³H]GABA (C) was assayed by the rapid-filtration method. Competing solutes were added to a final concentration of 0.5 mM. (L-alpha-AB, L- ${alpha}$ -aminobutyrate; D-alpha-AB, D- ${alpha}$ -aminobutyrate.

Uptake of GABA by Bra_Rl. Nodules and Rhizobium bacteroids contain high concentrationsof GABA (44, 51), and this solute can be used as the sole carbonand nitrogen source by rhizobia in vitro (11, 29). However,no transporter of GABA has been reported in rhizobia. Therefore,the possible role of Aap or Bra in GABA uptake was investigated.R. leguminosarum (A34) transported [³H]GABA at a rate comparableto that for amino acids tested (compare Fig. 5 and 2A). GABAuptake in RU1131 (bra mutant) was undetectable, and mutationof aap (RU1356) had no effect, indicating that Bra_Rl, but notAap, transports GABA. In uptake competition assays, GABA inhibitedthe uptake of L-leucine and L-glutamate by Bra_Rl (Fig. 4A and B).Similarly, solutes that inhibit uptake of L-leucine andL-glutamate also inhibit the uptake of GABA (Fig. 4C), confirmingthat Bra_Rl transports GABA and thus that the reduced uptakeof GABA is not due to a secondary effect of a mutation of Bra_Rlon a separate GABA transporter.

View larger version (21K):
[in this window]
[in a new window]
FIG. 5. Uptake of GABA by mutated strains of R. leguminosarum. The rates of uptake of GABA (black bars) and L-glutamate (white bars) were determined for a number of mutant strains of A34.

Constraints on the solute specificity of Bra_Rl. To determine what constraints there are on solute structurefor transport by Bra_Rl, the effect of a range of solutes onL-glutamate and L-leucine uptake was determined (Fig. 4). Solutesof Bra_Rl must possess both amino and carboxyl groups, as butyrate,propionate, and butylamine did not inhibit L-glutamate uptake.The position of the amino group in relation to the carboxylgroup is not critical, as Bra_Rl can transport GABA, a ${gamma}$ -aminoacid. Therefore, the specificity of Bra_Rl is not restrictedto ${alpha}$ -amino acids, but the apparent affinity is highest for L- ${alpha}$ -aminoacids, as L- ${alpha}$ -aminobutyrate is a better inhibitor of L-glutamateand L-leucine uptake than GABA.

The stereospecificity of characterized HAAT transporters hasnot been fully determined, and available data are ambiguous.Preliminary characterization of Liv_Ec indicated that it couldtransport D-leucine but with a higher K_m and lower V_max thanthose for the L isomer (41). However, no data were presentedin this initial report to substantiate these claims. In contrast,characterization of the binding properties of BraC_Pa indicatedthat a 100-fold excess of D-leucine did not inhibit the bindingof L-leucine (21). Therefore, to determine the stereospecificityof Bra_Rl, representative D amino acids (D-leucine, D-glutamate,D-alanine, D-histidine, and D- ${alpha}$ -aminobutyrate) were used in competitionuptake assays. Uptake of L-glutamate was inhibited by D-leucine,D-alanine, D-histidine, and D- ${alpha}$ -aminobutyrate, but not by D-glutamate.L-Leucine uptake was inhibited by D-leucine and D- ${alpha}$ -aminobutyrate(Fig. 4). Therefore, Bra_Rl has a significant affinity for Damino acids but the affinity is lower than that for the correspondingL isomer. Furthermore, the apparent affinity for most D aminoacids tested is greater than that for physiologically relevantsolutes such as L-glutamate.

An SBP ABC transporter of urea and short-chain amides with similarityto branched-chain amino acid transporters of the HAAT familyhas been identified in Methylophilus methylotrophus (35). However,the solutes of this transporter (urea, acetamide, and formamide)had no effect on uptake of L-leucine or L-glutamate by Bra_Rl(Fig. 4). Therefore, the solute specificity of Bra_Rl is distinctfrom that of the urea and amide transporter.

Kinetics of solute uptake. The kinetic constants of uptake confirm that Bra_Rl is a high-affinitytransporter of amino acids for which K_m values are between 78nM and 56 µM (Table 2). The K_m for L-histidine uptake(78 nM) is lower than that for L-leucine uptake (205 nM), andthe V_max for L-glutamate uptake (17 nmol mg of protein^-1 min^-1)is the highest of those for the solutes tested. Therefore, thesesolutes are transported by Bra_Rl under physiologically relevantconditions. The K_m for L-glutamate uptake (56 µM) confirmsthat Bra_Rl has a much lower affinity for this solute than forothers tested, explaining its inability to inhibit uptake ofL-leucine and GABA (Fig. 4A and C). The K_m values for L-leucine,L-alanine, AIB, and L-histidine are each significantly lowerfor Bra_Rl than for Aap (Table 2).

View this table:
[in this window]
[in a new window]
TABLE 2. Kinetics of solute uptake by the Aap and Bra of R. leguminosarum^a

Growth of aap and bra mutants on amino acids as the sole carbon and nitrogen source. Since the physiological relevance of Bra_Rl to L-glutamate metabolismwas first revealed by growth studies, we examined the phenotypesfor the growth of aap, bra, and aap bra mutants on amino acidsas the sole carbon and nitrogen sources in liquid culture. Althoughsingle aap and bra mutants were able to grow on L-glutamate,L-glutamine, L-asparagine, L-proline, L-serine, L-arginine,and L-citrulline, the rate of growth was lower than that ofthe wild-type strain. Mutation of both aap and bra abolishedgrowth on these solutes (Table 3). Therefore, both Bra_Rl andAap have an important physiological role in growth on a broadrange of amino acids. Also, the lack of growth of bra mutantson GABA confirmed that Bra_Rl is the main route of GABA uptakein free-living R. leguminosarum. Growth on L-alanine and L-histidinewas unaffected by mutation of aap and bra (Table 3), indicatingthat R. leguminosarum has other transporters of these solutes.

View this table:
[in this window]
[in a new window]
TABLE 3. Growth of R. leguminosarum strains following 7 days of incubation at 28°C on AMS liquid media containing various solutes^a

Preliminary characterization of a second HAAT permease from R. leguminosarum. During the course of these studies, the coding sequence fora second HAAT-like permease of R. leguminosarum (Bra2_Rl) wasidentified on cosmid pRU3131. The partial sequence of this operon(accession no. AJ427840) indicated that it encoded at leastone SBP (Bra2C), two integral membrane proteins (Bra2DE), andtwo nucleotide-binding proteins (Bra2FG), each with significanthomology to the corresponding proteins of other HAAT members(e.g., see Bra2F_Rl in Fig. 6). However, mutation of this transportoperon did not affect uptake of L-leucine or L-alanine (datanot shown). Also, overexpression in RU1357 (aap bra mutant)did not result in increased uptake of any amino acid tested(Fig. 2). Therefore, R. leguminosarum has at least two HAATparalogues with different transport specificities or expressionprofiles.

View larger version (29K):
[in this window]
[in a new window]
FIG. 6. Phylogenetic tree of members of selected ABC transporters of the HAAT family. Amino acid sequences of the ATP-binding proteins of selected members of the HAAT family were aligned using Vector NTI Suite (version 6), and the resulting phylogenetic tree was drawn by using Treeview (version 1.6.1). In addition to the transporters described here, included in the tree are the permeases for which experimental evidence of function is published and transporters identified from the sequencing projects of M. loti, S. meliloti, Agrobacterium tumefaciens, and P. aeruginosa. The sequences are identified by the designated protein name or protein number assigned by the sequencing projects (http://sequence.toulouse.inra.fr/meliloti.html, http://www.kazusa.or.jp/rhizobase/, http://www.pseudomonas.com/, and http://cancer.lbi.ic.unicamp.br/agroC58/). The bacterial species from which the sequences were derived are indicated by a prefix as follows: Atu, A. tumefaciens; ec, E. coli; mll and mlr, M. loti; pa and PA, P. aeruginosa; rl, R. leguminosarum bv. viciae; slr, Synechocystis sp.; SMc and SMb, S. meliloti. The transporter classification numbers are in parentheses adjacent to the representative members of the transporter subfamily described by M. H. Saier (47).

Comparison of Bra_Rl and related sequences. The completion of microbial genome sequences has revealed thatsome species contain multiple HAAT paralogues. For example,a search of the Deinococcus radiodurans and Archaeoglobus fulgidussequences revealed four HAAT paralogues in each (25). Therefore,the incidence of HAAT proteins in rhizobia was investigated.A search of the complete genome sequences of S. meliloti andM. loti indicated that each has at least five complete operonsresembling HAAT operons and three or four "orphan" BraC-likebinding proteins (allocated gene no. mll1986, mlr7182, mlr7721,mlr9716, Sma0576, SMc00078, and Smc00513; see http://sequence.toulouse.inra.fr/meliloti.htmland http://www.kazusa.or.jp/rhizobase/). A similar search ofthe Agrobacterium tumefaciens genome sequence revealed sevencomplete operons resembling HAAT operons, with two located onthe At plasmid and the remainder distributed on the two chromosomes.

The sequences of BraF_Rl and BraG_Rl were aligned with the HAAT-likeABC proteins from S. meliloti, M. loti, Agrobacterium tumefaciens,P. aeruginosa, and E. coli (Fig. 6). The resulting tree indicatesthat Bra_Rl has the highest identity to the Liv_Ec and Bra_Pa transporters,with orthologues in the sequenced rhizobia and Agrobacteriumtumefaciens (SMc01948/9, mll3974/5, and Atu2424/5).

DISCUSSION

Top

Discussion

These data indicate that Bra_Rl is the second general amino acidpermease present in R. leguminosarum. The previously describedAap belongs to one subfamily of ABC transporters, PAAT, whileBra_Rl belongs to the other main subfamily of ABC transportersof amino acids, HAAT. Although the affinities of Aap and Bra_Rlfor solutes differ (Table 2), these two transporters have overlappingsolute specificities, with each permease able to transport polaramino acids (e.g., L-glutamate, L-histidine, and L-arginine)and branched-chain amino acids (e.g., L-leucine) (Fig. 2). Asignificant difference between Aap and Bra_Rl is their stereospecificities;Aap is specific for L amino acids (39, 55), whereas Bra_Rl alsohas significant affinity for D amino acids (Fig. 4). As butylamine,butyrate, and propionate do not inhibit uptake of Bra_Rl solutes,solutes of Bra_Rl must possess amino and carboxyl groups. However,the specificity of Bra_Rl is not restricted to ${alpha}$ -amino acids asGABA, a ${gamma}$ -amino acid, is transported. Indeed, Bra_Rl is the firstABC transporter to be shown to transport GABA. All previouslyidentified bacterial transporters of GABA, which include GabPof E. coli (37) and GadC of Lactococcus lactis (48), are secondarycarriers of the amino acid-polyamine-organocation (APC) superfamilyand function as solute/cation symporters or solute/solute antiporters(27).

Both Bra_Rl and Aap contribute to the ability of R. leguminosarumto grow on amino acids as the sole source of carbon and nitrogen,but growth of aap bra double mutants on L-alanine and L-histidineindicates that unidentified transporters of amino acids arepresent in this species (Table 3). A histidine transporter (HutXWV)of the quaternary amine uptake transporter family has been identifiedin S. meliloti (6). However, this permease is not present inall rhizobia as no apparent orthologue of hutXWV is presentin the complete genome sequence of M. loti. An alternative candidateL-histidine transporter is the uncharacterized homologue ofthe HisJQMP permease of S. enterica serovar Typhimurium (17,18), which has been identified in R. leguminosarum (25).

L-Alanine is clearly transported by Bra_Rl, as mutation or overexpressionof braDEFG alters the rate of uptake of this solute (Fig. 2).However, unlike that of other solutes, uptake of L-alanine isnot dependent on BraC_Rl. Our present understanding of solutetransport by SBP ABC transporters indicates that it is unlikelythat the membrane components of this permease transport L-alaninewithout interaction with an SBP (16). Therefore, it is probablethat another BraC-like SBP is involved in L-alanine uptake.However, no BraC-like genes are present in the immediate vicinityof the bra_Rl operon (Fig. 1). The S. meliloti genome containsthree orphan braC homologues that are not located near othertransport components. It is possible that the proteins encodedby these genes interact with HAAT transporters encoded by geneslocated elsewhere on the genome. Although no such orphan braC-likegenes have yet been identified in R. leguminosarum, an orphanL-alanine binding protein may interact with BraDEFG_Rl. The interactionof multiple SBPs with the membrane complex of ABC transportersis well established. For example, in S. enterica serovar TyphimuriumhisJ and argT encode a histidine binding protein and an arginine,lysine, and ornithine binding protein, respectively (17), whichinteract with HisQMP, and in E. coli livK and livJ encode aleucine-specific binding protein and a leucine, isoleucine,and valine binding protein, respectively, which interact withLivHMGF (33).

The closely related branched-chain amino acid transporters inE. coli (Liv_Ec; T.C. 3.A.1.4.1) and P. aeruginosa (Bra_Pa) arethe best-characterized members of the HAAT family. Althoughthese transporters are referred to as branched-chain amino acidor LIV transporters, their specificity is broader than thesenames suggest. One of the two periplasmic binding proteins ofLiv_Ec (LivJ) binds L-threonine, L-alanine, and L-serine in additionto L-leucine, L-isoleucine, and L-valine, although the affinityfor the former three solutes is lower than that for the latterthree (41). Indeed, an investigation of L-alanine transportin E. coli confirmed that it is transported by Liv_Ec (43). Also,the membrane complex of Bra_Pa has been solubilized and reconstitutedinto proteoliposomes, and the transport of L-alanine and L-threonineby this permease was confirmed. However, the affinities of BraC_Pafor L-alanine and L-threonine (K_d, 3 to 5 µM) are muchlower than those for L-leucine, L-isoleucine, and L-valine (K_d,0.3 to 0.5 µM), indicating a preference for the transportof branched-chain amino acids (23). The reported specificityof Bra_Pa is not as broad as that reported here for Bra_Rl, asno significant uptake of L-glutamate or L-proline could be detectedin proteoliposomes containing Bra_Pa. Also, uptake of L-[¹⁴C]leucinewas not inhibited by L-histidine, L-glutamate, L-glutamine,or L-proline (23). However, as the Bra_Pa uptake assays werecarried out with a final solute concentration of only 10 µMand as the competition experiments were performed with onlya high-affinity solute (i.e., L-leucine), Bra_Pa may have lower,but significant, affinity for other amino acids.

An investigation of amino acid uptake in cyanobacteria identifiedtwo open reading frames (ORFs) of Synechocystis sp. strain PCC6803 (slr0467 and slr0559; T.C. 3.A.1.4.2) which, when mutated,produced a decreased rate of amino acid uptake. The productof ORF slr0467 (renamed natA) has 40% identity to BraF_Pa, andthe product of slr0559 (natB) has 26% identity to BraC_Pa. Mutationof these genes resulted in an almost total impairment of uptakeof a broad range of neutral amino acids (i.e., L-alanine, glycine,L-leucine, L-phenylalanine, L-proline, and L-serine), in additionto a 70% decrease in L-aspartate uptake and a 30% decrease inL-histidine uptake. Mutation of natA also decreased L-glutamateuptake by 30 to 50% (36). Since the characterization of thistransporter relied exclusively on mutation analysis, furthercharacterization is required to confirm the solute specificity,as mutation of natA and natB may have a secondary effect onthe expression of other transporters. Nevertheless, the datasuggest that the Nat permease of Synechocystis spp. is a broad-specificityamino acid transporter of the HAAT family. However, a comparisonof the natA and the R. leguminosarum braF and braG sequencesindicates that the Nat permease is more distantly related toLiv_Ec and Bra_Pa (Fig. 6). Mutation of a second ORF of Synechocystissp. strain PCC 6803 with high sequence identity to ABC bindingproteins of the HAAT family (sll0374) had no effect on the uptakeof the 12 amino acids tested (36). Therefore, Synechocystissp. strain PCC 6803 contains at least one member of the HAATfamily with an apparent broad specificity for amino acids andanother that is not involved in the uptake of amino acids underthe conditions tested.

A high-affinity SBP ABC transporter of short-chain amides andurea has been identified in Methylophilus methylotrophus (35).The partial sequence of the operon encoding this transporterrevealed three genes, fmdDEF, which encode an SBP and two integralmembrane proteins, each with significant similarity to the correspondingproteins of Liv_Ec and Bra_Pa. So, although FmdDEF is involvedin the uptake of urea and short-chain amides, it is a memberof the HAAT family of ABC transporters. Thus, the solute specificitiesof transporters of the HAAT family extends beyond amino acidsand includes short-chain amides and urea. However, the solutespecificities of Bra_Rl and Fmd do not overlap as urea, acetamide,and formamide do not inhibit solute uptake by Bra_Rl (Fig. 4B).Therefore, the urea and amide transporters are a distinct subclassof the HAAT family.

The complete genome sequences of S. meliloti, M. loti, and Agrobacteriumtumefaciens have revealed that these organisms contain a numberof HAAT paralogues, and this work reports two R. leguminosarumHAAT permeases. It has been noted that S. meliloti has a highdegree of paralogy, with many ancient gene duplications givingrise to a rich array of transport and regulatory proteins (13).This raises the question of the functions of the different paralogues.Do the HAAT paralogues differ in solute specificity and/or expressionprofile? The expression of one HAAT operon of S. meliloti (encodingSMb20602 to SMb20605 and SMb21707) is induced during nitrogendeprivation (34), and in Pseudomonas fluorescens, a HAAT operonis induced by growth in the plant rhizosphere (42). Therefore,some HAAT paralogues clearly function under specific physiologicalconditions. However, the data presented here caution againstassigning solute specificity on the basis of homology to previouslycharacterized transporters. Further research is required togain a full understanding of the role of this ABC transporterfamily in bacterial physiology.

A general amino acid permease (Gap1) in Saccharomyces cerevisiaehas been described (28). However, this is a secondary carrierof the amino acid/auxin permease family and is unique to eukaryotes(46). The general amino acid permeases of R. leguminosarum,Aap and Bra_Rl, are the only characterized broad-host-range aminoacid transporters of the ABC superfamily. Indeed, the characterizationof Bra_Rl has indicated that it has the broadest specificityof any characterized bacterial transporter of amino acids.

ACKNOWLEDGMENTS

This work was funded by the Biotechnology and Biological SciencesResearch Council of the United Kingdom.

FOOTNOTES

* Corresponding author. Mailing address: School of Animal and Microbial Sciences, University of Reading, Whiteknights, P.O. Box 228, Reading RG6 6AJ, United Kingdom. Phone: (44) 118 931 8895. Fax: (44) 118 931 6671. E-mail: p.s.poole{at}reading.ac.uk.

REFERENCES

Top