Previous Article | Next Article 
Journal of Bacteriology, August 2002, p. 4161-4167, Vol. 184, No. 15
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.15.4161-4167.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
The Putative Response Regulator BaeR Stimulates Multidrug Resistance of Escherichia coli via a Novel Multidrug Exporter System, MdtABC
Satoshi Nagakubo,1,2 Kunihiko Nishino,1,2,3 Takahiro Hirata,1,2,3 and Akihito Yamaguchi1,2,3*
Department of Cell Membrane Biology, Institute of Scientific and Industrial Research, Osaka University, Ibaraki,1
CREST, Japan Science and Technology Corporation, Osaka 567-0047,,3
Faculty of Pharmaceutical Science, Osaka University, Suita, Osaka 565-0871, Japan2
Received 19 February 2002/
Accepted 29 April 2002

ABSTRACT
Overproduction of the response regulator BaeR confers resistance
to novobiocin and bile salts in a
acrAB mutant by stimulating
drug exporter gene expression. The
mdtABC (multidrug transporter
ABC, formerly known as
yegMNO) genes, which encode a resistance-nodulation-cell
division (RND) drug efflux system, are responsible for resistance.
The MdtABC system comprises the transmembrane MdtB/MdtC heteromultimer
and MdtA membrane fusion protein. MdtAC also confers bile salt,
but not novobiocin, resistance. This indicates that the evolution
from an MdtC homomultimer to an MdtBC heteromultimer contributed
to extend the drug resistance spectrum. A BLAST search suggested
that such a heteromultimer-type RND exporter constitutes a unique
family among gram-negative organisms.

INTRODUCTION
The emergence of bacterial multidrug resistance has become an
increasing problem in the treatment of infectious diseases.
Multidrug resistance often results from the overexpression of
multidrug efflux transporters (
19). Recent genome sequence analysis
revealed that bacteria have a lot of intrinsic drug exporter
genes (
20). We previously cloned all of the open reading frame
(ORF) clusters encoding putative drug exporter genes in
Escherichia coli and revealed that 20 genes encode exporters of known drugs
and/or toxic compounds (
16). During the course of these comprehensive
studies, we found that the overexpression of a response regulator
of a bacterial two-component signal transduction system confers
multidrug resistance by stimulating the expression of multidrug
exporter genes (
15,
17).
Two-component signal transduction systems are major environmental sensing mechanisms of bacteria and are a component of sensor kinases and response regulators (2, 11). The vanS and vanR genes encode an Enterococcus two-component system which confers vancomycin resistance via upregulation of vanA and vanH, which make an altered peptidoglycan precursor to which vancomycin does not bind (3, 6). Similar two-component-system-mediated vancomycin tolerance was reported to occur in Streptococcus pneumoniae (18). Recently, it was found that some two-component systems confer drug resistance by upregulating drug exporter genes (4, 9, 15, 17). Since two-component systems are a mechanism for bacterial environmental adaptation and intrinsic drug exporters are a bacterial self-defense mechanism (23, 24), it is reasonable that some two-component systems could control drug exporter genes.
In previous papers, Nishino and Yamaguchi reported a mechanism for E. coli to express multidrug resistance by overexpression of the response regulator EvgA, which stimulates the expression of novel multidrug exporters (15, 17). EvgA regulates the expression of emrKY (7, 15), which encodes a major facilitator superfamily (MFS)-type bile salt-specific exporter, and yhiUV (17), which encodes a resistance-nodulation-cell division (RND)-type multidrug exporter. In this study, we characterize a novel multiple-membrane component RND-type drug transporter system, MdtABC, which comprises a transmembrane MdtB/MdtC heteromultimer and the membrane fusion protein MdtA. This system is also stimulated by overproduction of the response regulator BaeR.

MATERIALS AND METHODS
Bacterial strains and plasmids.
The bacterial strains and plasmids used in this study are listed
in Table
1. The chromosomal DNA of
E. coli W3104 (
25) was used
as a template for PCR cloning of the
mdt-
bae ORF clusters.
E. coli DH5

(Takara Shuzo Co., Kyoto, Japan) was used as a cloning
host.
E. coli KAM3 (
12), a derivative of
E. coli TG1 that lacks
acrAB, and
E. coli TG1

tolC, which lacks
tolC, were used for
drug susceptibility testing.
E. coli KO6494 was constructed
for this study from
E. coli KAM3 by means of random knockout
of the genes by Mu d1 phage integration. Plasmids pUC119, pHSG398,
pQE30, pTrc99A, and pACYC177 were purchased from commercial
sources. Other plasmids were constructed in this study.
Subcloning and expression of individual ORFs in the mdt-bae ORF cluster.
The
mdt-
bae ORF cluster was previously cloned from the chromosomal
DNA of
E. coli W3104 in our laboratory (
16). Each ORF or ORF
pair was amplified from pUCyeg-mdt-bae (
16) by PCR with a pair
of primers containing a restriction enzyme site that exists
in the multicloning sites of the pUC119 and pQE30 vectors. The
DNA fragments were digested with restriction enzymes and then
ligated into the multicloning sites of pUC119 and pQE30. As
for
mdtABCD, the chromosomal DNA of
E. coli W3104 was digested
by restriction enzymes
PstI and
SmaI followed by separation
by agarose gel electrophoresis. The DNA fragments of around
9.5 kb were extracted from the gel and ligated into the multicloning
site of pUC119 followed by transformation of
E. coli KAM3. The
colonies that carried the
mdtABCD genes were detected by colony
hybridization, with the PCR fragment of
mdtC used as a probe.
The PCR fragment was obtained by amplification of the
mdtC gene
from the
E. coli W3104 chromosome with primers mdtC-F (CCGAATTCAAGTTTTTTGCCCTCTTCATTT)
and mdtC-R (GGCTGCAGCTCGGTTACCGTTTGTTTAGGT). After purification,
the PCR product was labeled with a digoxigenin labeling kit
(Takara Shuzo Co.). The resulting cells carried plasmids encoding
mdtABCD and the putative promoter region. pUCmdtABC was constructed
from pUCmdtABCD by deletion of the
BglII-
SmaI fragment. The
resulting plasmid lacked the
mdtD gene.
Random knockout and selection of strains lacking the BaeR-responsive gene.
Random knockout of the E. coli KAM3 chromosomal genes was performed by the method of Mu d1 (Apr) phage integration as described previously (22). In brief, KAM3 cells were infected by Mu d1 phage followed by selection with 50 µg of ampicillin/ml. The phage-integrated KAM3 cells were then transformed with pHSGbaeSR (Cmr). The ampicillin- and chloramphenicol-resistant clones were isolated on agar plates containing 150 µg of ampicillin/ml and 10 µg of chloramphenicol/ml. Of these clones, the strains that were sensitive to 4 µg of novobiocin/ml were screened. The Mu d1 phage integration site was then determined as follows. In order to construct the plasmid library of this strain, the genomic DNA of E. coli KO6494 was subjected to partial Sau3AI digestion and then ligated into the pUC118 vector that had been digested with BamHI and treated with alkaline phosphatase. From this plasmid library, the plasmids containing Mu d1 DNA fragments were selected by colony hybridization with a PCR fragment of Mu d1 DNA as a probe. This PCR fragment was obtained from Mu d1 DNA by using primers MuF (GGTTGTGGTTAATTTGTTTATCA) and MuR (GGTAAATTCCTTTGATTACTGAT). The PCR product was labeled with a digoxigenin labeling kit (Takara Shuzo Co.). The plasmid obtained, which contained the Mu d1 fragment, was sequenced by using a BigDye DNA sequencing kit (PE Applied Biosystems) with M13, M4, and M13RV sequencing primers (Takara Shuzo Co.).
Construction of tolC in-frame deletion mutants.
To construct the tolC deletion mutant from E. coli TG1 cells, the precise in-frame deletions were generated by crossover PCR. The following oligonucleotide primers were used: tolC-No (CGCGGATCCTCATCCCGGCAACCATCTC), tolC-Ni (CACGCAATAACCTTCACACTCCAAATTTATAACCATTCCTTGTGGTGAAGCAGTAT),tolC-Co (CGCGGATCCGCTGGATTGCTGGGCC), and tolC-Ci, (GTTATAAATTTGGAGTGTGAAGGTTATTGCGTGTGATGACGACGACGGGG).The fragment containing the deletion was then cloned into the BamHI site (underlined in the primer sequences) of the pKO3 vector (10), which is a gene replacement vector that contains a temperature-sensitive origin of replication and markers for positive and negative selection for chromosomal integration and excision. The deletion was introduced into the chromosome by use of the pKO3 gene replacement protocol as described previously (10). The plasmid obtained was then electroporated into TG1. Cells were then recovered in 1 ml of SOC (2% Bacto Tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 20 mM glucose) for 1 h at 30°C. The cells were then plated on prewarmed chloramphenicol (20 µg/ml)-containing Luria broth (LB) plates and incubated at 43°C. From these plates, five colonies were picked up and inoculated into 1 ml of LB. After that, the cells were plated at 30°C on 5% (wt/vol) sucrose plates. The outgrowing bacteria were plated on LB plates with or without chloramphenicol at 30°C. Chloramphenicol-sensitive mutants were selected. Chromosomal insertions and deletions were confirmed by PCR.
Drug resistance determination.
The MICs of drugs and toxic compounds were determined as concentrations that largely prevented bacterial growth on L-agar (1% tryptone, 0.5% yeast extract, 0.5% NaCl) plates by sequential twofold dilutions as described previously (16).
Determination of the amount of mRNA by quantitative real-time PCR.
Total RNA was purified from KAM3 cells harboring pUC119 and pUCbaeSR by using RNA Protect bacterial reagent (Qiagen) and an SV total RNA isolation system (Promega). cDNA samples were synthesized from total RNA by using TaqMan reverse transcription reagents (PE Applied Biosystems) and random nucleotide hexamers. Then, specific primer pairs were designed with ABI PRISM Primer Express software (PE Applied Biosystems), and a real-time PCR was performed with each specific primer pair by using SYBR Green PCR Master Mix and run on an ABI PRISM 7000 sequence detection system.

RESULTS
ORF clusters responsible for the drug resistance phenotype of the genomic mdt and bae region.
The genomic
yeg,
mdt, and
bae region, which is located at 46.5
to 46.6 min in the
E. coli chromosome and contains eight ORFs
(Fig.
1) (
20a), when cloned into a multicopy vector, gave
E. coli KAM3 (
acrAB) cells a drug resistance phenotype against
bile salt derivatives, sodium dodecyl sulfate (SDS), and novobiocin.
The MICs of deoxycholate, cholate, taurocholate, SDS, and novobiocin
were increased by factors of 64, 8, >4, 4, and 8, respectively
(Table
2). The MICs of 17 other drugs and toxic compounds (tetracycline,
chloramphenicol, minocycline, erythromycin, enoxacin, kanamycin,
vancomycin, doxorubicin, rifampin, trimethoprim, acriflavine,
crystal violet, ethidium bromide, rhodamine 6G, methylviologen,
tetraphenylphosphonium bromide, and carbonyl cyanide
m-chlorophenylhydrazone)
were unaffected. This region contains some putative drug exporter
genes (
16). According to the sequence similarities,
mdtB and
mdtC were suggested to encode RND-type drug exporters and
mdtA was postulated to be a membrane fusion protein gene. In addition,
mdtD is a putative MFS-type drug exporter gene. On the other
hand,
yegK and
yegL are putative regulator genes, and
baeS and
baeR encode a putative sensor kinase and a response regulator,
respectively, in a two-component signal transduction system
(
13). In order to determine which ORFs are responsible for the
drug resistance phenotype, we subcloned the ORF clusters into
the multicopy plasmid pUC119. As shown in Table
2, a plasmid
carrying
mdtABCD conferred the same drug resistance phenotype
as a plasmid carrying the entire region. The genes
mdtABC also
showed the same resistance phenotype, while
mdtAB and
mdtA did
not. The putative regulator genes,
yegLK, conferred no resistance.
Surprisingly, the
baeSR two-component regulator genes gave the
same resistance phenotype as
mdtABC. The
baeR gene alone also
conferred the same resistance, while
baeS alone conferred no
resistance, indicating that overexpression of the response regulator
is enough for the resistance phenotype. This result is similar
to that obtained with
evgA reported previously (
15).
View this table:
[in this window]
[in a new window]
|
TABLE 2. Drug resistance of E. coli KAM3 ( acrAB) and KO6494 [ acrAB mdtB::Apr (Mu d1)] cells harboring a pUC119 or pHSG398 plasmid carrying an ORF cluster(s) in the genomic yeg, mdt, and bae regiona
|
Genes responsible for baeR-modulated drug resistance.
In order to determine the genes modulated by
baeR and responsible
for drug resistance, the chromosomal genes of
E. coli KAM3 were
randomly knocked out by transposition of Mu d1 phage, which
carries an ampicillin resistance gene as a marker. A mixture
of cells with random insertions was transformed with pHSGbaeSR,
which is a pHSG398 plasmid carrying
baeSR genes and a chloramphenicol
resistance gene as a marker. We obtained 7,200 clones of phage-integrated-plasmid-carrying
strains by selection for ampicillin and chloramphenicol resistance.
These clones were transplanted on the agar plate containing
4 µg of novobiocin/ml, and we obtained one novobiocin-sensitive
strain, KO6494. The phage integration site, which was determined
as described in Materials and Methods, was in the
mdtB gene
(data not shown). The MICs of bile salt derivatives, SDS, and
novobiocin against strain KO6494 [
acrAB mdtB::Ap
r(Mu d1)] were
the same as those against the host KAM3 cells (Table
2). Thus,
phage Mu d1 insertion in the
mdtB gene of strain KO6494 resulted
in the loss of the drug resistance phenotype, even when the
strain carried the multicopy
baeSR genes (pHSGbaeSR).
Expression control of mdtABCD genes by BaeR.
In order to determine whether the expression of the mdtABC genes is controlled by BaeR, we performed Northern blot analysis with a DNA fragment containing the mdtC region as a probe. Total cellular RNA isolated from KAM3 cells carrying pUCbaeSR showed a radioactive band corresponding to the mdtC mRNA, whereas KAM3 cells showed no such band (data not shown). The size of the radioactive band was 13 kb, which covers the entire mdt-bae locus, suggesting that these six genes (mdtABCD and baeSR) are transcribed as one operon (Fig. 1).
The amounts of mRNAs of individual genes of the mdtABCD region and of other multidrug exporter genes were determined by quantitative reverse transcription-PCR assay. As shown in Fig. 2, BaeR overexpression increased the amounts of mdtA, mdtB, mdtC, and mdtD mRNA by factors of about 7.4, 6.6, 4.5, and 2.8, respectively. The order of these values is consistent with the transcription of mdtABCD from the same promoter of the mdt-bae operon under the control of BaeR. On the other hand, the expression of the yhiUV, emrA, emrE, macA, and ydhE genes was not affected by BaeR overexpression.
MdtABC is a novel RND-type drug exporter complex with unique subunit composition.
To determine whether any single transporter gene can confer
drug resistance, the
mdtA,
mdtB, and
mdtC genes were separately
cloned into pACYC177 and pTrc99A. None of these plasmids gave
any drug resistance to KAM3 cells, except for the very-low-level
deoxycholate and SDS resistance of pTrcmdtC (Table
3). The effect
of combinations of the transporter genes,
mdtB and
mdtC, and/or
the membrane fusion protein gene,
mdtA, on drug resistance was
checked (Table
3). The pair of pACYCmdtA and pTrcmdtBC conferred
the same resistance pattern as pUCmdtABC, except that the deoxycholate
resistance was slightly low. On the other hand, the drug resistance
pattern of the combination of pACYCmdtA and pTrcmdtC was unique;
that is, the combination conferred resistance only to deoxycholate
and its derivatives and not to novobiocin or SDS at all (Table
3). Since pUCmdtAB conferred no resistance (Table
2), there
is no possibility that MdtABC is a mixture of independent drug
exporters, i.e., bile salt-specific MdtAC and novobiocin-specific
MdtAB. In light of the high (45%) amino acid sequence similarity
of MdtB and MdtC, a complex of MdtB and MdtC is likely to be
replaced with an MdtC homomultimer in the absence of MdtB. Thus,
it seems that the complex of MdtC homomultimer and MdtA may
have narrower drug specificity than the complex of MdtB/MdtC
heteromultimer and MdtA. The very low resistance shown by pTrcmdtC
and pTrcmdtBC alone may be caused by a trace amount of MdtA
from leaky expression of the chromosomal gene in
E. coli KAM3.
Finally, we found that pUCmdtABC did not confer any resistance
to
E. coli TG1 cells from which the
tolC gene was deleted (data
not shown), indicating that TolC is required for the resistance
phenotype of MdtABC (Fig.
3).

DISCUSSION
In this study, we showed that overexpression of the response
regulator BaeR stimulates the drug resistance phenotype by upregulating
the expression of a novel RND-type drug exporter, MdtABC. This
is the second case in
E. coli of response regulator overexpression-stimulated
drug resistance. The first one involves EvgA, which regulates
drug exporter genes (
7,
15). The
evgAS operon is upstream of
the
evgA-controlled
emrKY operon, which encodes an MFS-type
bile salt-specific drug exporter. These operons are divergently
transcribed (
15). EvgAS also controls the remote genes
yhiUV,
which encode an RND-type multidrug exporter conferring the multidrug
phenotype of
evgA-overexpressing strains (
17). On the other
hand, the
baeSR genes are downstream of the
mdtABC genes and
are transcribed in the same direction.
baeSR was first reported
by Nagasawa et al. (
13) as a novel two-component signal transduction
system, but neither BaeR-controlled genes nor signals sensed
by BaeS had been known. We found in this study that overexpression
of BaeR upregulates the expression of MdtABC. The
baeSR-mediated
resistance can be assigned to
mdtABC. Recently, Li et al. (
9)
reported that the two-component signal transduction system SmeSR
in
Stenotrophomonas maltophilia controls the
smeABC genes, which
encode a putative RND-type transporter system, and confers multidrug
resistance. However, the gene responsible for
smeSR-mediated
resistance is
smeC and not
smeAB. Since SmeC is an outer membrane
channel protein like
E. coli TolC, some other genes encoding
an inner membrane transporter may cooperate with SmeC.
Neither MdtA, MdtB, nor MdtC provided drug resistance when overexpressed individually. MdtAB also did not confer drug resistance, but MdtAC conferred limited resistance against bile salt derivatives. MdtABC conferred resistance against novobiocin and bile salt derivatives. These results strongly suggest that the transmembrane functional unit is an MdtB/MdtC heteromultimer and that MdtB contributes to extend the substrate specificity of the transporter to novobiocin. From an evolutionary point of view, MdtB might be derived from MdtC and the transporter might gain the extension of the substrate range by the replacement of the ancestral MdtC homomultimer with the MdtB/MdtC heteromultimer. Such transporters with heteromultimer-type transmembrane subunits are unique as RND-type drug exporters, but they are common in other bacterial multicomponent substrate transporters, such as maltose transporter (14) and phosphotransferase systems (21). We found that MdtABC homologues are present in Pseudomonas aeruginosa and Xylella fastidiosa. PA2526, PA2527, and PA2528 of P. aeruginosa showed sequence identities with MdtC, MdtB, and MdtA of about 56, 62, and 45%, respectively. XF2384, XF2385, and XF2386 of X. fastidiosa showed identities with MdtA, MdtC, and MdtB of about 37, 46, and 40%, respectively. Although none of these putative RND-type transporters has been analyzed yet, they may constitute a new type subfamily of RND-type drug efflux transporters.
MdtABC requires a multifunctional outer membrane channel TolC for its function, much like YhiUV (17), EmrKY (17), MacAB (8), and AcrAB (5). Of these, MdtABC, YhiUV, and AcrAB have the RND-type inner membrane transporters MdtB/MdtC, YhiV, and AcrB, respectively. On the other hand, EmrKY and MacAB have different types of inner membrane subunit, EmrY and MacB, which are MFS- and ABC (ATP binding cassette family)-type transporters, respectively. The common features of these transport systems are the presence of their own membrane fusion proteins. Thus, it seems that the membrane fusion protein-dependent drug exporter systems in E. coli generally require TolC as an outer membrane subunit, irrespective of the types of their inner membrane proteins. These results suggest that the TolC dependence may be determined by a membrane fusion protein.
It is likely that the two-component signal transduction system-mediated upregulation of the expression of intrinsic drug exporter genes will become a source of multidrug resistance in pathogens.

ADDENDUM
After submitting this report, we became aware that the report
of Baranova and Nikaido (
1), which deals with the same subject,
was submitted to this journal at almost the same time. The results
of their study are consistent with ours, except for the limited
resistance of MdtAC against deoxycholate and SDS. The lack of
resistance of MdtAC-carrying cells against deoxycholate reported
in their study may be due to the absence of the translation
products. Their results showing BaeR binding to the
mdtABCD promoter region also support our conclusion that BaeR is a transcriptional
regulator of the
mdtABCD operon.

ACKNOWLEDGMENTS
Satoshi Nagakubo and Kunihiko Nishino contributed equally to
this work.
We thank Tomofusa Tsuchiya for strain KAM3 and George M. Church for plasmid pKO3. We thank Hiroshi Nikaido for helpful discussions. We thank Mary Berlyn and Kenneth Rudd for suggestions on genetic nomenclature.
K. Nishino is supported by a research fellowship from the Japan Society for the Promotion of Science for Young Scientists. This work was supported by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

FOOTNOTES
* Corresponding author. Mailing address: Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki-shi, Osaka 567-0047, Japan. Phone: 81-6-6879-8545. Fax: 81-6-6879-8549. E-mail:
akihito{at}sanken.osaka-u.ac.jp.


REFERENCES
1 - Baranova, N., and H. Nikaido. 2002. The BaeSR two-component regulatory system activates transcription of the yegMNOB (mdtABCD) transporter gene cluster in Escherichia coli and increases its resistance to novobiocin and deoxycholate. J. Bacteriol. 184:4168-4176.[Abstract/Free Full Text]
2 - Coote, J. G. 2001. Environmental sensing mechanisms in Bordetella. Adv. Microb. Physiol. 44:141-181.[Medline]
3 - Evers, S., and P. Courvalin. 1996. Regulation of VanB-type vancomycin resistance gene expression by the VanSB-VanRB two-component regulatory system in Enterococcus faecalis V583. J. Bacteriol. 178:1302-1309.[Abstract/Free Full Text]
4 - Fournier, B., R. Aras, and D. C. Hooper. 2000. Expression of the multidrug resistance transporter NorA from Staphylococcus aureus is modified by a two-component regulatory system. J. Bacteriol. 182:664-671.[Abstract/Free Full Text]
5 - Fralick, J. A. 1996. Evidence that TolC is required for functioning of the Mar/AcrAB efflux pump of Escherichia coli. J. Bacteriol. 178:5803-5805.[Abstract/Free Full Text]
6 - Haldimann, A., S. L. Fisher, L. L. Daniels, C. T. Walsh, and B. L. Wanner. 1997. Transcriptional regulation of the Enterococcus faecium BM4147 vancomycin resistance gene cluster by the VanS-VanR two-component regulatory system in Escherichia coli K-12. J. Bacteriol. 179:5903-5913.[Abstract/Free Full Text]
7 - Kato, A., H. Ohnishi, K. Yamamoto, E. Furuta, H. Tanabe, and R. Utsumi. 2000. Transcription of emrKY is regulated by the EvgA-EvgS two-component system in Escherichia coli K-12. Biosci. Biotechnol. Biochem. 64:1203-1209.[CrossRef][Medline]
8 - Kobayashi, N., K. Nishino, and A. Yamaguchi. 2001. Novel macrolide-specific ABC-type efflux transporter in Escherichia coli. J. Bacteriol. 183:5639-5644.[Abstract/Free Full Text]
9 - Li, X.-Z., L. Zhang, and K. Poole. 2002. SmeC, an outer membrane multidrug efflux protein of Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 46:333-343.[Abstract/Free Full Text]
10 - Link, A. J., D. Phillips, and G. M. Church. 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179:6228-6237.[Abstract/Free Full Text]
11 - Mizuno, T. 1998. His-Asp phosphotransfer signal transduction. J. Biochem. (Tokyo) 123:555-563.[Abstract/Free Full Text]
12 - Morita, Y., K. Kodama, S. Shiota, T. Mine, A. Kataoka, T. Mizushima, and T. Tsuchiya. 1998. NorM, a putative multidrug efflux protein, of Vibrio parahaemolyticus and its homolog in Escherichia coli. Antimicrob. Agents Chemother. 42:1778-1782.[Abstract/Free Full Text]
13 - Nagasawa, S., K. Ishige, and T. Mizuno. 1993. Novel members of the two-component signal transduction genes in Escherichia coli. J. Biochem. 114:350-357.[Abstract/Free Full Text]
14 - Nikaido, H. 1994. Maltose transport system of Escherichia coli: an ABC-type transporter. FEBS Lett. 346:55-58.[CrossRef][Medline]
15 - Nishino, K., and A. Yamaguchi. 2001. Overexpression of the response regulator evgA of the two-component signal transduction system modulates multidrug resistance conferred by multidrug resistance transporters. J. Bacteriol. 183:1455-1458.[Abstract/Free Full Text]
16 - Nishino, K., and A. Yamaguchi. 2001. Analysis of a complete library of putative drug transporter genes in Escherichia coli. J. Bacteriol. 183:5803-5812.[Abstract/Free Full Text]
17 - Nishino, K., and A. Yamaguchi. 2002. EvgA of the two-component signal transduction system modulates production of the YhiUV multidrug transporter in Escherichia coli. J. Bacteriol. 184:2319-2323.[Abstract/Free Full Text]
18 - Novak, R., B. Henriques, E. Charpentier, S. Normark, and E. Tuomansen. 1999. Emergence of vancomycin tolerance in Streptococcus pneumoniae. Nature 399:590-593.[CrossRef][Medline]
19 - Okusu, H., D. Ma, and H. Nikaido. 1996. AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants. J. Bacteriol. 178:306-308.[Abstract/Free Full Text]
20 - Paulsen, I. T., L. Nguyen, M. K. Sliwinski, R. Rabus, and M. H. Saier. 2000. Microbial genome analyses: comparative transport capabilities in eighteen prokaryotes. J. Mol. Biol. 301:75-100.[CrossRef][Medline]
20 - Rudd, K. E. 1998. Linkage map of Escherichia coli K-12, edition 10: the physical map. Microbiol. Mol. Biol. Rev. 62:985-1019.[Abstract/Free Full Text]
21 - Siebold, C., K. Flukiger, R. Beutler, and B. Erni. 2001. Carbohydrate transporters of the bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS). FEBS Lett. 504:104-111.[CrossRef][Medline]
22 - Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
23 - Thanassi, D. G., L. W. Cheng, and H. Nikaido. 1997. Active efflux of bile salts by Escherichia coli. J. Bacteriol. 179:2512-2518.[Abstract/Free Full Text]
24 - White, D. G., J. D. Goldman, B. Demple, and S. B. Levy. 1997. Role of the acrAB locus in organic solvent tolerance mediated by expression of marA, soxS, or robA in Escherichia coli. J. Bacteriol. 179:6122-6126.[Abstract/Free Full Text]
25 - Yamamoto, T., M. Tanaka, C. Nohara, Y. Fukunaga, and S. Yamagishi. 1981. Transposition of the oxacillin-hydrolyzing penicillinase gene. J. Bacteriol. 145:808-813.[Abstract/Free Full Text]
Journal of Bacteriology, August 2002, p. 4161-4167, Vol. 184, No. 15
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.15.4161-4167.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Blair, J. M. A., La Ragione, R. M., Woodward, M. J., Piddock, L. J. V.
(2009). Periplasmic adaptor protein AcrA has a distinct role in the antibiotic resistance and virulence of Salmonella enterica serovar Typhimurium. J Antimicrob Chemother
64: 965-972
[Abstract]
[Full Text]
-
Mima, T., Kohira, N., Li, Y., Sekiya, H., Ogawa, W., Kuroda, T., Tsuchiya, T.
(2009). Gene cloning and characteristics of the RND-type multidrug efflux pump MuxABC-OpmB possessing two RND components in Pseudomonas aeruginosa. Microbiology
155: 3509-3517
[Abstract]
[Full Text]
-
Price, N. L., Raivio, T. L.
(2009). Characterization of the Cpx Regulon in Escherichia coli Strain MC4100. J. Bacteriol.
191: 1798-1815
[Abstract]
[Full Text]
-
Holden, M. T. G., Seth-Smith, H. M. B., Crossman, L. C., Sebaihia, M., Bentley, S. D., Cerdeno-Tarraga, A. M., Thomson, N. R., Bason, N., Quail, M. A., Sharp, S., Cherevach, I., Churcher, C., Goodhead, I., Hauser, H., Holroyd, N., Mungall, K., Scott, P., Walker, D., White, B., Rose, H., Iversen, P., Mil-Homens, D., Rocha, E. P. C., Fialho, A. M., Baldwin, A., Dowson, C., Barrell, B. G., Govan, J. R., Vandamme, P., Hart, C. A., Mahenthiralingam, E., Parkhill, J.
(2009). The Genome of Burkholderia cenocepacia J2315, an Epidemic Pathogen of Cystic Fibrosis Patients. J. Bacteriol.
191: 261-277
[Abstract]
[Full Text]
-
Yamanaka, H., Kobayashi, H., Takahashi, E., Okamoto, K.
(2008). MacAB Is Involved in the Secretion of Escherichia coli Heat-Stable Enterotoxin II. J. Bacteriol.
190: 7693-7698
[Abstract]
[Full Text]
-
Begic, S., Worobec, E. A.
(2008). The role of the Serratia marcescens SdeAB multidrug efflux pump and TolC homologue in fluoroquinolone resistance studied via gene-knockout mutagenesis. Microbiology
154: 454-461
[Abstract]
[Full Text]
-
Zoetendal, E. G., Smith, A. H., Sundset, M. A., Mackie, R. I.
(2008). The BaeSR Two-Component Regulatory System Mediates Resistance to Condensed Tannins in Escherichia coli. Appl. Environ. Microbiol.
74: 535-539
[Abstract]
[Full Text]
-
Nishino, K., Nikaido, E., Yamaguchi, A.
(2007). Regulation of Multidrug Efflux Systems Involved in Multidrug and Metal Resistance of Salmonella enterica Serovar Typhimurium. J. Bacteriol.
189: 9066-9075
[Abstract]
[Full Text]
-
Matsuo, T., Hayashi, K., Morita, Y., Koterasawa, M., Ogawa, W., Mizushima, T., Tsuchiya, T., Kuroda, T.
(2007). VmeAB, an RND-type multidrug efflux transporter in Vibrio parahaemolyticus. Microbiology
153: 4129-4137
[Abstract]
[Full Text]
-
Mima, T., Joshi, S., Gomez-Escalada, M., Schweizer, H. P.
(2007). Identification and Characterization of TriABC-OpmH, a Triclosan Efflux Pump of Pseudomonas aeruginosa Requiring Two Membrane Fusion Proteins. J. Bacteriol.
189: 7600-7609
[Abstract]
[Full Text]
-
Dupont, M., James, C. E., Chevalier, J., Pages, J.-M.
(2007). An Early Response to Environmental Stress Involves Regulation of OmpX and OmpF, Two Enterobacterial Outer Membrane Pore-Forming Proteins. Antimicrob. Agents Chemother.
51: 3190-3198
[Abstract]
[Full Text]
-
Petersen, L., Bollback, J. P., Dimmic, M., Hubisz, M., Nielsen, R.
(2007). Genes under positive selection in Escherichia coli. Genome Res
17: 1336-1343
[Abstract]
[Full Text]
-
Carlsson, K. E., Liu, J., Edqvist, P. J., Francis, M. S.
(2007). Extracytoplasmic-Stress-Responsive Pathways Modulate Type III Secretion in Yersinia pseudotuberculosis. Infect. Immun.
75: 3913-3924
[Abstract]
[Full Text]
-
Bohnert, J. A., Schuster, S., Fahnrich, E., Trittler, R., Kern, W. V.
(2007). Altered spectrum of multidrug resistance associated with a single point mutation in the Escherichia coli RND-type MDR efflux pump YhiV (MdtF). J Antimicrob Chemother
59: 1216-1222
[Abstract]
[Full Text]
-
Wu, H., Mao, F., Olman, V., Xu, Y.
(2007). Hierarchical classification of functionally equivalent genes in prokaryotes. Nucleic Acids Res
35: 2125-2140
[Abstract]
[Full Text]
-
Depardieu, F., Podglajen, I., Leclercq, R., Collatz, E., Courvalin, P.
(2007). Modes and Modulations of Antibiotic Resistance Gene Expression. Clin. Microbiol. Rev.
20: 79-114
[Abstract]
[Full Text]
-
Elkins, C. A., Mullis, L. B.
(2006). Mammalian Steroid Hormones Are Substrates for the Major RND- and MFS-Type Tripartite Multidrug Efflux Pumps of Escherichia coli. J. Bacteriol.
188: 1191-1195
[Abstract]
[Full Text]
-
Hu, W. S., Li, P.-C., Cheng, C.-Y.
(2005). Correlation between Ceftriaxone Resistance of Salmonella enterica Serovar Typhimurium and Expression of Outer Membrane Proteins OmpW and Ail/OmpX-Like Protein, Which Are Regulated by BaeR of a Two-Component System. Antimicrob. Agents Chemother.
49: 3955-3958
[Abstract]
[Full Text]
-
Poole, K.
(2005). Efflux-mediated antimicrobial resistance. J Antimicrob Chemother
56: 20-51
[Abstract]
[Full Text]
-
Kumar, A., Worobec, E. A.
(2005). Cloning, Sequencing, and Characterization of the SdeAB Multidrug Efflux Pump of Serratia marcescens. Antimicrob. Agents Chemother.
49: 1495-1501
[Abstract]
[Full Text]
-
Nishino, K., Honda, T., Yamaguchi, A.
(2005). Genome-Wide Analyses of Escherichia coli Gene Expression Responsive to the BaeSR Two-Component Regulatory System. J. Bacteriol.
187: 1763-1772
[Abstract]
[Full Text]
-
Lee, L. J., Barrett, J. A., Poole, R. K.
(2005). Genome-Wide Transcriptional Response of Chemostat-Cultured Escherichia coli to Zinc. J. Bacteriol.
187: 1124-1134
[Abstract]
[Full Text]
-
Tan, K., McCue, L. A., Stormo, G. D.
(2005). Making connections between novel transcription factors and their DNA motifs. Genome Res
15: 312-320
[Abstract]
[Full Text]
-
Nehme, D., Li, X.-Z., Elliot, R., Poole, K.
(2004). Assembly of the MexAB-OprM Multidrug Efflux System of Pseudomonas aeruginosa: Identification and Characterization of Mutations in mexA Compromising MexA Multimerization and Interaction with MexB. J. Bacteriol.
186: 2973-2983
[Abstract]
[Full Text]
-
Nishino, K., Yamaguchi, A.
(2004). Role of Histone-Like Protein H-NS in Multidrug Resistance of Escherichia coli. J. Bacteriol.
186: 1423-1429
[Abstract]
[Full Text]
-
Hirakawa, H., Nishino, K., Yamada, J., Hirata, T., Yamaguchi, A.
(2003). {beta}-Lactam resistance modulated by the overexpression of response regulators of two-component signal transduction systems in Escherichia coli. J Antimicrob Chemother
52: 576-582
[Abstract]
[Full Text]
-
Elkins, C. A., Nikaido, H.
(2003). Chimeric Analysis of AcrA Function Reveals the Importance of Its C-Terminal Domain in Its Interaction with the AcrB Multidrug Efflux Pump. J. Bacteriol.
185: 5349-5356
[Abstract]
[Full Text]
-
Nishino, K., Yamada, J., Hirakawa, H., Hirata, T., Yamaguchi, A.
(2003). Roles of TolC-Dependent Multidrug Transporters of Escherichia coli in Resistance to {beta}-Lactams. Antimicrob. Agents Chemother.
47: 3030-3033
[Abstract]
[Full Text]
-
Rojas, A., Segura, A., Guazzaroni, M. E., Teran, W., Hurtado, A., Gallegos, M. T., Ramos, J. L.
(2003). In Vivo and In Vitro Evidence that TtgV Is the Specific Regulator of the TtgGHI Multidrug and Solvent Efflux Pump of Pseudomonas putida. J. Bacteriol.
185: 4755-4763
[Abstract]
[Full Text]
-
Zhou, L., Lei, X.-H., Bochner, B. R., Wanner, B. L.
(2003). Phenotype MicroArray Analysis of Escherichia coli K-12 Mutants with Deletions of All Two-Component Systems. J. Bacteriol.
185: 4956-4972
[Abstract]
[Full Text]
-
Nishino, K., Inazumi, Y., Yamaguchi, A.
(2003). Global Analysis of Genes Regulated by EvgA of the Two-Component Regulatory System in Escherichia coli. J. Bacteriol.
185: 2667-2672
[Abstract]
[Full Text]
-
Hirakawa, H., Nishino, K., Hirata, T., Yamaguchi, A.
(2003). Comprehensive Studies of Drug Resistance Mediated by Overexpression of Response Regulators of Two-Component Signal Transduction Systems in Escherichia coli. J. Bacteriol.
185: 1851-1856
[Abstract]
[Full Text]
-
Grkovic, S., Brown, M. H., Skurray, R. A.
(2002). Regulation of Bacterial Drug Export Systems. Microbiol. Mol. Biol. Rev.
66: 671-701
[Abstract]
[Full Text]
-
Baranova, N., Nikaido, H.
(2002). The BaeSR Two-Component Regulatory System Activates Transcription of the yegMNOB (mdtABCD) Transporter Gene Cluster in Escherichia coli and Increases Its Resistance to Novobiocin and Deoxycholate. J. Bacteriol.
184: 4168-4176
[Abstract]
[Full Text]
-
Tonpitak, W., Thiede, S., Oswald, W., Baltes, N., Gerlach, G.-F.
(2000). Actinobacillus pleuropneumoniae Iron Transport: a Set of exbBD Genes Is Transcriptionally Linked to the tbpB Gene and Required for Utilization of Transferrin-Bound Iron. Infect. Immun.
68: 1164-1170
[Abstract]
[Full Text]