This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, T.
Right arrow Articles by Zhao, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, T.
Right arrow Articles by Zhao, J.

 Previous Article  |  Next Article 

Journal of Bacteriology, September 2002, p. 5096-5103, Vol. 184, No. 18
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.18.5096-5103.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Differential Expression and Localization of Mn and Fe Superoxide Dismutases in the Heterocystous Cyanobacterium Anabaena sp. Strain PCC 7120

Tao Li,1 Xu Huang,1 Ruanbao Zhou,1 Yingfang Liu,1 Bin Li,1 Chris Nomura,2 and Jindong Zhao1,3*

State Key Lab of Plant Genetic and Protein Engineering,3 College of Life Sciences, Peking University, Beijing 100871, China,1 Department of Biochemistry, Pennsylvania State University, University Park, Pennsylvania 168022

Received 12 March 2002/ Accepted 14 June 2002


arrow
ABSTRACT
 
Superoxide dismutases (Sods) play very important roles in preventing oxidative damages in aerobic organisms. The nitrogen-fixing heterocystous cyanobacterium Anabaena sp. strain PCC 7120 has two Sod-encoding genes: a sodB, encoding a soluble iron-containing Sod (FeSod), and a sodA, encoding a manganese-containing Sod (MnSod). The FeSod was purified and characterized. A recombinant FeSod was also obtained by overproduction in Escherichia coli. Immunoblot study of the FeSod during induction of heterocyst differentiation showed that the cells produced six- to eightfold more FeSod 8 h after a shift from a nitrogen-replete condition to a nitrogen-depleted condition. However, the amount of FeSod protein in filaments with mature heterocysts was the same as that in filaments grown with combined nitrogen. Superoxide anion-generating chemicals such as methyl viologen did not induce upregulation of the sodB gene expression. The predicted preprotein of the sodA gene has a leader peptide and a motif for membrane attachment at the N terminus of the mature protein. Activity staining after gel electrophoresis of the purified thylakoid membranes showed that most of the MnSod in Anabaena sp. strain PCC 7120 was located on thylakoids toward the lumenal side. Expression of the sodA gene in E. coli shows that the leader peptide was required for its activity and the membrane localization of the MnSod. Northern hybridization detected one 0.82-kb transcript of sodA. The sodA gene was upregulated by methyl viologen, whereas its amount was unchanged during heterocyst differentiation. Immunoblotting and activity staining showed that isolated heterocysts contained a lower but still significant amount of FeSod, suggesting that its function is required in heterocysts. No MnSod was observed in isolated heterocysts. These results show that the two different Sod proteins have differentiated roles in Anabaena sp. strain PCC 7120.


arrow
INTRODUCTION
 
Active oxygen species (AOS) such as superoxide anion (O2-), hydroxyl radical (OH·), and hydrogen peroxide (H2O2) are inevitably formed in all aerobic organisms and can cause damage to a wide range of biomolecules, such as DNA molecules and proteins (6, 20). They are formed by partial reduction of oxygen in cellular metabolism. Superoxide could disrupt Fe-S centers, and the released irons can react with H2O2, forming highly reactive hydroxyl radical (15). Therefore, both O2- and H2O2 must be removed promptly to avoid cellular damage. The defense systems against AOS in prokaryotes and eukaryotes are similar (15, 47). They both use enzymes and nonenzymatic antioxidants to remove AOS. Antioxidant chemicals such as gluthathione and ascorbate scavenge AOS directly, whereas enzymatic protection against AOS involves systems of enzymes which remove AOS. The most critical enzymes in removing superoxide anion are superoxide dismutases (Sods), which carry out the following reaction: 2O2- + 2H+ -> H2O2 + O2. The H2O2 formed is removed by catalases or peroxidases. So far, four kinds of Sods have been found: the copper-zinc type (Cu,Zn-Sod), the manganese type (MnSod), the iron type (FeSod), and the nickel type (NiSod). They all participate in protecting cellular molecules from damage caused by AOS (11, 15).

In plant leaves, algae and cyanobacteria, O2- is usually formed by reduction of oxygen at the reducing side of photosystem I (2). It has been demonstrated that Sods play important roles against oxidative damage in cyanobacteria. A mutant strain of Synechococcus sp. strain PCC 7942 lacking detectable FeSod activity was shown to be much more sensitive to AOS (19) and chilling stress (40). An FeSod is also shown to be very important against oxidative damage in Nostoc commune under prolonged desiccation (37).

In heterocystous cyanobacteria, special cells called heterocysts are formed when the filaments are grown under a nitrogen-limiting condition (16, 46). Mature heterocysts contain a nitrogenase system and are the site for nitrogen fixation. Heterocysts have no oxygen evolving activity, and the thick wall of heterocysts limits but does not totally exclude oxygen penetration into the cells (46). Heterocysts also have a high activity of respiration, which consumes oxygen. Because photosystem I is present in heterocysts, oxygen can still intercept electrons of the electron transport chain to form O2- (2). Respiratory electron transport could also lead to the formation of O2-. Sod is thus probably required in heterocysts to protect against cellular damage by O2- (14). However, little information is available on what kind of Sod is present in heterocysts and how the sod gene expression is regulated. We have recently cloned the sodB gene from Anabaena sp. strain PCC 7120 and showed that its expression was upregulated upon shifting from a nitrogen-replete condition to a nitrogen-depleted condition (26). Here we report the results of isolation, purification, and characterization of the FeSod and MnSod from Anabaena sp. strain PCC 7120. Their localization and gene expression are also reported.


arrow
MATERIALS AND METHODS
 
Strains and culture conditions. Axenic cultures of Anabaena sp. strain PCC 7120 were grown on agar plates (1.5% Difco Bacto Agar) or in liquid medium of BG11 (34) with or without combined nitrogen. Liquid cultures were grown at 28°C and bubbled with 0.5% CO2 in filtered air. The cultures were illuminated with cool white fluorescent light at an intensity of ca. 80 µmol m-2 s-1. Escherichia coli strain DH5{alpha} was used for all routine cloning. The E. coli BL21(DE3) was used for overproduction of the sodB gene, and the E. coli strain QC774 (10) was used to express the sodA gene from Anabaena sp. strain PCC 7120.

Purification of FeSod from Anabaena sp. strain PCC 7120. Anabaena cells from 10 liters of late exponential culture in BG11 medium were collected by centrifugation. The pellet was resuspended in buffer A (20 mM Tris-HCl, pH 8.0; 10 mM NaCl) and centrifuged. The cells were resuspended in buffer A containing 100 µM phenylmethanesulfonyl fluoride and broken by passage through a French press twice at a pressure of 160 MPa. The cell extracts were centrifuged at a speed of 20,000 rpm in an AJ25 rotor (Beckman) for 1 h to remove membranes and unbroken cells. Solid ammonium sulfate was added to the supernatant to a saturation of 60%. The solution was stirred for 30 min at 4°C before centrifugation at 25,000 x g for 1 h at 4°C. The pellet was discarded, and solid ammonium sulfate was added again to the supernatant to bring the solution to a final saturation of 70%. The solution was stirred and centrifuged as described above. The pellet containing Sod activity was resuspended in buffer A and dialyzed against buffer A overnight at 4°C. The precipitant formed during the dialysis was removed by centrifugation, and the supernatant was loaded to a DEAE-Sephadex column (40 by 2.5 cm) equilibrated with buffer A. The column was eluted with a linear NaCl gradient from 10 to 500 mM in buffer A. The fractions containing FeSod activity were pooled and dialyzed against buffer A before being concentrated by ultrafiltration and loaded onto a Sephacryl-100 HR (Sigma) column (50 by 4 cm). The column was eluted with buffer A at a flow rate of 25 ml h-1. The fractions containing Sod activity were pooled and concentrated as described above, applied to a Mono-Q HR column, and eluted with a linear NaCl gradient. The fractions containing Sod activity were collected and concentrated as described above. The molecular mass of the purified Sod protein was determined with a G2025A MS instrument as described by Zhou et al. (49). The isoelectric point of the purified Sod was estimated by isoelectrofocusing electrophoresis (48), followed by activity staining.

Overproduction of Anabaena sod genes in E. coli. The sodB gene from Anabaena sp. strain PCC 7120 was amplified by PCR in the presence of the high-fidelity enzyme Pfu (24). The primers used for the amplification were 5'TCACCATGGCATTTGTACAGGAAC3' and 5'CTGGATCCTAAGCTTTAGCATAAT3'. The restriction sites of NcoI and BamHI in the primers are underlined. The amplified fragment was first cloned into the pGEM-T vector (Promega, Beijing, People's Republic of China). The fragment from the resultant plasmid obtained by digestion with NcoI and BamHI was cloned into pET3d (38) and transformed into E. coli strain BL21(DE3) for overexpression. The sodA gene from Anabaena sp. strain PCC 7120 encodes a protein with a leader peptide. The DNA fragment encoding full-length protein was amplified by PCR with the primers 5'-TTCCATGGGTAAATCATCTCTGTGGCAA-3' (NcoI) and 5'-TTGGATCCCGCCGGGAAGTCCC-3' (BamHI). The DNA fragment encoding only the mature protein was amplified by PCR with the primers 5'-TTAGATGTGCCAACCTCAAGAAGC-3' (AflIII) and 5'-TTGGATCCCGCCGGGAAGTCCC-3' (BamHI). The amplified fragments were first cloned into the pGEM-T vector. The resultant plasmids were digested with NcoI and BamHI or with AflIII and BamHI. The generated DNA fragments containing the sodA genes were cloned into pSE380 (5), generating the expression plasmids pSE380sodA-f and pSE380sodA-m, respectively. These plasmids were transformed into the E. coli strain QC774 for expression of the sodA genes.

Isolation of heterocysts and purification of membranes. Heterocysts were isolated according to the method of Zhou et al. (48). The plasma membranes and thylakoid membranes were purified from 4 liters of culture by using the two-phase partition system (25, 30). The purity of the isolated membranes was determined according to the method of Norling et al. (30). No P700 activity or PsaE protein was detected in the isolated plasma membranes.

Detection of Sod. The measurement of Sod activity was based on its inhibition of the reduction of nitroblue tetrazolium by superoxide according to the method of Winterbourn et al. (45). The FeSod of E. coli from Sigma (S5389) was used as a control. It had an activity of 3,800 U per mg of protein under our assay conditions. The in-gel Sod activity staining procedure was performed according to the method of Beauchamp and Fridovich (4) as follows. The proteins were separated with nondenaturing polyacrylamide gel (8%) electrophoresis. The gel was then soaked in 2.5 mM nitroblue tetrazolium in buffer P (20 mM NaH2PO4 and 20 mM K2HPO4; pH 7.8) at 20°C for 30 min before it was transferred to buffer P containing 28 µM TEMED (N,N,N',N'-tetramethylethylenediamine) and 28 µM flavin and soaked for another 20 min. The gel was then rinsed twice with buffer P before being illuminated with a tungsten light bulb at an intensity of 450 µmol m-2 s-1.

The cells of Anabaena sp. strain PCC 7120 grown in BG-11 medium in late exponential phase were collected and broken either with a French press as described above or by osmotic shock after lysozyme treatment. The cell extracts obtained with the French press were centrifuged (5,000 x g, 5 min) to remove unbroken cells. The supernatant was centrifuged with high-speed centrifugation at 20,000 rpm (27,200 x g) with an AJ25 rotor for 1 h. The supernatant was the soluble fraction and used directly for in-gel Sod assay. The pellet was the membrane fraction. The membranes were washed three times with buffer A, and they were named total membranes. Heterocysts were broken with a French press according to the method of Zhou et al. (48). The total membranes, the purified membranes, and the total cell extracts from isolated heterocysts were precipitated with 80% acetone to remove lipids. The precipitants were solubilized in buffer A before they were assayed for Sod activity by in-gel activity staining. The procedure for breaking the cells by osmotic shock was as follows. The Anabaena sp. strain PCC 7120 cells were suspended in buffer A containing 0.5 M sucrose. To the cell suspension, lysozyme was added to a final concentration of 0.5 mg ml-1 and incubated at 30°C for 30 min before it was centrifuged at 5,000 x g for 5 min. The cell pellet was gently resuspended in an equal volume of buffer A without sucrose and centrifuged at 15,000 rpm for 30 min. The supernatant was used directly for in-gel assay for Sod activity.

Immunoblotting for detection of FeSod was performed as follows. The purified FeSod was used to raise antibodies in rabbits (18). The proteins of the total cellular extracts from Anabaena sp. strain PCC 7120 filaments or from isolated heterocysts were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (22) before being blotted on a polyvinylidene difluoride membrane. Proteins cross-reacted with the anti-FeSod antibodies were detected by using secondary antibodies conjugated with horseradish peroxidase (Promega) as described previously (48). Quantification of proteins after immunoblotting or in-gel staining was done by using ImageMaster VDS software (Pharmacia, Hong Kong).

Other methods. Induction of heterocyst differentiation was as described previously (48), and the oxidative stress condition was introduced by addition of 5 µM methyl viologen (MV) to the culture. Multiple sequence alignment was performed with CLUSTALW (41). Northern analysis was performed as described by Liu et al. (26). The protein concentration was determined with a dye-binding assay kit from Bio-Rad (Beijing, People's Republic of China). Determination of protein N-terminal sequences was carried out with an automatic protein sequencer (ABI491; Applied Biosystems) at the core facility of the College of Life Sciences in Peking University. Protein was first loaded onto a polyvinylidene difluoride membrane by using a Prosorb kit (Perkin-Elmer Applied Biosystems) and sequenced by gas-phase sequencing (49). The chlorophyll concentration was determined with 80% acetone extraction (27). The concentrations of Fe and Mn were determined with an atomic absorption spectrophotometer (Cole-Parmer, Beijing, People's Republic of China). The detection limits of the instrument for both ions are 0.01 ppm.


arrow
RESULTS
 
Characterization of FeSod. The gene encoding the FeSod from Anabaena sp. strain PCC 7120 has been cloned and sequenced (26). The gene was named sodB based on the homology of its amino acid sequence with other FeSods at several key positions. To confirm that its product is indeed an FeSod, the soluble Sod from Anabaena sp. strain PCC 7120 was purified. Table 1 summarizes the purification process. The Sod in the supernatant was first concentrated with ammonium sulfate precipitation since it was found that ammonium sulfate precipitation was effective in removing most of phycobiliproteins as well as other proteins. The Sod was precipitated with 70% ammonium sulfate. The pellet was resuspended in buffer A, and the Sod was purified with a DEAE anion-exchange column, followed by purification on a a gel filtration column. The DEAE ion-exchange step would separate the FeSod from the MnSod of Anabaena sp. strain PCC 7120 because the FeSod has a pI of 4.8 (Fig. 2), whereas the MnSod has a predicted pI of 6. The Sod was further purified with a MonoQ column. A total of 262-fold purification was achieved. Table 1 also shows that each protein contains approximately one molecule of Fe. One FeSod contained <0.01 Mn atom (data not shown). The results of the FeSod purification were analyzed by SDS-PAGE, as shown in Fig. 1A. After the MonoQ column step, only one band was present, as shown by Coomassie blue staining (lane 5). The purified Sod had a molecular mass of ca. 23 kDa as determined by SDS-PAGE. N-terminal sequencing revealed that it had a sequence of (A)FVQEPLPYDFNALEQY. The N-terminal sequence is identical to the predicted sequence of the sodB gene (26), confirming that the gene is indeed encoding an FeSod. The initial Met residue of the FeSod was apparently posttranslationally removed. We found that the first residue of ca. 80% of the native FeSod was an Ala residue (in parenthesis), whereas 20% started with a Phe residue, indicating some pretease cleavage at its amino terminus during purification. No other sequences were found with N-terminal sequencing. The purified native Sod has a molecular mass of 22.3 kDa as determined with mass spectroscopy (data not shown). The isoelectric point of the purified native FeSod was estimated to be 4.8 with isoelectrofocusing gel electrophoresis, followed by activity staining (Fig. 2B). The purified Sods maintained 80% activity after treatment with high temperature at 55°C for 30 min (data not shown). We also found that the FeSod activity was inhibited by H2O2 but not by KCN (not shown), a finding typical for FeSod.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Purification of FeSod from Anabaena sp. strain PCC 7120 grown under nitrogen-replete conditionsa



View larger version (64K):
[in this window]
[in a new window]
 
FIG. 2. In-gel activity staining of the Sods of Anabaena sp. strain PCC 7120. (A) Activity staining of the total cellular extracts (lane 1), the total membranes (lane 2), the supernatant obtained by the French press method (lane 3), the supernatant obtained by the osmotic shock method (lane 4), and the purified FeSod (lane 5) after nondenaturing acrylamide gel electrophoresis (8%). In lane 1, both bands of MnSod and FeSod are indicated on the left. The other bands indicated with arrows are probably heterodimers and hetero-oligomers of the two Sods (see the text). (B) Determination of the isoelectric point of the native FeSod by isoelectrofocusing gel electrophoresis, followed by activity staining. The pI of the FeSod was 4.8.



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 1. Purification of the FeSod of Anabaena sp. strain PCC 7120. (A) SDS-PAGE analysis of purification of the native FeSod. Soluble fraction (lane 2) was first treated with ammonium sulfate (60%) to remove most of the phycobiliproteins and other proteins. The purification process includes a DEAE column (lane 3), a gel filtration column (lane 4), and a MonoQ column (lane 5). (B) SDS-PAGE analysis of purification of the recombinant FeSod. The sodB gene was overexpressed in E. coli BL21(DE3) by using the expression vector pET3d. Lane 2, total cellular extracts from E. coli BL21(DE3) without pET3dSodB; lanes 3 and 4, total cellular extracts and soluble fraction from E. coli BL21(DE3) with pET3dSodB induced with 0.5 mM IPTG (isopropyl-ß-D-thiogalactopyranoside), respectively; and lane 5, purified recombinant FeSod. The purification procedure was the same as that described for panel A. In both panels A and B, the gels were stained with Coomassie blue, and the first lanes are the standards with molecular masses (indicated on the left side in kilodaltons).

The sodB gene product was also overproduced in E. coli, and the results are shown in Fig. 1B. More than 50% of the total cellular proteins were the overproduced FeSod (lane 3). Most of the overproduced Sod protein was in soluble form (lane 4). The purification of the recombinant FeSod was similar to that for the native FeSod, and the purified recombinant Sod is shown in lane 5 of Fig. 1B.

Figure 2A shows activity staining of the native Sods from the whole-cell extracts, the total membranes, the supernatant obtained with the French press method, the supernatant obtained with osmotic shock, and the purified FeSod after a nondenaturing gel electrophoresis. Only one band can be observed in the purified native Sod (lane 5). There are several bands present in whole-cell lysate (lane 1). The major band observed in whole-cell extract corresponded to the purified FeSod, which moved fastest in the nondenaturing gel. The top band was from MnSod (see below) and the middle bands could be heterodimer and hetero-oligomers of MnSod and FeSod (10, 12). All bands except the top band showed strong reaction with anti-FeSod by immunoblotting after nondenaturing electrophoresis (data not shown), suggesting that most of these bands in lane 1 (Fig. 2A) contained FeSod. The total membranes (lane 2) contained a major band corresponding to the band with lowest mobility (MnSod) in the total cell extracts and a faint band at the position of FeSod. The supernatant obtained with the French press (lane 3) contained two bands: a strong band at the position of FeSod and a weak band at the MnSod position. The supernatant obtained with osmotic shock contained only one band at the position of FeSod.

Characterization of the MnSod from Anabaena sp. strain PCC 7120. The activity staining result (Fig. 2) suggested that there would be at least another Sod protein present in Anabaena sp. strain PCC 7120. The sequence of the genome of Anabaena sp. strain PCC 7120 has recently been determined (www.cyanosite.bio.purdue.edu). A BLAST search based on its sodB gene revealed the presence of another sod gene, which showed a high homology to the sodA2 gene from Plectonema boryanum (8). No Cu,Zn-type sod gene was found in the Anabaena sp. strain PCC 7120 genome with the BLAST search. Multiple sequence alignment of the sodA gene product with other MnSod proteins shows that it has a sequence typical of bacterial MnSod (Fig. 3). Anabaena sp. strain PCC 7120 sodA has conserved amino acid residues at the key positions where the MnSods have characteristic residues (33). The sodA gene of Anabaena sp. strain PCC 7120 is predicted to encode a preprotein with a leader peptide. There is also a membrane attachment motif (CQPQ) at the N terminus of the mature SodA (43, 44). These sequences suggest that the MnSod from Anabaena sp. strain PCC 7120 is possibly secreted either outside the plasma membrane or into the thylakoid lumen and is likely a lipoprotein associated with membranes through its CQPQ motif.



View larger version (77K):
[in this window]
[in a new window]
 
FIG. 3. Partial sequence comparison of Anabaena sp. strain PCC 7120 SodA (residues 1 to 178) with other MnSods by multiple sequence alignment by using CLUSTALW. SodAs: 7120, Anabaena sp. strain PCC 7120 (www.cyanosite.bio.purdue.edu); Bsub, Bacillus subtilis (P54375); Nostoc, N. punctiforme; Pbo, P. boryanum (U17609, U17610, and U17611 for SodA1, SodA2 and SodA3, respectively); Taq, Thermus aquaticus (E04306); Valg, Vibrio alginolyticus (AF085191). The leader peptides are underlined, and the predicted lipid attachment motifs (CQPQ and CASA) are italic. The characteristic amino acid residues specific to MnSod are in boldface. Gaps are indicated by dashes.

To study the roles of the leader peptide in the correct folding of the MnSod, the recombinant SodA from Anabaena sp. strain PCC 7120 was overproduced. Figure 4 shows the activity staining of the recombinant SodA produced in E. coli strain QC774 which lacks both sodB and sodA (10). When the full-length sodA gene encoding both leader peptide and mature protein was used to produce recombinant SodA, Sod activity could be detected and it was found in total cell extracts (lane 3) and associated with membranes (lane 4). When the sodA gene lacking the sequence encoding the leader peptide was expressed in E. coli, little Sod activity was detected in the E. coli cell extract (lane 2), whereas SDS-PAGE analysis showed that the gene product was present. However, it formed inclusion bodies lacking Sod activity (not shown).



View larger version (111K):
[in this window]
[in a new window]
 
FIG. 4. The leader peptide of the SodA preprotein from Anabaena sp. strain PCC 7120 is required for the MnSod activity in E. coli. The expression of the sodA gene in E. coli strain QC774 was performed by using the expression vector pSE380. Activity staining was performed with total cellular extracts of E. coli strain QC774 without the sodA gene (lane 1), with truncated sodA gene lacking the sequence encoding leader peptide (p380sodA-m) (lane 2), and with full sodA gene (p380sodA-f) (lane3). Lane 4, membrane fraction of E. coli strain QC774 containing p380sodA-f; lane 5, total cellular extract from E. coli strain QC774 p380sodB that produces soluble FeSod of Anabaena sp. strain PCC 7120.

Anabaena sp. strain PCC 7120, like most of the cyanobacteria, has two membrane systems: plasma membranes and thylakoid membranes. To study the location of SodA in Anabaena sp. strain PCC 7120, plasma membranes and thylakoid membranes were separated by using a two-phase system (25, 30). The results show that plasma membranes and thylakoid membranes have different protein profiles (Fig. 5A). Activity staining showed that the MnSod activity was located on thylakoid membranes (Fig. 5B). Figure 5B also shows that the activity staining band of the thylakoid membrane was at the same position in the gel as the recombinant MnSod produced in E. coli (lane 3). Thus, the detected band on thylakoid membranes was the MnSod. The Sod activity associated with both the thylakoid membranes and the E. coli plasma membranes was inhibited neither by H2O2 nor by KCN, a finding typical of bacterial MnSod (data not shown). It is worthwhile to point out that only one band of MnSod was detected with the isolated membranes.



View larger version (71K):
[in this window]
[in a new window]
 
FIG. 5. Localization of MnSod in Anabaena sp. strain PCC 7120. (A) Analysis of the proteins from isolated plasma membrane and thylakoids by SDS-PAGE. Cells grown with nitrogen-replete medium were used. Lane 1, soluble proteins; lane 2, total membrane proteins; lane 3, thylakoid membrane proteins; lane 4, plasma membrane proteins. Molecular mass standards are shown on the left. From the top down, the bars indicate 97, 64, 45, 30, 21, and 14 kDa. (B) Sod activity staining after nondenaturing gel electrophoresis. Lane 1, plasma membrane; lane 2, thylakoid membranes; lane 3, total membranes; lane 4, total membranes from E. coli QC774 with recombinant MnSod of Anabaena sp. strain PCC 7120 as in Fig. 4; lane 5, purified FeSod.

Expression of sodA and sodB in Anabaena sp. strain PCC 7120. It has been shown that the sodB gene was upregulated by the shifting Anabaena sp. strain PCC 7120 culture from a nitrogen-replete condition to a nitrogen-depleted condition (26). To carry the present study further, we raised antibodies against FeSod to study the expression of sodB in Anabaena sp. strain PCC 7120 during the entire period of heterocyst differentiation and under oxidative stress by superoxide anions. When Anabaena sp. strain PCC 7120 culture was shifted from a nitrogen-replete condition to a nitrogen-depleted condition, the amount of FeSod increased about six to eight times within the first few hours of induction (Fig. 6A). It remained at a high level until heterocyst differentiation was complete (24 h) and gradually declined to the original low level in 48 h. The polyclonal antibodies used in the present study seemed to be specific to FeSod since we found that they showed no cross-reaction with MnSod even at the concentration 10 times higher than that used under our experimental conditions.



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 6. Expression of the sod genes of Anabaena sp. strain PCC 7120. (A) Immunoblotting determination of sodB expression during heterocyst differentiation. The average intensities of the bands in lanes 0 through 40 h are 100, 580, 570, 620, 310, and 95. (B) Immunoblotting determination of sodB expression after the addition of superoxide-generating agent MV (5.0 µM) to the culture. The average intensities of the bands in lanes 0 to 12 h are 100, 120, and 88. (C) In-gel activity staining to determine the expression of the sodA gene after the addition of MV (5.0 µM) to the culture. The average intensities of the bands in lanes 0 to 12 h are 100, 250, 480, and 120. (D) In-gel activity staining to determine the expression of the sodA gene during induction of heterocyst differentiation. The average intensities of the bands in lanes 0 to 24 h are 100, 96, 110, 98, and 115. Times (in hours [h]) of the induction are shown at the top of each panel. In panels A and B, 40 µg of protein was loaded into each lane, and in panels C and D, 60 µg of protein was loaded into each lane. The intensities of the bands are the average of three blots or gels and are normalized to the band intensities at 0 h.

The expression of sodB genes in some bacteria can be induced by oxidants (12). The expression of sodB of Anabaena sp. strain PCC 7120 subjected to a superoxide anion stress by addition of MV to the culture was studied (Fig. 6B). No increase of FeSod was observed by immunoblotting up to 12 h after the addition of MV. The cells died after longer incubation with MV (data not shown).

The effect of MV on the membrane-associated MnSod was also studied by using activity staining, and the results are shown in Fig. 6C. The addition of MV at a concentration of 5 µM induced a four- to sixfold increase of MnSod activity on membranes. The activity increased to its maximum level at 8 h after the addition of MV. The activity started to decline at 12 h, probably due to the cell death induced by MV. On the other hand, no change of MnSod activity was observed during the entire process of heterocyst differentiation in Anabaena sp. strain PCC 7120 (Fig. 6D). To confirm our observation that sodA gene was not upregulated during heterocyst differentiation, Northern analysis was performed and the results are shown in Fig. 7. One transcript of 0.82 kb was detected, suggesting that the sodA was transcribed as a single gene. No increase of the band intensity was observed during heterocyst differentiation.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 7. Northern analysis of the expression of the sodA gene from Anabaena sp. strain PCC 7120 during heterocyst differentiation. A DNA fragment containing the sodA gene was radiolabeled and used as a probe. One 0.82-kb transcript was detected as indicated by the arrow. Sample collection times (in hours [h]) after nitrogen step-down are shown on top. Each lane contained 25 µg of total RNA.

Only FeSod is present in heterocysts. The results presented in Fig. 2 show that both MnSod and FeSod are present in vegetative cells grown in the presence of combined nitrogen. The relative amount of the two Sod proteins in heterocysts was determined with isolated heterocysts by either activity staining or immunoblotting, and the results are shown in Fig. 8. The profiles of Sod proteins in vegetative cells grown in the absence or presence of combined nitrogen (Fig. 8A) were similar. On the other hand, heterocysts contained only the FeSod band with activity staining (lane 3). No MnSod was detected in heterocysts. The intensity of the FeSod band was only ca. 20% of that of the band in whole filaments, indicating that heterocyst contained less active SodB protein. Immunoblotting with the cell extracts from isolated heterocysts also showed that heterocysts contained less FeSod (Fig. 8B). The average intensity of the stained FeSod band in heterocyst extract was only 30% of that in whole filament extract, confirming that there is less but still significant FeSod in heterocysts in Anabaena sp. strain PCC 7120.



View larger version (64K):
[in this window]
[in a new window]
 
FIG. 8. Characterization of Sod in heterocysts. (A) Nondenaturing gel electrophoresis, followed by activity staining. (B) Determination of relative amount of FeSod in heterocysts by immunoblotting after SDS-PAGE. The whole-cell extracts from the vegetative cells grown with combined nitrogen (lane 1) or without combined nitrogen for 3 days (lane 2) and the isolated heterocysts (lane 3) were used for the analysis. Approximately 30 µg of protein was loaded into each lane.


arrow
DISCUSSION
 
Oxygen plays an important role in metabolism of cyanobacteria and strongly inhibits nitrogen fixation. Like all other aerobic organisms, the cyanobacteria use Sods to remove superoxide anions generated in oxygen-participated processes. While some cyanobacteria such as Synechocystis sp. strain PCC 6803 contain only the sodB gene (21), most of the cyanobacteria contain two kinds of sod genes, sodA which encodes MnSod and sodB that encodes FeSod. Apparently, the presence of two kinds of Sod in most of the cyanobacteria is advantageous in adapting metal concentration fluctuations in their environments. So far, only one copy of sodB gene is present in all cyanobacteria studied (8, 19, 26). The assignment of the cyanobacterial sodB genes was mostly based on their primary sequences (19, 26). In this report, we show that the purified SodB from Anabaena sp. strain PCC 7120 was indeed an FeSod based on its N-terminal sequence and the Fe content (Table 1). Our results also show that the FeSod of Anabaena sp. strain PCC 7120 is a soluble enzyme. The number of sodA genes encoding MnSod varies among cyanobacteria. Synechococcus sp. strain PCC 7942 probably has one sodA (23) and Anabaena sp. strain PCC 7120 (Fig. 3) contains one sodA based on a genome search and the results of this study. P. boryanum contains three sodA genes (8). Preliminary search suggests that Nostoc punctiforme ATCC 29133 contains two copies of sodA genes (Fig. 3).

Although the MnSod from Anabaena sp. strain PCC 7120 shares the same enzymatic properties with other bacterial MnSods, such as its insensitivity to H2O2 and KCN inhibition, there is a distinctive feature of the Anabaena MnSod: a major part of it is membrane associated (Fig. 3). The association of Sod with membranes is relatively uncommon among eubacteria (Fig. 3) (17). However, cyanobacteria differ from other bacteria in that they have a thylakoid membrane system that is the site for both oxygenic photosynthetic and respiratory electron transport, which could generate superoxide in the cytoplasm and thylakoid lumen, respectively. It is known that the cyanobacterial membranes contain unsaturated double bonds, and some filamentous cyanobacteria have polyunsaturated double bonds (42). The Anabaena sp. strain PCC 7120 used in this study has at least four different fatty acid desaturases (www-cyanosite.bio.purdue.edu). The complex membrane system in an environment of high oxygen concentration may create a special situation that requires a membrane-associated Sod to protect membrane molecules from oxidative damage. Some MnSod in other cyanobacteria are also found to be associated with membranes. N. punctiforme has two sodA genes, and their products are predicted to be membrane associated (Fig. 3). P. boryanum has three sodA genes, and at least one of them (sodA1) is predicted to be membrane associated (8). Synechococcus sp. strain PCC 7942 probably has one membrane-associated MnSod based on assays of enzymatic activity (19, 23). With isolated thylakoid membranes and plasma membranes, we demonstrated that the MnSod from Anabaena sp. strain PCC 7120 was associated with thylakoid membranes (Fig. 5), with little activity on plasma membranes. This result implies that membrane-associated MnSod is possibly related to the function of protecting thylakoid membranes from superoxide anion damage. A membrane-associated MnSod was also found in rat liver mitochondria, and it was suggested to protect the membranes from superoxide damage (31).

Similar ways have been adapted for the association of MnSods with the membranes in different cyanobacteria. Both the MnSod from Anabaena sp. strain PCC 7120 and the SodA1 from N. punctiforme have a leader peptide and a fatty acid attachment site (Fig. 3). The mature forms of the two MnSods are predicted to be lipoproteins. The leader peptides have also been found in other cyanobacterial MnSods such as the sodA1 gene product P. boryanum (8). We demonstrated that the leader peptide of the MnSod from Anabaena sp. strain PCC 7120 is not only critical to the MnSod association with membranes but also important in the correct folding of the MnSod and its activity in E. coli (Fig. 4). Since the signal sequences in prokaryotes are similar and the membrane topology is similar in both cyanobacteria and E. coli, the leader peptide of the MnSod is very likely also important in the Anabaena sp. strain PCC 7120 cells.

The presence of the leader peptide and the association of MnSod with thylakoid membranes suggest that the MnSod of Anabaena sp. strain PCC 7120 is located within the lumen, whereas the FeSod is in cytoplasm, although it cannot be completely ruled out that the membrane-anchored MnSod is facing the cytoplasmic side of the membranes. The suggestion that the MnSod is within the lumen is supported by the results shown in Fig. 2A. Only FeSod, which did not form aggregates by itself (Fig. 2A, lane 5), was released outside the cells with osmotic shock, whereas some MnSod and FeSod were present in the supernatant obtained by the French press method. The MnSod and FeSod obtained by the French press method formed no aggregates of heterodimer or hetero-oligomers. The aggregation could occur if MnSod and FeSod are located within the same compartment of the cells (10, 12) or after the concentration process in the case of the Sods from Anabaena sp. strain PCC 7120 (Fig. 2A, lane 1). Thus, the two Sods from Anabaena sp. strain PCC 7120 are likely separated spatially. The differential localization of MnSod and FeSod in Anabaena sp. strain PCC 7120 suggests that they have different roles in protecting cellular molecules from superoxide damage. By using different superoxide-generating agents, Thomas et al. (39) demonstrated that different Sods of Synechococcus sp. strain PCC 7942 might have different roles in protection against superoxide damages generated at different locations within the cells. The expression of the sodA and sodB genes in Anabaena sp. strain PCC 7120 also suggests that they have differentiated roles in protection against superoxide. While both sodA and sodB of Anabaena sp. strain PCC 7120 are expressed under normal growth conditions, suggesting that they are required for prevention of superoxide damage under these conditions, the upregulation of the two genes in Anabaena sp. strain PCC 7120 is induced under different conditions. Northern blotting analysis revealed that shifting from a nitrogen-replete condition to a nitrogen-depleted condition induced a severalfold increase of the sodB transcripts in Anabaena sp. strain PCC 7120 (26). The immunoblotting result shown in Fig. 6 confirmed the observation. The increase of the FeSod level during heterocyst differentiation suggests that the cells are under a more stressful condition during heterocyst differentiation, probably due to the limitation of nitrogen supply. This stress condition is relieved once nitrogen fixation takes place and the amount of FeSod returns to the same level as that under nitrogen-replete conditions. On the other hand, no upregulation of sodA expression is observed under nitrogen step-down conditions (Fig. 6 and 7). Northern analysis showed that the sodA gene from Anabaena sp. strain PCC 7120 was transcribed as a monocistron with an mRNA size of 0.82 kb (Fig. 7). The expression of sodA is upregulated by MV, which generates superoxide anions in both photosynthetic and respiratory electron transfers (Fig. 6). A previous study reported that the sodA2 gene transcript increased rapidly upon addition of MV in P. boryanum (8). We did not observe any FeSod increase induced by MV, as was the case with E. coli whose sodB gene expression remained unchanged after addition of MV (7, 10).

The amount of Sods in heterocysts has been reported in several studies, and the results varied by species. While the heterocysts of Anabaena variabilis contained more Sod protein than the vegetative cells (3), the heterocysts of Anabaena cylindrica contained less Sod than the vegetative cells (9). In this study, we show that the heterocysts of Anabaena sp. strain PCC 7120 contain a smaller amount of Sod (Fig. 8) by both activity staining and immunoblotting. We also demonstrate that FeSod is the only significant Sod present in the heterocysts by activity staining (Fig. 8). Because a major site of production of superoxide anions in heterocysts is at excited P700 of photosystem I, a soluble Sod is probably required to remove superoxide in cytosol. On the other hand, a heterocyst is an environment with a much reduced oxygen concentration, and it resembles some anaerobic bacteria. It is thus likely that much less Sod would be required and that the expression of sodB gene is low in heterocysts. The heterocyst thylakoids would also be under much less oxidative stress, and much less MnSod would be required in heterocysts to protect the thylakoid membranes.

A mutant lacking sodB was constructed in Synechococcus sp. strain PCC 7942 (19), and the mutant strain helped in the understanding of the roles that FeSod plays in that organism. A mutant strain of Corynebacterium melassecola lacking sodA was also useful in elucidating the roles of MnSod under different growth conditions (29). Cell differentiation and nodulation in a mutant strain of Sinorhizobium meliloti lacking sodA were severely impaired (35). Conversely, the increase in activity of antioxidant enzymes through genetic engineering extends the average life span in Drosophila melanogaster (32) and Caenorhabditis elegans (28), and it improves plant tolerance to stress conditions (1, 36). Anabaena sp. strain PCC 7120 presents an ideal case for studying the separate roles of MnSod and FeSod in heterocystous cyanobacteria because it has only one sodA and one sodB. We are currently trying to overexpress the sodA and sodB genes, as well as to construct mutant strains lacking either sodA or sodB or both, by the conjugal transfer method (13). These mutants, if constructed, will be very helpful in our understanding of different Sods in both vegetative cells and heterocysts under various conditions.


arrow
ACKNOWLEDGMENTS
 
The skillful technical assistance of C. Dong and Z. Wang is appreciated.

This research was supported by the National Natural Science Foundation of China (grant 39535002) and by the Department of Science and Technology of China (G1998010100, J99-A-032, and 00CB1089).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: College of Life Sciences, Peking University, Beijing 100871, People's Republic of China. Phone: 86-10-6275-6421. Fax: 86-10-6275-1526. E-mail: jzhao{at}pku.edu.cn. Back


arrow
REFERENCES
 
    1
  1. Allen, R. D. 1995. Dissection of oxidative stress tolerance using transgenic plants. Annu. Rev. Plant Physiol. 107:1049-1054.
  2. 2
  3. Asada, K., and M. Takahashi. 1987. Production and scavenging of active oxygen in photosynthesis, p. 227-287. In D. J. Kyle, C. B. Osmond, and C. J. Arntzen (ed.), Photoinhibition. Elsevier, New York, N.Y.
  4. 3
  5. Bagchi, S. N., A. Ernst, and P. Borger. 1991. The effect of activated oxygen species on nitrogenase of Anabaena variabilis. Z. Naturforsch. Sect. C 46:407-415.
  6. 4
  7. Beauchamp, C., and I. Fridovich. 1971. Superoxide dismutase: improved assays and an assay application to acrylamide gels. Anal. Biochem. 44:276-287.[CrossRef][Medline]
  8. 5
  9. Brosius, J. 1989. Superpolylinkers in cloning and expression vectors. DNA 8:759-777.[Medline]
  10. 6
  11. Cadenas, E. 1989. Biochemistry of oxygen toxicity. Annu. Rev. Biochem. 58:79-110.[CrossRef][Medline]
  12. 7
  13. Campan, I., and D. Touanti. 1993. Interaction of six global transcription regulators in expression of manganese superoxide dismutase in Escherichia coli K-12. J. Bacteriol. 175:1687-1696.[Abstract/Free Full Text]
  14. 8
  15. Campbell, W. S., and D. E. Laudenbach. 1995. Characterization of four superoxide dismutase genes from a filamentous cyanobacterium. J. Bacteriol. 177:964-972.[Abstract/Free Full Text]
  16. 9
  17. Canini, A., P. Civitareale, S. Marini, M. Grilli Caiola, and G. Rotilio. 1992. Purification of iron superoxide dismutase from the cyanobacterium Anabaena cylindrica Lemm and localization of the enzyme in heterocysts by immunogold labeling. Planta 187:438-444.
  18. 10
  19. Carlioz, A., and D. Touanti. 1986. Isolation of superoxide dismutase mutants in E. coli: is superoxide dismutase necessary for aerobic life? EMBO J. 5:623-630.[Medline]
  20. 11
  21. Choudhury, S. B., J. W. Lee, G. Davidson, Y. I. Yim, K. Bose, M. L. Sharma, S. O. Kang, D. E. Cabelli, and M. J. Maroney. 1999. Examination of the nickel site structure and reaction mechanism in Streptomyces seoulensis superoxide dismutase. Biochemistry 38:3744-3752.[CrossRef][Medline]
  22. 12
  23. Cortez, N., N. Carrillo, C. Pasternak, A. Balzer, and G. Klug. 1998. Molecular cloning and expression analysis of the Rhodobacter capsulatus sodB gene, encoding an iron superoxide dismutase. J. Bacteriol. 180:5413-5420.[Abstract/Free Full Text]
  24. 13
  25. Elhai, J., and C. P. Wolk. 1988. Conjugal transfer of DNA to cyanobacteria. Methods Enzymol. 167:747-754.[Medline]
  26. 14
  27. Fay, P. 1992. Oxygen relations of nitrogen fixation in cyanobacteria. Microbiol. Rev. 56:340-373.[Abstract/Free Full Text]
  28. 15
  29. Fridovich, I. 1995. Superoxide radial and superoxide dismutases. Annu. Rev. Biochem. 64:97-112.[CrossRef][Medline]
  30. 16
  31. Golden, J. W., and H. S. Yoon. 1998. Heterocyst formation in Anabaena. Curr. Opin. Microbiol. 1:623-629.[CrossRef][Medline]
  32. 17
  33. Graeff-Wohlleben, H., S. Killat, A. Banemann, G. Guiso, and R. Gross. 1997. Cloning and characterization of an Mn-containing superoxide dismutase (SodA) of Bordetella pertussis. J. Bacteriol. 179:2194-2201.[Abstract/Free Full Text]
  34. 18
  35. Harlow, E., and D. Lane. 1988. Antibodies: a laboratory manual. Cold Spring Harbor Laboratory, New York, N.Y.
  36. 19
  37. Herbert, S. K., G. Samson, D. C. Fork, and D. E. Laudenbach. 1992. Characterization of damage to photosystem I and II in a cyanobacterium lacking detectable iron superoxide dismutase activity. Proc. Natl. Acad. Sci. USA 89:8716-8720.[Abstract/Free Full Text]
  38. 20
  39. Imlay, J. A., and S. Linn. 1988. DNA damage and oxygen radical toxicity. Science 240:1302-1309.[Abstract/Free Full Text]
  40. 21
  41. Kotani, H., T. Kaneko, T. Matsubayashi, S. Sato, M. Sugiura, and S. Tabata. 1994. A physical map of the genome of a unicellular cyanobacterium Synechocystis sp. PCC6803. DNA Res. 1:303-307.
  42. 22
  43. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
  44. 23
  45. Laudenbach, D. E., C. G. Trick, and N. A. Straus. 1989. Cloning and characterization of an Anacystis nidulans R2 superoxide dismutase gene. Mol. Gen. Genet. 216:455-461.[CrossRef][Medline]
  46. 24
  47. Li, B., C. Gu, and J. Zhao. 1998. Molecular cloning and expression of Pfu DNA polymerase gene and its application in long-distance PCR. Chinese Sci. Bull. 43:863-867.
  48. 25
  49. Li, B., D. Xu, and J. Zhao. 2001. Isolation of plasma and thylakoid membranes from the heterocystous cyanobacterium Anabaena sp. PCC 7120. Acta Bot. Sinica 43:650-652.
  50. 26
  51. Liu, Y., R. Zhou, and J. Zhao. 2000. Molecular cloning and sequencing of the sodB gene from a heterocystous cyanobacterium Anabaena sp. PCC 7120. Biochim. Biophys. Acta 1491:248-252.
  52. 27
  53. MacKinney, G. 1941. Absorption of light by chlorophyll solutions. J. Biol. Chem. 140:315-322.[Free Full Text]
  54. 28
  55. Melov. S., J. Ravenscroft, S. Malik, M. S. Gill, D. W. Walker, P. E. Clayton, D. C. Wallace, B. Malfroy, S. R. Doctrow, and G. J. Lithgow. 2000. Extension of life-span with superoxide dismutase/catalase mimetics. Science 289:1567-1569.[Abstract/Free Full Text]
  56. 29
  57. Merkamm. M., and A. Guyonvarch. 2001. Cloning of the sodA gene from Corynebacterium melassecola and role of superoxide dismutase in cellular viability. J. Bacteriol. 183:1284-1295.[Abstract/Free Full Text]
  58. 30
  59. Norling, B., E. Zak, B. Andersson, and H. Pakrasi. 1998. 2D-isolation of pure plasma and thylakoid membranes from the cyanobacterium Synechocystis sp. PCC 6803. FEBS Lett. 436:189-192.[CrossRef][Medline]
  60. 31
  61. Okado-Matsumoto, A., and I. Fridovich. 2001. Subcellular distribution of superoxide dismutases (SOD) in rat liver. J. Biol. Chem. 276:38388-38393.[Abstract/Free Full Text]
  62. 32
  63. Orr, W. C., and R. S. Sohal. 1994. Extension of life span by overexpression of superoxide dismutase and catalase in Drosophila melanogaster. Science 263:1128-1130.[Abstract/Free Full Text]
  64. 33
  65. Parker, M. W., and C. C. F. Blake. 1988. Iron- and manganese-containing superoxide dismutases can be distinguished by analysis of their primary structures. FEBS Lett. 229:377-382.[CrossRef][Medline]
  66. 34
  67. Rippka, R., J. Deruelles, J. B. Waterbury, M. Herdman, and R. Y. Stanier. 1979. Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J. Gen. Microbiol. 111:1-61.
  68. 35
  69. Santos, R., D. Herouart, A. Puppo, and D. Touati. 2000. Critical protective role of bacterial superoxide dismutase in rhizobium-legume symbiosis. Mol. Microbiol. 38:750-759.[CrossRef][Medline]
  70. 36
  71. Scandalios, J. G. 1993. Oxygen stress and superoxide dismutases. Plant Physiol. 101:7-12.[Medline]
  72. 37
  73. Shirkey, B., D. P. Kovarcik, D. J. Wright, G. Wilmoth, T. F. Prickett, R. F. Helm, E. M. Gregory, and M. Potts. 2000. Active Fe-containing superoxide dismutase and abundant sodF mRNA in Nostoc commune (cyanobacteria) after years of desiccation. J. Bacteriol. 182:189-197.[Abstract/Free Full Text]
  74. 38
  75. Studies, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dendorff. 1991. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185:60-89.[CrossRef]
  76. 39
  77. Thomas, D. J., T. J. Avenson, J. B. Thomas, and S. K. Herbert. 1998. A cyanobacterium lacking iron superoxide dismutases is sensitized to oxidative stress induced with methyl viologen but is not sensitized to oxidative stress induced with norflurazon. Plant Physiol. 116:1593-1602.[Abstract/Free Full Text]
  78. 40
  79. Thomas, D. J., J. B. Thomas, S. D. Prier, N. E. Nasso, and S. K. Herbert. 1999. Iron superoxide dismutase protects against chilling damage in the cyanobacterium Synechococcus species PCC7942. Plant Physiol. 120:275-282.[Abstract/Free Full Text]
  80. 41
  81. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
  82. 42
  83. Varkonyi, Z., O. Zsiros, T. Farkas, G. Garab, and Z. Gombos. 2000. The tolerance of cyanobacterium Cylindrospermopsis raciborskii to low-temperature photo-inhibition affected by the induction of polyunsaturated fatty acid synthesis. Biochem. Soc. Trans. 28:892-894.[CrossRef][Medline]
  84. 43
  85. von Heijne, G. 1986. A new method for predicting signal sequence cleavage sites. Nucleic Acids Res. 14:4683-4690.[Abstract/Free Full Text]
  86. 44
  87. von Heijne, G. 1989. The structure of signal peptides from bacterial lipoproteins. Protein Eng. 2:531-534.[Abstract/Free Full Text]
  88. 45
  89. Winterbourn, S., R. Hawkins, M. Brain, and R. Carrell. 1975. The estimation of red cell superoxide dismutase activity. J. Lab. Clin. Med. 85:337-342.[Medline]
  90. 46
  91. Wolk, C. P., A. Ernst, and J. Elhai. 1994. Heterocyst metabolism and development, p. 769-823. In D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
  92. 47
  93. Yu, B. P. 1994. Cellular defenses against damage from reactive oxygen species. Physiol. Rev. 74:139-162.[Free Full Text]
  94. 48
  95. Zhou, R., Z. Cao, and J. Zhao. 1998. Characterization of HetR protein turnover in Anabaena sp. PCC 7120. Arch. Microbiol. 169:417-423.
  96. 49
  97. Zhou, R., X. Wei., N. Jiang, H. Li, Y. Dong, K. L. Hsi, and J. Zhao. 1998. Evidence that HetR protein is an unusual serine-type protease. Proc. Natl. Acad. Sci. USA 95:4959-4963.[Abstract/Free Full Text]


Journal of Bacteriology, September 2002, p. 5096-5103, Vol. 184, No. 18
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.18.5096-5103.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Zhao, W., Guo, Q., Zhao, J. (2007). A Membrane-Associated Mn-Superoxide Dismutase Protects the Photosynthetic Apparatus and Nitrogenase from Oxidative Damage in the Cyanobacterium Anabaena sp. PCC 7120. Plant Cell Physiol 48: 563-572 [Abstract] [Full Text]  
  • Lopez-Gomollon, S., Hernandez, J. A., Wolk, C. P., Peleato, M. L., Fillat, M. F. (2007). Expression of furA is modulated by NtcA and strongly enhanced in heterocysts of Anabaena sp. PCC 7120. Microbiology 153: 42-50 [Abstract] [Full Text]  
  • Wolfe-Simon, F., Starovoytov, V., Reinfelder, J. R., Schofield, O., Falkowski, P. G. (2006). Localization and Role of Manganese Superoxide Dismutase in a Marine Diatom. Plant Physiol. 142: 1701-1709 [Abstract] [Full Text]  
  • Regelsberger, G., Laaha, U., Dietmann, D., Ruker, F., Canini, A., Grilli-Caiola, M., Furtmuller, P. G., Jakopitsch, C., Peschek, G. A., Obinger, C. (2004). The Iron Superoxide Dismutase from the Filamentous Cyanobacterium Nostoc PCC 7120: LOCALIZATION, OVEREXPRESSION, AND BIOCHEMICAL CHARACTERIZATION. J. Biol. Chem. 279: 44384-44393 [Abstract] [Full Text]  
  • Fournier, M., Zhang, Y., Wildschut, J. D., Dolla, A., Voordouw, J. K., Schriemer, D. C., Voordouw, G. (2003). Function of Oxygen Resistance Proteins in the Anaerobic, Sulfate-Reducing Bacterium Desulfovibrio vulgaris Hildenborough. J. Bacteriol. 185: 71-79 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, T.
Right arrow Articles by Zhao, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, T.
Right arrow Articles by Zhao, J.