This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Francia, M. V. Articles by Clewell, D. B. Search for Related Content PubMed PubMed Citation Articles by Francia, M. V. Articles by Clewell, D. B.

Amplification of the Tetracycline Resistance Determinant of pAM1 in Enterococcus faecalis Requires a Site-Specific Recombination Event Involving Relaxase

Department of Biologic and Materials Sciences, School of Dentistry,¹ Department of Microbiology and Immunology, School of Medicine, The University of Michigan, Ann Arbor, Michigan 48109²

Received 19 April 2002/ Accepted 18 June 2002

	ABSTRACT

Top Abstract Text References

 
The small multicopy plasmid pAM1 (9.75 kb) encoding tetracycline resistance in Enterococcus faecalis is known to generate tandem repeats of a 4.1-kb segment carrying tet(L) when cells are grown extensively in the presence of tetracycline. Here we show that the initial (rate-limiting) step involves a site-specific recombination event involving plasmid-encoded relaxase activity acting at two recombination sequences (RS1 and RS2) that flank the tet determinant. We also present the complete nucleotide sequence of pAM1.

	TEXT

Top Abstract Text References

 
Tetracycline resistance in clinical isolates of enterococci is extremely common and is frequently associated with plasmids and/or conjugative transposons (6). pAM1 is a relatively small (9.75-kb), multicopy tetracycline resistance plasmid originally identified in Enterococcus faecalis strain DS5 (10). Although not conjugative, it is readily mobilizable by coresident conjugative elements, and its mobilization has been used indirectly to identify conjugative plasmids devoid of easily selectable markers (11, 12, 28, 29).

When E. faecalis cells carrying pAM1 are grown in the presence of tetracycline, the plasmid accumulates tandem repeats of a 4.1-kb segment of DNA containing the tet(L) determinant (9, 40, 41). The phenomenon was found to involve a recombinational event between directly repeated recombination sequences (RSs) that flanked tet (41). Three models, not mutually exclusive, were suggested to explain how the process may take place (41); the rate-limiting step involves intra- or intermolecular recombination events between the two RSs. (In the case of an intramolecular event, an uneven crossover between the two RSs within a partially replicated molecule can be easily envisioned and requires only a single crossover, whereas the other models invoke two-step processes.) The generation of tetracycline-sensitive derivatives exhibiting a deletion of the amplifiable segment is explainable by the same mechanism(s). After a single tandem duplication arises, the repeated segments bearing tet become available, in their entirety, for further amplification by a RecA-dependent process (43), and growth under selective conditions leads to single molecules with as many as eight repeats (40). The RSs are presumed necessary only for the initial tandem duplication step.

Perkins and Youngman (31) found that pAM1 represents a composite of two independent replicons, one of which, pAM11, corresponds to the amplifiable segment of the plasmid. The other, designated pAM12, corresponds to the replicon that remains in E. faecalis after loss of tetracycline resistance (i.e., spontaneous deletion of pAM11). (It is believed that pAM11 is not able to replicate independently in E. faecalis but is able to replicate in Bacillus subtilis and pAM12 is not able to replicate in B. subtilis.) Based on its sensitivity to various restriction enzymes, pAM11 was found to closely resemble pBC16 and other plasmids in Bacillus (1, 2) and pUB110 of Staphylococcus aureus (33). Here we report on the nucleotide sequence of pAM1 and identify the nature of the two RSs. In addition, we show that two mobilization proteins (putative relaxases), one associated with pAM11 and one with pAM12, participate in site-specific recombinational events related to the first step in amplification.

Determination of the nucleotide sequence of pAM1. A map of pAM1 is shown in Fig. 1, while Table 1 provides a list of related open reading frames. All of the determinants have the same orientation, and the presence of genes with near identity to replication and mobilization functions on pBC16 and pS86 (a cryptic plasmid from E. faecalis [25]), is clearly evident. The nomenclature utilized here is repB and mobB (B for Bacillus, relating the connection of pAM11 to the bacillus plasmid pBC16) and repE and mobE (E for Enterococcus, relating the connection of pAM12 to the enterococcal pS86). The two RSs represent segments of 387 bp (Fig. 2), a size that relates well with that previously proposed based on electron microscopy (41) but, interestingly, they exhibit only 57% identity. A core region exhibits identity at 50 out of 56 nucleotides. The RSs overlap the 5' ends of the adjacent mob determinants (Fig. 2). The products of these two determinants are 34% identical and exhibit 58% identity (70% similarity) in their N-terminal 200 amino acids. They both relate to the recently described pMV158 family of relaxases (19). (DNA relaxases are key enzymes in the initiation of DNA transfer via their cleavage at the nic site within a specific transfer origin, oriT.) Proteins belonging to this family show characteristic amino acid sequence motifs plus one motif that is common to all other relaxase types—that is, a highly conserved pair of histidine residues followed by a stretch of hydrophobic amino acid residues (19, 44) (positions 131 to 139 in MobB and 129 to 136 in MobE). In addition, the DNA sequences of the target nic regions are shared among the members of this family. The relaxase MobM of pMV158 (originally from Streptococcus agalactiae) has been shown to display the typical properties of DNA relaxases from plasmids of gram-negative bacteria (19, 44). Interestingly, both of the RSs of pAM1 contain regions resembling the pMV158 oriT site and even include the palindrome identified as the pMV158 nicking site (19). Relaxases have been reported previously to facilitate site-specific recombination between two oriT sites (3, 17, 24, 27, 37), which raises the question of whether relaxase activity might contribute to the initial tandem duplication step during amplification in the presence of tetracycline. A schematic representation of pAM1 amplification is shown in Fig. 3.

View larger version (25K): [in this window] [in a new window]   FIG. 1. Structural organization of pAM1. The positions of the open reading frames and their orientations are indicated with arrows. The cointegrate relationship between pAM11 (closely related to pBC16 from Bacillus cereus) and pAM12 (closely related to pS86 from E. faecalis) is illustrated. oriTB and oriTE are putative oriT sites that resemble the pMV158-like oriT family and are located within RS1 and RS2, respectively. The recombination in the RSs giving rise to pAM1 (and in amplified forms [see Fig. 3]) is shown with the differentially shaded rectangles. ItE represents an iteron-repeat region upstream of repE; a homologous region in pS86 has been suggested to be involved in replication. oriU and oriL represent the pAM11 double-strand origin and minor origin of replication, respectively, based on homology with pBC16. The positions of the restriction sites used in construction of the pAM1 mutants and/or for the amplification analyses are indicated.

View this table: [in this window] [in a new window]   TABLE 1. Open reading frames identified in pAM1

View larger version (42K): [in this window] [in a new window]   FIG. 2. RS comparisons. (A) Comparison of RS1 (top line) and RS2 (bottom line) sequences. Conserved nucleotides are boxed, and inverted repeat sequences are indicated with arrows. The putative transfer origin nick site is noted with the triangle. The putative Shine-Dalgarno (SD) sequences and the ATG start codons of the corresponding mob genes are also shown. The hatched bar indicates the sequence where amplification-related recombination occurs in vivo. (B) Sequence of the junction site of in vivo amplification products, using the 1.5-kb EcoRI fragment (see Fig. 3) as template to generate a PCR product from the indicated primers. The probable crossover point is indicated by the switch to bold letters.

View larger version (19K): [in this window] [in a new window]   FIG. 3. Schematic representation of pAM1 tetracycline resistance amplification. The 3.05- and 1.5-kb EcoRI segments corresponding to those appearing on the agarose gel analyses shown in Fig. 4 are noted. The locations of the primers used for the PCRs (see Fig. 4) are also indicated.

View larger version (50K): [in this window] [in a new window]   FIG. 4. Analyses of the amplification of pAM1 and mutant derivatives in the isogenic strains JH2-2 and UV202. (A) EcoRI digestions of pAM1 from UV202 (lanes 1 and 2) and JH2-2 (lanes 3 and 4) cells grown overnight in the presence of 5 µg of tetracycline/ml (lanes 1 and 3) or subcultured for a second day under the same conditions (lanes 2 and 4). The arrow indicates the 1.5-kb band reflecting amplification of tet. (B) SalI digestions. Lanes correspond to those in panel A. The new SalI bands indicating tetracycline amplification are noted with an arrow. (C) PCR products indicating in vivo amplification using the above lysates and primers 1 (AACGAGCACGAGAGCAAAACCCC) and 2 (TTCACGTGTTCGCTCATGGTC). (D) PCR products reflecting tet amplification or its absence in UV202 cells (lanes 1, 3, 5, 7, and 8) or JH2-2 cells (lanes 2, 4, 6, and 9 to 12). Cells harboring pAM1 (lanes 1 and 2) or its deletion mutants, pAM8501 (lanes 3 and 4), pAM8502 (lanes 5 and 6), and pAM8503 (lanes 7 to 12), were grown as indicated below. Strains containing pAM1 or its derivatives pAM8501 or pAM8502 were grown in 5 µg of tetracycline/ml. Strains containing pAM8503 were grown in increasing drug concentrations of 5 µg/ml (lanes 7 and 9), 10 µg/ml (lanes 8 and 10), 15 µg/ml (lane 11), or 20 µg/ml (lane 12). (E) EcoRI digestions of pAM1 from UV202 cells (lanes 1 to 4) or JH2-2 cells (lanes 6 to 8) grown in the presence of increasing concentrations of drug: 5 µg/ml (lanes 1 and 5), 10 µg/ml (lanes 2 and 6), 15 µg/ml (lanes 3 and 7), and 40 µg/ml (lanes 4 and 8). M, the molecular mass marker 1Kb-plus (Invitrogen).

MobB or MobE is necessary for the initial duplication. To determine if either of the pAM1 relaxases (MobB or MobE) was involved in the recombination event, we generated three mutant derivatives with deletions within the related determinants. pAM8501 is a mutant with a 1,264-bp deletion in mobE. pAM1 was cleaved with SalI, and the larger of the two SalI fragments (Fig. 1) was religated and introduced into JH2-2 by electroporation (16). pAM8502 is a mutant with a 789-bp deletion in mobB. In this case, pAM1 was cleaved with BamHI and AflII and filled with DNA polymerase (Klenow), and the larger fragment was religated and introduced into JH2-2 by electroporation. pAM8503 was pAM1 with mutations in both mobB and mobE (both of the above mutations). All three mutants were confirmed by restriction analyses and sequencing. Each derivative was introduced into JH2-2 and UV202, and the cells were grown in increasing concentrations of tetracycline. Both single mutants were able to grow in a manner closely resembling that of pAM1 and exhibited amplification based on the ability to detect a PCR product arising from the 1.5-kb EcoRI fragment (Fig. 4D, lanes 3 to 6). However, the double mutant (pAM8503) behaved differently. UV202 or JH2-2 cells harboring pAM8503 were able to grow in the presence of 5 µg of tetracycline/ml but did not give rise to a detectable amplification pattern (data not shown), and a PCR product representative of the expected new (recombinant) RS (i.e., within the 1.5-kb EcoRI fragment) could not be detected even after growth in increasing concentrations of tetracycline (Fig. 4D, lanes 7 to 12). The data are consistent with the view that relaxase activity of both MobB and MobE can catalyze site-specific recombination involving the nic sites within the two RSs, generating the substrate that can subsequently be utilized for further recombination by the host RecA system.

MobB or MobE is required for conjugative mobilization of pAM1. As mentioned above, the N-terminal regions of the deduced protein sequences of mobB and mobE genes in pAM1 reveal significant homology with corresponding regions of the pMV158 family of relaxases, many of which are encoded in gram-positive plasmids that replicate by rolling-circle replication mechanisms. In several cases, these genes have been shown to be required for conjugative mobilization (14, 30, 34, 36). From this perspective, the plasmid constructions described in the above section were assayed for their ability to be mobilized by pAM307 (pAD1::Tn917 with wild-type conjugation properties) (8) or a derivative (pAM8130) defective in relaxase (17). (Matings were conducted overnight as described in reference 7.) Table 2 shows that, in the presence of pAM307, mobilization of pAM8503 (deletions in both mob genes) was reduced 10-fold compared to that of pAM1. Derivatives with a deletion of only one or the other of the mob genes (i.e., pAM8501 or pAM8502) could be mobilized almost as efficiently as the wild-type pAM1, suggesting that both Mob proteins were functional. Importantly, when the conjugative pAD1 element was defective in its own relaxase (pAM8130, which is defective in traX [17]), no mobilization of pAM8503 was detected, while the mobilization of pAM1 was not affected. This suggests that pAM1 relaxases are required for pAM1 transfer by pAM8130, and pAM307 was utilizing its own relaxase to mobilize pAM8503 (and to a significant degree probably also pAM1, pAM8501, and pAM8502), unless mobilization involved a transient cointegration event between the two plasmids. Whereas transposition of Tn917 from pAM307 might be considered a factor in cointegrate formation (8), restriction analyses of the plasmid content of several transconjugants showed the absence of a new Tn917 copy in the pAM1 derivative. Thus, if cointegrate formation was occurring in the transfer of pAM8503, it must have involved a different mechanism. We also note here (Table 2) that a pAD1 derivative, pAM8131, with a mutation in traW, a traG-like determinant (44) required for pAD1 transfer (17), was not able to mobilize pAM1. Mobilization of small nonconjugative, but mobilizable, plasmids is known to be dependent on a TraG-like function of corresponding coresident conjugative plasmids (44) with one exception, the Enterobacter cloacae CloDF13 plasmid (5). This plasmid encodes its own TraG analog.

View this table: [in this window] [in a new window]   TABLE 2. Mobilization frequencies of pAM1 and its deletion derivatives by pAM307 or its TraX or TraW mutants

Appearance of deletions of repB in pAM1.

Concluding remarks. The ability of bacteria to generate tandem repeats of specific genes as a way of increasing their level of antibiotic resistance is well known; homologous recombination events involving short direct repeats, insertion sequences, and/or transposons are known to be related to such amplification processes (4, 13, 20, 21, 26, 32, 35, 39, 41). However, while it has been previously suggested (15), site-specific recombination events have, to our knowledge, not been reported in such processes. It is now evident that in the case of pAM1, MobE and/or MobB are important in the first step of the amplification of tetracycline resistance by facilitating a site-specific recombination event between the RS1 and RS2 sequences containing putative oriT sites. Further amplification steps occurring via this process might also occur but apparently at a level significantly below that facilitated by the added duplication (i.e., the new 4.6-kb segment, representing an entire unit of pAM11) now able to participate in homologous recombination.

While it is conceivable that the initial recombination between RS1 and RS2 might also occur via homologous recombination, the relatively small size (387 bp) and low sequence identity (57%) of these regions would significantly limit such an occurrence. Indeed, in the absence of MobB and MobE (i.e., in the case of the double-mutant pAM8503), growth in the presence of tetracycline in a RecA⁺ host did not result in amplification. Rather, it gave rise to deletions within repB which probably resulted in tet being upregulated via its proximity to the repB promoter.

Relaxase activities of the Mob proteins play a key role in conjugative mobilization by recognizing an oriT site, cleaving at nic, covalently attaching to the 5' nucleotide, and initiating movement of the single strand into the recipient bacterium. Upon completion of the transfer, the reverse reaction of the relaxase (ligation) is believed to recircularize the molecule (23, 44). From an evolutionary perspective, one can easily envision how two coresident plasmids with similar nic sites could take advantage of the recombination potential of a related relaxase to generate a cointegrate structure, such as that involving pAM11 and pAM12 coming together to generate pAM1. Indeed, an earlier example of this has been reported by Gennaro et al. (18) whereby two small resistance plasmids, pT181 and pE194, in S. aureus, could form a cointegrate structure by a RecA-independent, recombination event facilitated by a plasmid-encoded protein designated Pre (for plasmid recombination). The activity involved specific RSs, RSa and RSb, located on the different plasmids and having 24-bp core sequences that were identical. The Pre protein was later found to correspond to a Mob (relaxase) protein based on sequence similarity, and the RSs corresponded to oriT sites (44).

Sequence analyses of antibiotic resistance elements continue to reveal the degree to which plasmids, transposons, insertion sequences, and integrons have interacted, as new combinations of determinants evolve and amplify via horizontal transfer through the bacterial world. The growing evidence that proteins relating to the conjugation process (e.g., those encoding relaxase) and related oriT sites can participate directly in the recombination process further illustrates the number of genetic tools available to bacteria in their constant effort to survive and evolve.

Nucleotide sequence accession number. The nucleotide sequence of pAM1 has been assigned the GenBank accession number AF503772.

	ACKNOWLEDGMENTS

 
This work was supported by National Institutes of Health grant GM33956. M.V.F. was supported in part by a grant from NATO.

We thank all members of our laboratory for helpful discussions.

	FOOTNOTES

 
* Corresponding author. Mailing address: Department of Biologic and Materials Sciences, School of Dentistry, The University of Michigan, Ann Arbor, MI 48109-1078. Phone: (734) 763-0117. Fax: (734) 763-9905. E-mail: dclewell{at}umich.edu.

	REFERENCES

Top Abstract Text References

 

1. Bernhard, K., H. Schrempf, and W. Goebel. 1978. Bacteriocin and antibiotic resistance plasmids in Bacillus cereus and Bacillus subtilis. J. Bacteriol. 133:897-903.[Abstract/Free Full Text]
2. Bingham, A. H., C. J. Bruton, and T. Atkinson. 1979. Isolation and partial characterization of four plasmids from antibiotic-resistant thermophilic bacilli. J. Gen. Microbiol. 114:401-408.[Medline]
3. Broome-Smith, J. 1980. RecA independent, site-specific recombination between ColE1 or ColK and a miniplasmid they complement for mobilization and relaxation: implications for the mechanism of DNA transfer during mobilization. Plasmid 4:51-63.[CrossRef][Medline]
4. Bruand, C., V. Bidnenko, and S. D. Ehrlich. 2001. Replication mutations differentially enhance RecA-dependent and RecA-independent recombination between tandem repeats in Bacillus subtilis. Mol. Microbiol. 39:1248-1258.[CrossRef][Medline]
5. Cabezon, E., J. I. Sastre, and F. de la Cruz. 1997. Genetic evidence of a coupling role for the TraG protein family in bacterial conjugation. Mol. Gen. Genet. 254:400-406.[CrossRef][Medline]
6. Clewell, D. B. 1990. Movable genetic elements and antibiotic resistance in enterococci. Eur. J. Clin. Microbiol. Infect. Dis. 9:90-102.[CrossRef][Medline]
7. Clewell, D. B., F. Y. An, B. A. White, and C. Gawron-Burke. 1985. Streptococcus faecalis sex pheromone (cAM373) also produced by Staphylococcus aureus and identification of a conjugative transposon (Tn918). J. Bacteriol. 162:1212-1220.[Abstract/Free Full Text]
8. Clewell, D. B., P. K. Tomich, M. C. Gawron-Burke, A. E. Franke, Y. Yagi, and F. Y. An. 1982. Mapping of Streptococcus faecalis plasmids pAD1 and pAD2 and studies relating to transposition of Tn917. J. Bacteriol. 152:1220-1230.[Abstract/Free Full Text]
9. Clewell, D. B., Y. Yagi, and B. Bauer. 1975. Plasmid-determined tetracycline resistance in Streptococcus faecalis: evidence for gene amplification during growth in presence of tetracycline. Proc. Natl. Acad. Sci. USA 72:1720-1724.[Abstract/Free Full Text]
10. Clewell, D. B., Y. Yagi, G. M. Dunny, and S. K. Schultz. 1974. Characterization of three plasmid deoxyribonucleic acid molecules in a strain of Streptococcus faecalis: identification of a plasmid determining erythromycin resistance. J. Bacteriol. 117:283-289.[Abstract/Free Full Text]
11. Clewell, D. B., Y. Yagi, Y. Ike, R. A. Craig, B. L. Brown, and F. An. 1982. Sex pheromones in Streptococcus faecalis: multiple pheromone systems in strain DS5, similarities of pAD1 and pAM1, and mutants of pAD1 altered in conjugative properties, p. 97-100. In D. Schlessinger (ed.), Microbiology—1982. American Society for Microbiology, Washington, D.C.
12. Dunny, G. M., and D. B. Clewell. 1975. Transmissible toxin (hemolysin) plasmid in Streptococcus faecalis and its mobilization of a noninfectious drug resistance plasmid. J. Bacteriol. 124:784-790.[Abstract/Free Full Text]
13. Edlund, T., and S. Normark. 1981. Recombination between short DNA homologies causes tandem duplication. Nature 292:269-271.[CrossRef][Medline]
14. Farias, M. E., and M. Espinosa. 2000. Conjugal transfer of plasmid pMV158: uncoupling of the pMV158 origin of transfer from the mobilization gene mobM, and modulation of pMV158 transfer in Escherichia coli mediated by IncP plasmids. Microbiology 146:2259-2265.[Abstract/Free Full Text]
15. Fierro, F., J. L. Barredo, B. Diez, S. Gutierrez, F. J. Fernandez, and J. F. Martin. 1995. The penicillin gene cluster is amplified in tandem repeats linked by conserved hexanucleotide sequences. Proc. Natl. Acad. Sci. USA 92:6200-6204.[Abstract/Free Full Text]
16. Flannagan, S. E., and D. B. Clewell. 1991. Conjugative transfer of Tn916 in Enterococcus faecalis: trans activation of homologous transposons. J. Bacteriol. 173:7136-7141.[Abstract/Free Full Text]
17. Francia, M. V., and D. B. Clewell. 2002. Transfer origins in the conjugative Enterococcus faecalis plasmids pAD1 and pAM373. Identification of the pAD1 nic site, a specific relaxase and a possible TraG-like protein. Mol. Microbiol. 45:375-395.
18. Gennaro, M. L., J. Kornblum, and R. P. Novick. 1987. A site-specific recombination function in Staphylococcus aureus plasmids. J. Bacteriol. 169:2601-2610.[Abstract/Free Full Text]
19. Guzman, L. M., and M. Espinosa. 1997. The mobilization protein, MobM, of the streptococcal plasmid pMV158 specifically cleaves supercoiled DNA at the plasmid oriT. J. Mol. Biol. 266:688-702.[CrossRef][Medline]
20. Iida, S., I. Kulka, J. Meyer, and W. Arber. 1987. Amplification of drug resistance genes flanked by inversely repeated IS1 elements: involvement of IS1-promoted DNA rearrangements before amplification. J. Bacteriol. 169:1447-1453.[Abstract/Free Full Text]
21. Ives, C. L., and K. F. Bott. 1990. Characterization of chromosomal DNA amplifications with associated tetracycline resistance in Bacillus subtilis. J. Bacteriol. 172:4936-4944.[Abstract/Free Full Text]
22. Jacob, A. E., and S. Hobbs. 1974. Conjugal transfer of plasmid-borne multiple antibiotic resistance in Streptococcus faecalis var. zymogenes. J. Bacteriol. 117:360-372.[Abstract/Free Full Text]
23. Lanka, E., and B. M. Wilkins. 1995. DNA processing reactions in bacterial conjugation. Annu. Rev. Biochem. 64:141-169.[CrossRef][Medline]
24. Llosa, M., S. Bolland, G. Grandoso, and F. de la Cruz. 1994. Conjugation-independent, site-specific recombination at the oriT of the IncW plasmid R388 mediated by TrwC. J. Bacteriol. 176:3210-3217.[Abstract/Free Full Text]
25. Martinez-Bueno, M., E. Valdivia, A. Galvez, and M. Maqueda. 2000. pS86, a new theta-replicating plasmid from Enterococcus faecalis. Curr. Microbiol. 41:257-261.[CrossRef][Medline]
26. McDevitt, D., E. R. Wann, and T. J. Foster. 1993. Recombination at the coagulase locus in Staphylococcus aureus: plasmid integration and amplification. J. Gen. Microbiol. 139:695-706.[Medline]
27. Meyer, R. 1989. Site-specific recombination at oriT of plasmid R1162 in the absence of conjugative transfer. J. Bacteriol. 171:799-806.[Abstract/Free Full Text]
28. Murray, B. E., F. An, and D. B. Clewell. 1988. Plasmids and pheromone response of the ß-lactamase producer Streptococcus (Enterococcus) faecalis HH22. Antimicrob. Agents Chemother. 32:547-551.[Abstract/Free Full Text]
29. Oliver, D. R., B. L. Brown, and D. B. Clewell. 1977. Analysis of plasmid deoxyribonucleic acid in a cariogenic strain of Streptococcus faecalis: an approach to identifying genetic determinants on cryptic plasmids. J. Bacteriol. 130:759-765.[Abstract/Free Full Text]
30. Oskam, L., D. J. Hillenga, G. Venema, and S. Bron. 1991. The large Bacillus plasmid pTB19 contains two integrated rolling-circle plasmids carrying mobilization functions. Plasmid 26:30-39.[CrossRef][Medline]
31. Perkins, J. B., and P. Youngman. 1983. Streptococcus plasmid pAM1 is a composite of two separable replicons, one of which is closely related to Bacillus plasmid pBC16. J. Bacteriol. 155:607-615.[Abstract/Free Full Text]
32. Peterson, B. C., and R. H. Rownd. 1983. Homologous sequences other than insertion elements can serve as recombination sites in plasmid drug resistance gene amplification. J. Bacteriol. 156:177-185.[Abstract/Free Full Text]
33. Polak, J., and R. P. Novick. 1982. Closely related plasmids from Staphylococcus aureus and soil bacilli. Plasmid 7:152-162.[CrossRef][Medline]
34. Priebe, S. D., and S. A. Lacks. 1989. Region of the streptococcal plasmid pMV158 required for conjugative mobilization. J. Bacteriol. 171:4778-4784.[Abstract/Free Full Text]
35. Rownd, R., T. Miki, and J. Greenberg. 1979. Structure, dissociation and amplification of composite R plasmid DNA, p. 3-22. In S. Mitsuhashi (ed.), Microbial drug resistance, vol. 2. University Park Press, Baltimore, Md.
36. Selinger, L. B., N. F. McGregor, G. G. Khachatourians, and M. F. Hynes. 1990. Mobilization of closely related plasmids pUB110 and pBC16 by Bacillus plasmid pXO503 requires trans-acting open reading frame ß. J. Bacteriol. 172:3290-3297.[Abstract/Free Full Text]
37. Warren, G. J., and A. J. Clark. 1980. Sequence-specific recombination of plasmid ColE1. Proc. Natl. Acad. Sci. USA 77:6724-6728.[Abstract/Free Full Text]
38. Weaver, K. E., and D. B. Clewell. 1988. Regulation of the pAD1 sex pheromone response in Enterococcus faecalis: construction and characterization of lacZ transcriptional fusions in a key control region of the plasmid. J. Bacteriol. 170:4343-4352.[Abstract/Free Full Text]
39. Wiebauer, K., S. Schraml, S. W. Shales, and R. Schmitt. 1981. Tetracycline resistance transposon Tn1721: recA-dependent gene amplification and expression of tetracycline resistance. J. Bacteriol. 147:851-859.[Abstract/Free Full Text]
40. Yagi, Y., and D. B. Clewell. 1976. Plasmid-determined tetracycline resistance in Streptococcus faecalis: tandemly repeated resistance determinants in amplified forms of pAM1 DNA. J. Mol. Biol. 102:583-600.[CrossRef][Medline]
41. Yagi, Y., and D. B. Clewell. 1977. Identification and characterization of a small sequence located at two sites on the amplifiable tetracycline resistance plasmid pAM1 in Streptococcus faecalis. J. Bacteriol. 129:400-406.[Abstract/Free Full Text]
42. Yagi, Y., and D. B. Clewell. 1980. Recombination-deficient mutant of Streptococcus faecalis. J. Bacteriol. 143:966-970.[Abstract/Free Full Text]
43. Yagi, Y., and D. B. Clewell. 1980. Amplification of the tetracycline resistance determinant of plasmid pAM1 in Streptococcus faecalis: dependence on host recombination machinery. J. Bacteriol. 143:1070-1072.[Abstract/Free Full Text]
44. Zechner, E. L., F. de la Cruz, R. Eisenbrandt, A. M. Grahn, G. Koraimann, E. Lanka, G. Muth, W. Pansegrau, C. M. Thomas, B. M. Wilkins, and M. Zatyka. 2000. Conjugative-DNA transfer processes, p. 87-174. In C. M. Thomas (ed.), The horizontal gene pool. Bacterial plasmids and gene spread. Harwood Academic Publishers, Amsterdam, The Netherlands.

This article has been cited by other articles:

• Cesar, C. E., Llosa, M. (2007). TrwC-Mediated Site-Specific Recombination Is Controlled by Host Factors Altering Local DNA Topology. J. Bacteriol. 189: 9037-9043 [Abstract] [Full Text]  
• Kienesberger, S., Gorkiewicz, G., Joainig, M. M., Scheicher, S. R., Leitner, E., Zechner, E. L. (2007). Development of Experimental Genetic Tools for Campylobacter fetus. Appl. Environ. Microbiol. 73: 4619-4630 [Abstract] [Full Text]  
• Criado, R., Diep, D. B., Aakra, A., Gutierrez, J., Nes, I. F., Hernandez, P. E., Cintas, L. M. (2006). Complete Sequence of the Enterocin Q-Encoding Plasmid pCIZ2 from the Multiple Bacteriocin Producer Enterococcus faecium L50 and Genetic Characterization of Enterocin Q Production and Immunity.. Appl. Environ. Microbiol. 72: 6653-6666 [Abstract] [Full Text]  
• Lodato, P. B., Rogers, E. J., Lovett, P. S. (2006). A Variation of the Translation Attenuation Model Can Explain the Inducible Regulation of the pBC16 Tetracycline Resistance Gene in Bacillus subtilis. J. Bacteriol. 188: 4749-4758 [Abstract] [Full Text]  
• Draper, O., Cesar, C. E., Machon, C., de la Cruz, F., Llosa, M. (2005). Site-specific recombinase and integrase activities of a conjugative relaxase in recipient cells. Proc. Natl. Acad. Sci. USA 102: 16385-16390 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Francia, M. V. Articles by Clewell, D. B. Search for Related Content PubMed PubMed Citation Articles by Francia, M. V. Articles by Clewell, D. B.