Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Peralta-Gil, M. Articles by Espín, G. Search for Related Content PubMed PubMed Citation Articles by Peralta-Gil, M. Articles by Espín, G.

 Previous Article  |  Next Article 

Journal of Bacteriology, October 2002, p. 5672-5677, Vol. 184, No. 20
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.20.5672-5677.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Expression of the Azotobacter vinelandii Poly-ß-Hydroxybutyrate Biosynthetic phbBAC Operon Is Driven by Two Overlapping Promoters and Is Dependent on the Transcriptional Activator PhbR

Martín Peralta-Gil,¹ Daniel Segura,¹ Josefina Guzmán,¹ Luis Servín-González,² and Guadalupe Espín^1*

Departamento de Microbiología Molecular, Instituto de Biotecnología,¹ Departamento de Biología Molecular y Biotecnología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Cuernavaca Morelos 62250, Mexico²

Received 29 May 2002/ Accepted 7 July 2002

Top Abstract Introduction Materials and Methods Results and Discussion References

 
The Azotobacter vinelandii phbBAC genes encode the enzymes for poly-ß-hydroxybutyrate (PHB) synthesis. The phbR gene, which is located upstream of and in the opposite direction of phbBAC, encodes PhbR, a transcriptional activator which is a member of the AraC family of activators. Here we report that a mutation in phbR reduced PHB accumulation and transcription of a phbB-lacZ fusion. We also report that phbB is transcribed from two overlapping promoters, p_B1 and p_B2. The region corresponding to the -35 region of p_B1 overlaps the p_B2 -10 region. In the phbR mutant, expression of phbB from the p_B1 promoter is significantly reduced, whereas expression from the p_B2 promoter is slightly increased. Two phbR promoters, p_R1 and p_R2, were also identified. Transcription from p_R2 was shown to be dependent on ^S. Six conserved 18-bp sites, designated R1 to R6, are present within the phbR-phbB intergenic region and are proposed to be putative binding targets for PhbR. R1 overlaps the -35 region of the p_B1 promoter. A model for the regulation of phbB transcription by PhbR is proposed.

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Azotobacter vinelandii is a nitrogen-fixing soil bacterium that undergoes differentiation to form desiccation-resistant cysts and produces two polymers that have industrial importance, alginate and poly-ß-hydroxybutyrate (PHB). PHB synthesis in Azotobacter species has been shown to be controlled posttranscriptionally at the level of ß-ketothiolase activity, which catalyzes the first step of PHB synthesis (20). Oxygen limitation initiates the synthesis of this polymer (19). Under relaxed oxygen conditions acetyl coenzyme A (acetyl-CoA) is fed into the tricarboxylic acid cycle, and the resulting CoA inhibits ß-ketothiolase activity. Under oxygen limitation and carbon-excess conditions, the level of NAD(P)H increases and NAD(P)H inhibits citrate synthase and isocitrate dehydrogenase, elevating the levels of acetyl-CoA and lowering the CoA levels; thus, the inhibition of ß-ketothiolase by CoA is overcome, which allows synthesis of PHB to proceed (20).

A PHB biosynthetic gene cluster (phbBAC) codes for the enzymatic activities involved in PHB synthesis, including ß-ketothiolase (PhbA), acetoacetyl-CoA reductase (PhbB), and PHB synthase (PhbC), in Azotobacter sp. strain FA8 (16) and A. vinelandii (D. Segura, T. Cruz, and G. Espín, unpublished results). Linked to the phbBAC biosynthetic genes, phbR, a gene coding for a protein exhibiting identity to transcriptional activators of the XylS/AraC family, was identified in A. vinelandii (D. Segura, unpublished); 310 nucleotides upstream and in the direction opposite that of the phb biosynthetic cluster a phbR gene is also present in Pseudomonas sp. strain 61-3. It has been proposed that this gene is a positive regulatory factor for the PHB biosynthetic genes (11). The AraC family includes more than 100 proteins from different bacteria. Most family members are transcription activators that bind to specific 18- to 20-bp sequences at target promoters (for a review see reference 6). The 100 amino acids of the AraC C-terminal domain constitute the DNA binding domain, which is predicted to contain two helix-turn-helix DNA binding regions (6). The conservation of the AraC family DNA binding domain is such that other family members are likely to bind to their targets in a similar manner.

The presence of phbR upstream of the phbBAC biosynthetic gene cluster in A. vinelandii (Segura, unpublished) suggests that PHB synthesis in this bacterium may also be controlled at the transcriptional level.

In this paper, we report isolation and characterization of a phbR mutant and identification of four promoters within the phbR-phbB intergenic region: two overlapping promoters that transcribe phbB and two promoters that transcribe phbR. Our data indicate that PhbR activates transcription from one of the phbB promoters.

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Bacterial strains, media, and growth conditions. The A. vinelandii strains and plasmids used in this study are listed in Table 1. A. vinelandii cells were grown at 30°C, on PY medium (5 g of peptone per liter, 3 g of yeast extract per liter) supplemented with sucrose (20 g/liter). Growth was determined by determining the amount of protein by the method of Lowry et al. (9). The following antibiotic concentrations were used: kanamycin, 3 and 10 µg/ml; spectinomycin, 25 µg/ml; and gentamicin, 0.25 µg/ml.

View this table: [in this window] [in a new window]

TABLE 1. Bacterial strains and plasmids used in this work

Microbiological procedures. A. vinelandii transformation was carried out as described previously (2). Random mini-Tn5 mutagenesis of a strain was carried out with a PUT derivative containing the mini-Tn5 lacZ2 transposon (5), as previously described (12). PHB accumulation was determined by the method of Law and Slepecky (7) as described previously (10).

Enzymatic activities. ß-Galactosidase activity was measured as reported by Miller (13); 1 U of activity corresponded to 1 nmol of o-nitrophenyl-ß-D-galactoside hydrolyzed per min per mg of protein. ß-Glucuronidase activity was measured as reported by Wilson et al. (25). ß-Ketothiolase, acetoacetyl-CoA reductase, and PHB synthase activities were assayed by the methods of Segura et al. (unpublished). Protein was determined by the method of Lowry et al. (9). All measurements were done in triplicate.

Nucleic acid procedures. RNA and DNA isolation and cloning and Southern blotting procedures were carried out as described previously (17).

Construction of A. vinelandii phbR and rpoS mutants. It was previously shown that in A. vinelandii insertion of the gentamicin cassette from plasmid pBSL98 (1) into the ampD gene in the same orientation as the direction of transcription produces a nonpolar mutation, which allows transcription of a downstream gene in the same operon (15). A 2.2-kb PstI restriction fragment containing phbR and phbB from strain UW136 was cloned into plasmid pBluescript KS(+), producing plasmid pTC2P (Fig. 1). This plasmid was partially digested with BamHI, and the ends were made blunt by treatment with the Klenow fragment. A 4.25-kb EcoRI fragment with a spectinomycin resistance gene (Sp) and the gusA reporter was isolated from plasmid pCAM140 (25) and cloned into plasmid pBSL97 (1). The resulting plasmid was designated pMP01. The Sp gene in pMP01 was replaced by a 0.8-kb fragment containing a gentamicin resistance gene (Gm) from pBSL98 (1) to create plasmid pSM-Gus-Gm. A 2.8-kb XhoI fragment containing gusA and the Gm gene was isolated from pSM-Gus-Gm, made blunt by treatment with the Klenow fragment, and inserted into the phbR gene at the BamHI site (also made blunt by treatment with the Klenow fragment) in the same orientation as the orientation of phbR transcription, to create a phbR::Gus-Gm nonpolar mutation. The resultant plasmid, pSMR4 (Fig. 1), which is unable to replicate in A. vinelandii, was introduced by transformation into strains UW136 and AJ2, as reported by Bali et al. (2) Two gentamicin-resistant transformants, one from each strain (designated JGW-R and AJ2-R, respectively), were chosen for further analysis. Replacement of the phbR gene with the phbR::Gus-Gm mutation on the chromosomes of strains JGW-R and AJ2-R was confirmed by Southern analysis by using plasmid pTC2P as the probe (data not shown).

View larger version (17K): [in this window] [in a new window]

FIG. 1. Physical map of the A. vinelandii phbB and phbR region and plasmids constructed in this study.

Plasmid pSMS7 carrying an rpoS::Sp mutation (4) was transformed into strains UW136 and JGW-R. Two spectinomycin-resistant transformants, one from each strain (designated JGW-S and JGW-RS, respectively), were confirmed by Southern analysis to carry the rpoS::Sp mutation (data not shown)

High-resolution S1 nuclease mapping. Probes for S1 mapping were prepared by PCR amplification, after the 5' ends of the primers were labeled with [-³²P]ATP (3,000 Ci/mmol) by using T4 polynucleotide kinase. The labeled primer used to map the phbB transcriptional start site was 5'GATTGCTGTCCCGATTCCGC3', and the unlabeled primer was 5'CCAGCCCATAGGCCTTGAGC3'; these primers generated a 787-bp phbB probe. The PCR probe, uniquely labeled at one end, was purified from low-melting-point agarose gels. A total of 10⁵ Cerenkov counts of probe per min (corresponding to about 50 ng) was hybridized to 50 µg of total RNA isolated from cells grown on PY medium supplemented with 2% sucrose. Hybridization, processing of the samples, and gel electrophoresis of the protected fragments were performed as previously described (21, 23). The protected fragments were electrophoresed parallel to sequence ladders obtained with the labeled primer used for probe preparation.

To map the phbR start sites, labeled primer 5'CCAGCCCATAGGCCTTGAGC3' and unlabeled primer 5'GATTGCTGTCCCGATTCCGC3' were used to generate the 787-bp phbR probe.

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Isolation and characterization of strain DS268. To study regulation of PHB accumulation, we isolated mutants affected in the production of PHB. UW136 is an A. vinelandii strain that has an opaque phenotype on PY medium supplemented with 2% sucrose due to accumulation of PHB (18). Mini-Tn5 mutagenesis of strain UW136 produced mutant strain DS268, which is less opaque than the UW136 parent strain (data not shown). Strain DS268 produced PHB at a level that was about 28% of the wild-type level (Table 2).

View this table: [in this window] [in a new window]

TABLE 2. PHB production and PHB biosynthetic activitiesa

A PstI DNA fragment containing the mini-Tn5 insertion of mutant DS268 was cloned in pBluescriptKS+ to obtain plasmid pDS1T (Fig. 1). By sequencing across the transposon-insertion junction in plasmid pDS1T, the location of the mini-Tn5 mutation was found to lie within phbR (Fig. 1), between codons 202 and 205. Downstream of phbR and in the same orientation, an open reading frame designated phbP encoding a protein similar to PHA granule-associated phasin is present.

Strain JGW-R, a UW136 derivative carrying a phbR::Gus-Gm nonpolar mutation, was constructed as described in Materials and Methods. Similar to the phbR::Tn5 mutation, the phbR::Gus-Gm mutation reduced PHB accumulation by 64% (Fig. 2B), confirming that this phenotype was due to inactivation of phbR and not to a polar effect on phbP.

View larger version (14K): [in this window] [in a new window]

FIG. 2. Growth (A) and PHB accumulation (B) of strains UW136 () and JGW-R (•). (C) ß-Galactosidase activity in strains AJ2 (), and AJ2-phbR (). Cells were grown on PY medium with 2% sucrose.

Effect of the phbR mutation on the activities of the PHB biosynthetic enzymes. The PHB biosynthetic phbBAC genes seem to be organized as an operon since a mutation in phbB, encoding acetoacetyl-CoA reductase, was shown to negatively affect the ß-ketothiolase (PhbA) and PHB synthase (PhbC) activities (Segura, unpublished). The activities of the three enzymes of the PHB biosynthetic pathway were determined in the DS268 mutant. In agreement with the 70% reduction in PHB accumulation, the levels of the acetoacetyl-CoA reductase, ß-ketothiolase, and PHB synthase activities detected in strain DS268 were about 30% of the wild-type levels (Table 2). These results suggest that PhbR acts as an activator of the phbBAC biosynthetic gene cluster but that in its absence there is still significant expression of the operon.

Analysis of phbB expression by using a phbB-lacZ gene fusion. We determined the effect of the phbR mutation on transcription of the phbBAC operon. The induction kinetics of phbB transcription was determined in vivo by measuring the ß-galactosidase activity in strain AJ2 (UW136 carrying the phbB::lacZ fusion) and is shown in Fig. 2. Expression of phbB was detected during the exponential phase and upon entry into and during the stationary phase. Figure 2 also shows that the ß-galactosidase activity in strain AJ2-R, an AJ2 derivative with the phbR::Gm mutation, was significantly reduced, in agreement with the reductions in both PHB biosynthetic activities and accumulation of PHB observed in phbR mutants, further supporting the hypothesis that PhbR activates transcription of the phbBAC operon.

Transcription of phbB is initiated from two overlapping promoters. High-resolution S1 nuclease mapping experiments were carried out to identify the transcription start site(s) upstream the phbB gene. They were carried out with total RNA isolated from exponentially growing cells and from stationary-phase cultures of UW136. The probe for mapping the phbB promoters was prepared by PCR amplification as described in Materials and Methods and is indicated in Fig. 1. As shown in Fig. 3 for UW136 (48 h), two transcriptional start sites, located 92 and 115 nucleotides upstream of the ATG start codon of phbB, were identified by using RNA from stationary-phase (48-h) cultures, which defined promoters p_B1 and p_B2, respectively. Transcription from p_B2 was barely detected in RNA from exponentially growing cells (Fig. 3, UW136 [8 h]) and increased in stationary-phase cells (UW136 [48 h]). The intensities of the signals corresponding to the promoters detected indicate that p_B1 is a stronger promoter than p_B2. Figure 4 shows that the -35 region of p_B1 overlaps the -10 region of p_B2, suggesting that strong transcription from p_B1 could affect transcription from p_B2.

View larger version (46K): [in this window] [in a new window]

FIG. 3. S1 nuclease mapping analysis of phbB transcription in strains UW136, JGW-R, and JGW-S.

View larger version (29K): [in this window] [in a new window]

FIG. 4. Intergenic phbR-phbB region. The arrows indicate transcription start sites. The phbB and phbR start codons are indicated by boldface type. The -10 sequences of pB1, pB2, pR1, and pR2 are overlined. Sites R1 to R6 are enclosed in boxes. The putative CydR binding site is indicated by asterisks.

Transcription of phbB from p_B1 depends on PhbR. As shown above, PhbR is a transcriptional activator apparently involved in the regulation of PHB production in A. vinelandii, since a mutation in phbR reduced PHB accumulation and phbB transcription. To further investigate the involvement of phbR in regulation of PHB biosynthesis, we tested the effect of the phbR::Gus-Gm mutation on transcription of the phbB gene. Transcripts corresponding to the p_B1 and p_B2 promoters were clearly detected in the JGW-R phbR mutant (Fig. 3). The level of the p_B1 transcript was significantly reduced, whereas the level of the p_B2 transcript was increased, indicating that PhbR activates transcription from the p_B1 promoter and that this activation interferes with the p_B2 promoter. Lack of activation of p_B1 by PhbR might allow the RNA polymerase to exhibit more efficient initiation from p_B2 (see below).

In agreement with the PHB production leaky phenotype of the phbR mutant, transcription of phbB is not totally dependent on PhbR.

^S is needed for expression of the p_B2 promoter in the exponential phase. Transcription from p_B2 increases significantly during the stationary phase. To test whether p_B2 is a promoter of the class recognized by ^S, we carried out an S1 nuclease mapping experiment with RNA isolated from rpoS mutant JGW-S. As shown in Fig. 3, this promoter is not transcribed in the rpoS mutant during the stationary phase; however, and in contrast to the wild-type situation, transcription of this promoter increased in exponentially growing cells (Fig. 3, JGW-S [8 h]). This result suggests that p_B2 is recognized by both ^S and ^D. In fact, the -10 region of p_B2 (Fig. 4) has a sequence (CTATCCT) which corresponds well to the ^S-dependent promoter consensus sequence CTACACT (8).

Transcription analysis of the phbR promoter. We also identified the transcription start sites of the A. vinelandii phbR gene by performing S1 nuclease mapping experiments as described above (see Materials and Methods). Two transcriptional start sites were revealed; these sites were located 61 and 139 nucleotides upstream of the ATG start codon, identifying promoters p_R1 and p_R2 (Fig. 5, UW136 [48 h]). Transcription from the p_R2 promoter was not detected in exponentially growing cells and in the rpoS mutant (Fig. 5, UW136 [8 h] and JGW-R). However, the CTACACT consensus sequence recognized by ^S is not present in the -10 region of p_R2 (Fig. 4), suggesting that transcription from p_R2 is under ^S control in an indirect manner. During the stationary phase, both promoters seem to contribute equally to the expression of phbR.

View larger version (38K): [in this window] [in a new window]

FIG. 5. S1 nuclease mapping analysis of phbR transcription in strains UW136, JGW-R, and JGW-S.

Transcription of phbR was also studied by using a phbR-gus fusion. Similar to transcription of phbB, transcription of phbR increased upon entry into the stationary phase and, as expected, was reduced in the rpoS mutant (Fig. 6).

View larger version (13K): [in this window] [in a new window]

FIG. 6. ß-Glucuronidase activity in strains JGW-R () and JGW-RS (•) during growth on PY medium supplemented with 2% sucrose.

Sequence analysis of the phbB-phbR intergenic region. PhbR belongs to the AraC family of transcriptional regulators. The binding targets for some of these regulators, such as AraC and MelR from Escherichia coli, consist of repeated sequences 17 or 18 nucleotides long that possess conserved motifs. Each monomer binds to one of these conserved sequences. MelR binds to four target sites, sites 1', 1, 2, and 2', in the melAB promoter of E. coli, where the less conserved site 2' (7 of 18 bases) binds MelR most weakly (3). MelR binding to site 2' occurs only in the presence of melobiose and is absolutely required for expression of melAB. Improvement of the base sequence of site 2' removes the requirement for sites 1 and 1' and for melobiose (3, 22). Binding of MelR to a fifth site that overlaps the melR promoter has been shown to downregulate expression from the melR promoter (24).

Analysis of the phbB promoter region revealed two almost identical 18-bp sequences centered at positions -134 and -155 upstream from the ATG start codon (Fig. 4). We designated these putative PhbR binding sites R1 and R2. Scrutiny of the DNA sequences further upstream of site R2 revealed another four less-conserved 18-bp sites that we designated R3, R4, R5, and R6 (Fig. 4). Interestingly, we found that similar 18-bp sites are present in the phbR-phbB intergenic region of Pseudomonas sp. strain 61-3 (accession number AB014757), the other bacterium in which phbR has been described. An alignment of these R sites is shown in Fig. 7.

View larger version (52K): [in this window] [in a new window]

FIG. 7. (A) Alignment of the A. vinelandii and Pseudomonas sp. strain 61-3 putative PhbR binding sites. (B) Alignment of the cydAB CydR binding sites with the putative CydR binding site present in the phbB promoter.

Site R1 overlaps the -35 region of p_B1. R2 is located 3 nucleotides upstream of R1 (Fig. 4). The position of the A. vinelandii R1 and R2 sites is similar to the position of the binding sites (sites 2 and 2') for MelR (3), where site 2' also overlaps the -35 region of the melAB promoter. However, in contrast to the A. vinelandii R1 site that is almost identical to the R2 site, MelR site 2' is much less conserved (7 of 18 bases). The identity of the A. vinelandii R1 and R2 sites suggests that no inducer is required for activation, and in fact no inducer for PHB synthesis is known.

Although less conserved, putative PhbR binding site R5 overlaps the -10 region of the divergent phbR pR2 promoter, thus raising the possibility that PhbR acts as a repressor of its own transcription. However, when transcription of the phbR promoters in a phbR mutant was analyzed, transcription from the p_R2 promoter was only slightly increased compared to transcription from p_R1 (Fig. 5).

By analogy to the AraC (14) and MelR models, we propose that PhbR binds to the R1 and R2 sites and probably to the other less-conserved sites (R3 to R6) to activate transcription from the p_B1 promoter. This proposal is based on the observation that in the phbR mutant, activation from p_B1 is significantly diminished. We also propose that a reduction in transcription initiation from p_B1 would free the -10 region of p_B2 from PhbR occupation, favoring PhbR-independent transcription from p_B2.

We also found a putative CydR binding site within the phbB promoter region that overlaps the -10 region of p_B1 (Fig. 4 and 7). CydR is an Fnr-like regulatory protein that negatively regulates expression of cydAB (26, 27). The presence of this CydR binding site suggests that expression of the phbBAC operon could be negatively regulated by CydR. Interestingly, it has been shown that the levels of PHB biosynthetic ß-ketothiolase and acetoacetyl-CoA reductase proteins are elevated in a cydR mutant (28).

Based on previously published data and the results obtained in this study, a model for the regulation of PHB synthesis in A. vinelandii is proposed. In exponentially growing cells, low levels of PHB synthesis are due to inhibition of ß-ketothiolase activity and to a low level of phbR transcription. Upon entry into the stationary phase, the increase in transcription of rpoS and phbR increases transcription of the phbBAC operon, elevating the levels of the PHB biosynthetic enzymes. In addition, the tricarboxylic acid cycle activity might slow down during the stationary phase, allowing an increase in the acetyl-CoA/CoA ratio and in turn relieving the inhibitory effect on ß-ketothiolase.

In summary, this study showed that control of synthesis of PHB in A. vinelandii is regulated at the transcriptional level and that the transcriptional activator PhbR is a main regulator.

 
This work was supported by grant 27767 from CONACyT. M. Peralta-Gil thanks CONACyt and PADEP-UNAM for financial support during his Ph.D. studies.

We thank R. Noguez for helpful discussions and S. Moreno for technical support.

 
* Corresponding author. Mailing address: Departamento de Microbiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México, Apdo Postal 510-3, Cuernavaca Morelos 62250, Mexico. Phone: 52-73-291644. Fax: 52-73-172388. E-mail: espin{at}ibt.unam.mx.

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1
1. Alexeyev, F. A., I. N. Shokolenko, and T. P. Croughan. 1995. Improved antibiotic-resistance gene cassettes and omega elements for Escherichia coli vector construction and in vivo deletion/insertion mutagenesis. Gene 160:63-67.[CrossRef][Medline]
2
2. Bali, A., G. Blanco, S. Hill, and C. Kennedy. 1992. Excretion of ammonium by a nifL mutant of Azotobacter vinelandii fixing nitrogen. Appl. Environ. Microbiol. 58:1711-1718.[Abstract/Free Full Text]
3
3. Belyaeva, T. A., J. T. Wade, C. L. Webster, V. J. Howard, M. S. Thomas, E. I. Hyde, and S. J. W. Busby. 2000. Transcription activation at the Escherichia coli melAB promoter: the role of MelR and the cyclic APMP receptor proteinol. Mol. Microbiol. 36:211-222.[CrossRef][Medline]
4
4. Castañeda, M., J. Sánchez, S. Moreno, C. Núñez, and G. Espín. 2001. The global regulators GacA and ^S form part of a cascade that controls alginate production in Azotobacter vinelandii. J. Bacteriol. 183:6787-6793.[Abstract/Free Full Text]
5
5. De Lorenzo, V., M. Herrero, V. Jakubzik, and K. N. Timmis. 1990. Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria. J. Bacteriol. 172:6568-6572.[Abstract/Free Full Text]
6
6. Gallegos, M. T., R. Schleif, A. Bairoch, K. Hoffman, and J. L. Ramos. 1997. AraC/XylS family of transcriptional regulators. Microbiol. Mol. Biol. Rev. 61:393-410.[Abstract]
7
7. Law, J. H., and R. A. Slepecky. 1961. Assay of poly-ß-hydroxybutyric acid. J. Bacteriol. 82:33-36.[Abstract/Free Full Text]
8
8. Lee, J. L., and J. D. Gralla. 2001. Sigma 38 (rpoS) RNA polymerase promoter engagement via -10 region nucleotides. J. Biol. Chem. 276:30064-30071.[Abstract/Free Full Text]
9
9. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193:265-275.[Free Full Text]
10
10. Martínez, P., J. Guzmán, and G. Espín. 1997. A mutation impairing alginate production increased accumulation of poly-ß-hydroxybutyrate in Azotobacter vinelandii. Biotechnol. Lett. 19:909-912.[CrossRef]
11
11. Matsusaki, H., S. Manji, K. Taguchi, M. Kato, T. Fukui, and Y. Doi. 1998. Cloning and molecular analysis of the poly(3-hydroxybutyrate) and poly(3-hydroxybutyrate-co-3-hydroxyalkanoate) biosynthesis genes in Pseudomonas sp. strain 61-3. J. Bacteriol. 180:6459-6467.[Abstract/Free Full Text]
12
12. Mejía-Ruíz, H., S. Moreno, J. Guzmán, R. Nájera, R. León, G. Soberón-Chávez, and G. Espín. 1997. Isolation and characterization of an Azotobacter vinelandii algK mutant. FEMS Microbiol. Lett. 156:101-106.[Medline]
13
13. Miller, J. H. 1972. Experiments in molecular genetics, p. 431-435. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
14
14. Niland, P., R. Hühne, and B. Müller-Hill. 1996. How AraC interacts specifically with its target DNAs. J. Mol. Biol. 264:667-674.[CrossRef][Medline]
15
15. Núñez, C., S. Moreno, L. Cardenas, G. Soberón-Chávez, and G. Espín. 2000. Inactivation of the ampDE operon increases transcription of algD and affects morphology and encystment of Azotobacter vinelandii. J. Bacteriol. 182:4829-4835.[Abstract/Free Full Text]
16
16. Pettinari, J. M., G. J. Vázquez, D. Silberschmidt, B. Rehm, A. Steinbüchel, and B. S. Mendez. 2001. Poly(3-hydroxybutyrate) synthesis genes in Azotobacter sp. strain FA8. Appl. Environ. Microbiol. 67:5331-5334.[Abstract/Free Full Text]
17
17. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
18
18. Segura, D., and G. Espín. 1998. Mutational inactivation of a gene homologous to Escherichia coli ptsP affects poly-ß-hydroxybutyrate accumulation and nitrogen fixation in Azotobacter vinelandii. J. Bacteriol. 180:4790-4798.[Abstract/Free Full Text]
19
19. Senior, P. J., G. A. Beech, G. A. Ritchie, and E. A. Dawes. 1972. The role of oxygen limitation in the formation of poly-ß-hydroxybutyrate during batch and continuous culture of Azotobacter beijerinckii. Biochem J. 128:1193-1201.[Medline]
20
20. Senior, P. J., and E. A. Dawes. 1973. The regulation of poly-ß-hydroxybutyrate metabolism in Azotobacter beijerinckii. Biochem. J. 134:225-238.[Medline]
21
21. Servín-González, L., C. Castro, C. Pérez, M. Rubio, and F. Valdez. 1997. bldA-dependent expression of Streptomyces exfoliatus M11 lipase gene (lipA) in mediated by the product of a contiguous gene, lipR, encoding a putative transcriptional activator. J. Bacteriol. 179:7816-7826.[Abstract/Free Full Text]
22
22. Tamai, E., T. A. Belyaeva, S. J. W. Busby, and T. Tsuchiya. 2000. Mutations that increase the activity of the promoter of the Escherichia coli melobiose operon improve the binding of MelR, a transcriptional activator triggered by melobiose. J. Biol. Chem. 275:17058-17063.[Abstract/Free Full Text]
23
23. Valdez, F., G. González-Cerón, H. M. Keiser, and L. Servín-González. 1999. The Streptomyces coelicolor A3(2) lipAR operon encodes an extracellular lipase and a new type of transcriptional regulator. Microbiology 145:2365-2374.[Abstract/Free Full Text]
24
24. Wade, J. T., T. A. Belyaeva, E. I. Hyde, and S. J. W. Busby. 2000. Repression of the Escherichia coli melR promoter by MelR: evidence that efficient repression requires the formation of a repression loop. Mol. Microbiol. 36:223-229.[CrossRef][Medline]
25
25. Wilson, K. J., A. Sessitsch, J. C. Corbo, K. E. Giller, A. D. L. Akkermans, and R. A. Jefferson. 1995. ß-Glucuronidase (GUS) transposons for ecological and genetic studies in rhizobia and other Gram-negative bacteria. Microbiology 141:1691-1705.[Abstract/Free Full Text]
26
26. Wu, G., S. Hill, M. J. S. Kelly, G. Sawers, and R. K. Poole. 1997. The cydR gene product, required for cytochrome bd expression in the obligate aerobe Azotobacter vinelandii, is a Fnr-like protein. Microbiology 143:2197-2207.[Abstract/Free Full Text]
27
27. Wu, G., H. Cruz-Ramos, S. Hill, J. Green, G. Sawers, and R. K. Poole. 2000. Regulation of cytochrome bd expression in the obligate aerobe Azotobacter vinelandii by CydR (Fnr): sensitivity to oxygen reactive oxygen species and nitric oxide. J. Biol. Chem. 275:4679-4686.[Abstract/Free Full Text]
28
28. Wu, G., A. J. Moir, G. Sawers, S. Hill, and R. K. Poole. 2001. Biosynthesis of poly-beta-hydroxybutyrate (PHB) is controlled by CydR (Fnr) in the obligate aerobe Azotobacter vinelandii. FEMS Microbiol. Lett. 194:215-220.[Medline]

---

Journal of Bacteriology, October 2002, p. 5672-5677, Vol. 184, No. 20
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.20.5672-5677.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Setubal, J. C., dos Santos, P., Goldman, B. S., Ertesvag, H., Espin, G., Rubio, L. M., Valla, S., Almeida, N. F., Balasubramanian, D., Cromes, L., Curatti, L., Du, Z., Godsy, E., Goodner, B., Hellner-Burris, K., Hernandez, J. A., Houmiel, K., Imperial, J., Kennedy, C., Larson, T. J., Latreille, P., Ligon, L. S., Lu, J., Maerk, M., Miller, N. M., Norton, S., O'Carroll, I. P., Paulsen, I., Raulfs, E. C., Roemer, R., Rosser, J., Segura, D., Slater, S., Stricklin, S. L., Studholme, D. J., Sun, J., Viana, C. J., Wallin, E., Wang, B., Wheeler, C., Zhu, H., Dean, D. R., Dixon, R., Wood, D. (2009). Genome Sequence of Azotobacter vinelandii, an Obligate Aerobe Specialized To Support Diverse Anaerobic Metabolic Processes. J. Bacteriol. 191: 4534-4545 [Abstract] [Full Text]  
• Leon, R., Espin, G. (2008). flhDC, but not fleQ, regulates flagella biogenesis in Azotobacter vinelandii, and is under AlgU and CydR negative control. Microbiology 154: 1719-1728 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Peralta-Gil, M. Articles by Espín, G. Search for Related Content PubMed PubMed Citation Articles by Peralta-Gil, M. Articles by Espín, G.