Previous Article | Next Article ![]()
Journal of Bacteriology, October 2002, p. 5789-5799, Vol. 184, No. 20
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.20.5789-5799.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
-Proteobacteria Caulobacter crescentus and Rickettsia prowazekii Chromosomal Replication Origins
Department of Microbiology & Immunology, Dalhousie University, Halifax, Nova Scotia B3H 4H7, Canada,1 Molecular and Cellular Biology Laboratory, The Salk Institute for Biological Sciences, La Jolla, California 92037-1099,2 Department of Microbiology and Immunology, College of Medicine, University of South Alabama, Mobile, Alabama 36688,3 Department of Microbiology & Immunology, McGill University, Montreal, Quebec H3A 2B4, Canada4
Received 28 March 2002/ Accepted 10 July 2002
| ABSTRACT |
|---|
|
|
|---|
| TEXT |
|---|
|
|
|---|
-proteobacteria. These bacteria have diverse lifestyles despite their close affiliations based on 16S rRNA signature sequences (for reviews see references 16 and 22). Notable members of this group include the nonpathogenic organisms Rhodobacter capsulatus, Caulobacter crescentus, and Sinorhizobium meliloti, as well as the pathogenic organisms Agrobacterium tumefaciens, Brucella abortus, and Rickettsia prowazekii. Recently, the 4-Mb C. crescentus (27), 3.6-Mb S. meliloti (9), 2.8- and 2.0-Mb A. tumefaciens (15), and 1-Mb R. prowazekii (2) genomes have been completely sequenced. Despite the
3-Mb difference in genome size between C. crescentus and R. prowazekii, the hemE and RP001 genes flanking the C. crescentus replication origin were also found to border the putative R. prowazekii replication origin (7). Thus, it is apparent that essential replication sequences survived an extensive genomic reduction. The structure and genomic organization of the C. crescentus replication origin (Cori) are significantly different from the structure and genomic organization of the Escherichia coli replication origin (4, 5). Therefore, it has been hypothesized that Cori represents a new class of
-proteobacterial replication origins (7). Determinations of the hemE and RP001 genes flanking the putative replication origins in S. meliloti and A. tumefaciens further supported this hypothesis (9, 15).
C. crescentus is an excellent model organism for the study of chromosomal replication in
-proteobacteria as extensive studies have been conducted to elucidate the mechanism of regulation of its complex developmental life cycle. This freshwater bacterium has a doubling time of 90 min and asymmetrically divides into two types of morphologically different progeny, the replication-incompetent swarmer cells and the replication-competent stalk cells (8, 26). In order for chromosomal replication to occur, a swarmer cell must differentiate into a stalk cell. Completion of chromosomal replication in the stalk cell signals the transition to the predivisional cell, and then asymmetric division occurs. Cori, identified by autonomous plasmid replication (ARS) assays and in vivo 32P DNA labeling, initiates bidirectional replication in the stalk cell (6, 23). Sequence analysis of Cori revealed features shared with E. coli oriC, such as an AT-rich region and DnaA boxes (23) (Fig. 1B). In addition, Cori possesses unique features, which are described below (Fig. 1B). The hemE operon (23) and the RP001 homolog (7) flank and overlap Cori. A hemE weak promoter (Pw) accounts for most of HemE protein synthesis. A strong promoter (Ps) produces nontranslated transcripts that have been proposed to regulate chromosome replication (24). Five TTAA-n7-TTAA motifs (sites a to e) are binding sites for the response regulator, CtrA (30, 33) (Fig. 1B and 2B). CtrA sites a and b overlap Ps, site c overlaps an IHF site, and site e overlaps an essential DnaA box (24, 33; R. Siam and G. T. Marczynski, Abstr. 100th Gen. Meet. Am. Soc. Microbiol., abstr. H91, p. 368, 2000). Thus, CtrA is essential for regulation of chromosomal replication and other key events in C. crescentus, and therefore it is a global response regulator.
|
|
-proteobacteria (3).
Throughout the C. crescentus cell cycle, CtrA is present in the swarmer cell and the swarmer cell component of the predivisional cell, but CtrA is degraded before the onset of the S phase in the stalk cell by the protease ClpXP (11, 19). Transcription of ctrA is autoregulated by a negative-positive feedback mechanism involving two promoters, P1 and P2 (10). As part of a two-component signal transduction system, CtrA has a histidine kinase counterpart, CckA, which phosphorylates CtrA (CtrA
P) (18). CtrA
P binds to its five sites and apparently represses chromosomal replication in swarmer cells (30, 31). CtrA phosphorylation stimulates cooperative binding at sites a and b, but increased binding to sites c, d, and e is independent (33).
Although related to C. crescentus, R. prowazekii, the cause of louse-borne typhus, is an obligately intracellular parasite that reproduces only within the eukaryotic host cell cytoplasm (35). Research on R. prowazekii is difficult, as R. prowazekii can be cultivated only in eukaryotic cells and has a doubling time of 10 h (36). The bioenergetic mechanisms of this bacterium are well established; however, the method or control of chromosomal replication remains to be elucidated (1). The R. prowazekii replication origin was putatively identified by G-C skew analysis (2). Upon sequence analysis, an AT-rich region and several DnaA boxes based upon the E. coli DnaA box consensus sequence were identified (2). However, unique lysine residues within a highly conserved portion of the DNA binding region in the DnaA protein suggest that DnaA may recognize an alternative DnaA box sequence (34). In addition, a CtrA homolog with 59% identity and 70% homology, CzcR, has been found in R. prowazekii, as well as in Rickettsia conorii (3, 28). The homology is especially significant in the DNA binding carboxy-terminal region. Also, like CtrA, CzcR has a conserved aspartate at position 51 within the putative receiver domain that has the potential for phosphorylation from a histidine kinase.
Here we describe evidence that the R. prowazekii CtrA homolog, CzcR, is functionally similar to CtrA and that the genomic structure of the R. prowazekii putative replication origin (oriRp) is also similar to that of Cori. As determined by DNase I footprinting assays, CtrA binds to five sites matching the CtrA consensus sequence identified in oriRp. Conversely, CzcR binds to the five CtrA binding sites (sites a to e) in Cori. In addition, a 40-bp IHF binding site was found to overlap a central CtrA binding site in oriRp. In vivo complementation assays showed that CzcR can compensate for defective CtrA in C. crescentus cells. Although the ARS assays were negative for the putative oriRp in C. crescentus host cells, our results and previously reported results (2, 7) strongly suggest that oriRp is the actual replication origin. This study provides the first evidence of a conserved functional role for a CtrA homolog at the replication origin in an
-proteobacterium other than C. crescentus. In addition, the implicated role of the CtrA homolog CzcR at the R. prowazekii replication origin further supports the previously reported hypothesis that there is a new class of replication origins in
-proteobacteria.
Bacterial strains and ARS assays.
Strains and plasmids used in this study are listed in Table 1. C. crescentus Cori supports autonomous plasmid replication in C. crescentus but not in E. coli (23). To determine whether oriRp can replicate in C. crescentus, oriRp was cloned into three different plasmid vectors (Bluescript pSKII, pAGMT, and pAYC177) that do not by themselves replicate in C. crescentus. The oriRp plasmid constructs were electroporated into electrocompetent SC1107 CB15N
bla C. crescentus cells (23). For positive and negative controls, Cori plasmids and vector plasmids were individually electroporated into C. crescentus CB15N
bla host cells. A broad-host-range replicating plasmid (pGM976) was included in all electroporation samples as an internal positive control to confirm that electroporation was successful. Electrocompetent cells were prepared by growing cells in 50 ml of PYE medium to an optical density at 660 nm (OD660) of
0.5. These cells were washed three times in sterile 10% glycerol and resuspended in 1 ml (final volume) of sterile 10% glycerol. For electroporation, 0.100 ml of cells was mixed with
1 µg of plasmid DNA in a 1-mm electrocuvette and electroporated by using the EC1 program of a Bio-Rad MicroPulser electroporator. The following plasmid constructs were used: pMW1070, pMW1095, pGM2703, pGM2667, pGM2668 with pSK, pAGMT*, pGM2656, and pGM2657 (vectors for negative controls) and pGM1500, pAGMT*1E, pGM2671, and pGM2672 (positive controls). Electroporated cells were recovered in 1 ml of PYE broth, incubated at 30°C for 90 min, and then spread on PYE medium plates with the appropriate antibiotic(s) for selection (20 µg of ampicillin per ml and 5 µg of gentamicin per ml or 15 µg of tetracycline per ml). Observation of the electroporated oriRp plasmid plates, normalized for background colony growth, revealed negative results for ARS activity (Table 2). To discount the possibility that oriRp may not entirely include the potential ARS element, a larger 1,753-bp (pMW1095) fragment containing oriRp was subjected to the same assays as pMW1070 (pGM2704, pGM2669, pGM2670). Negative ARS assay results were obtained for pMW1095, which supported the initial conclusion that oriRp does not support autonomous plasmid replication in C. crescentus. We initially surmised that the ARS assays failed due to the small size of the fragment (492 bp) containing oriRp that may not have included the entire ARS element. Thus, a much larger fragment (1,753 bp) was tested; however, positive ARS assay results were not obtained. The reasons for the inability of oriRp plasmids to autonomously replicate in C. crescentus are unknown at this time. However, it should noted that R. prowazekii is an obligately intracellular organism; thus, the failure to obtain autonomous plasmid replication may have been due to an inadequate supply of factors, perhaps from the eukaryotic host cell, that may be required for the replication process.
|
|
0.500 and then induced with 1 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) for 30 min, pelleted by centrifugation at 4,000 rpm for 20 min at 4°C, resuspended in 20 ml of cold 1x phosphate-buffered saline-10% glycerol, and sonicated on ice. For extraction, purification, and thrombin cleavage of GST-CtrA we used the protocol provided with a GST fusion protein expression kit (Amersham Pharmacia Biotech). Phenylmethylsulfonyl fluoride (1 mM) and dithiothreitol (1 mM) were added to all reagents. Phosphorylation of CtrA by using purified maltose-binding protein (MBP)-EnvZ and DNase I footprinting assays with poly(dI-dC) (Pharmacia Biotech) employed as nonspecific DNA were performed as described previously (17, 33). The oriRp DNA fragment was prepared from pMW1070 that was cleaved and end labeled at the HincII site with [
-32P]ATP (Amersham Pharmacia) and then cleaved with BamHI (both sites located in the pSK polylinker) or vice versa. The Cori DNA fragment was prepared from pGM1877 that was cleaved and end labeled at the HindIII site with [
-32P]ATP and then cleaved with XhoI (both sites oppositely located in peripheral ends of Cori) or vice versa. For restriction site markers, end-labeled DNA fragments were digested with appropriate enzymes. Sequencing of pMW1070 and pGM1877 with universal pSK or pKS primers was performed with a Sequitherm kit (Epicentre Technologies Inc.).
|
Binding of CzcR to CtrA binding sites in Cori.
To determine if CzcR possesses DNA binding specificity similar to that of CtrA, DNase I footprinting assays were performed with His-CzcR and 32P-end-labeled pGM1877 (Cori) (Fig. 2A). The czcR gene was directionally PCR cloned (5' AAAAAAGGATCCATGAGAGTTTTATTAATT 3' and 5' AAAAAAGAATTCTTATTAT GCTCCTTGTGC 3') with engineered 5' BamHI and 3' EcoRI sites from pMW1089 and ligated into pTrcHisA (Invitrogen). However, overexpression of histidine-tagged CzcR was not successful in E. coli BL21 and M15 host cells due to differential tRNA codon usage. Histidine-tagged CzcR was overexpressed in E. coli BL21(DE3) CodonPlus RIL (Stratagene) by using 5 mM (final concentration) IPTG induction at an OD660 of
0.500 in 1 liter of Luria-Bertani medium with 50 µg of ampicillin per ml for 90 min. Extraction and purification were performed as described previously for histidine-tagged CtrA (29). The E. coli BL21(DE3) strain hosts a plasmid that encodes genes for arginine, isoleucine, and leucine tRNA codons. CzcR was phosphorylated by using purified MBP-EnvZ as described previously (33). The percentage of CzcR phosphorylated was measured as described previously (33). Five CzcR binding sites were detected in Cori; by using restriction site markers and sequencing ladders, these sites were found to be the same as the previously established five CtrA binding sites (sites a to e) in Cori (see Fig. 2B for comparison with CtrA control footprints). Note that the footprint patterns for His-CzcR binding to Cori and CtrA binding to Cori are identical. These results indicate that R. prowazekii CzcR binds to a DNA sequence similar to that to which C. crescentus CtrA binds. In addition, sequence analysis of the upstream region of czcR revealed a putative binding site that matches the CzcR binding consensus sequence, TTWW-N7-TTWW (data not shown). This evidence suggests that CzcR, like CtrA, may also have an autoregulation mechanism.
In vivo CzcR complementation of the C. crescentus ctrA401(Ts) mutation.
To examine CzcR activity in vivo, we tested the complementation of a C. crescentus mutant ctrA401 strain (LS1094). This strain produces a defective CtrA protein at 28°C that becomes nonfunctional, and therefore lethal, at 37°C (29). Compared to wild-type C. crescentus cells, the LS1094 cells at 28°C are prominently elongated and curled, and their motility is reduced due to the stunted growth or the absence of flagella. Stalk synthesis is initiated; however, stalk biogenesis does not occur (29). As the binding properties of CzcR are similar to those of CtrA, can CzcR compensate for a lack of functional CtrA? To investigate this question, a xylose-inducible plasmid was employed. For xylose-conditional expression of CzcR, czcR was directionally PCR cloned (5' AAAAGAATTCATGAGAGTTTTATTAATTGA 3' and 5' AAAAAAGCTTTTATTATGCT CCTTGTGCTA 3') at HindIII and EcoRI sites into pUJ142, which has a xylose-inducible promoter (pGM2767). For xylose-conditional expression of CtrA, pUJ142::ctrA (LS2890) was constructed as described by Domian et al. (11). For positive and negative complementation controls, plasmids pUJ142+CtrA (pLS2890) and pUJ142 were electroporated into electrocompetent LS1094 C. crescentus cells and plated on PYE antibiotic selection plates. All three electroporated plasmid strains (GM2785, GM2786, GM2787) were grown in M2G (0.2% glucose) medium to saturation and subcultured into M2G and M2GX (0.3% xylose) media. Every 2 h for 10 h, OD600 were determined for each strain in M2G and M2GX media at an OD660 of
0.1. Comparison of the growth curves established by using time course OD660 values of each of the three strains grown in M2G or M2GX medium did not reveal any significant differences in the growth rates (data not shown). However, light microscopic observation at 6 h revealed morphological differences between cells grown in M2G and M2GX media (Fig. 4). For electron microscopy, samples were centrifuged at low speed and resuspended to an OD660 of
1.00, and then a drop of each sample was placed on a formvar-carbon-coated copper 300 grid and left undisturbed for 2 min. The excess liquid was wicked off, and the grid was stained by floating it in unbuffered saturated ammonium molybdate for 10 s; the excess liquid was wicked off, and the grid was air dried. The grids were viewed with a Phillips EM300 microscope with an accelerating voltage of 60 kV.
|
The partial restoration of the wild-type phenotype by CzcR further supports the hypothesis that there is functional similarity between CtrA and CzcR, as initially suggested by protein homology and in vitro CzcR binding to CtrA binding motifs in Cori. Xylose induction of CzcR had an in vivo effect similar to that of wild-type CtrA on C. crescentus ctrA401 cells, resulting in an almost normal progression of the cell cycle. However, it should be noted that complete reversion to the wild-type phenotype by expression of CzcR was not achieved, and this may have been due to poor expression of CzcR in C. crescentus LS1094 cells. Like E. coli, C. crescentus has significantly different tRNA codon usage for isoleucine and leucine than R. prowazekii has (www.kazusa.or.jp/codon). It is quite possible that not all expressed CzcR proteins are full length; thus, the compensatory effect is intermediate.
IHF binding site overlaps a CtrA binding site in oriRp.
IHF is a small heterodimeric histone-like protein that is composed of
and ß subunits and is found in many gram-negative eubacteria (14), including C. crescentus. R. prowazekii presumably has an IHF protein since its genome contains genes for both
and ß subunits and the protein is identified as DNA binding protein HU in The Institute for Genome Research database (2). The E. coli IHF
subunit exhibits 29% identity and 52% homology with the R. prowazekii homolog, and the E. coli IHF ß subunit exhibits 32% identity and 53% homology with the R. prowazekii homolog. The carboxy-terminal DNA binding domains of the E. coli
and ß subunits exhibit significant homology with the R. prowazekii homologs (data not shown). The E. coli IHF protein binds in the center of the chromosomal replication origin (oriC) and bends DNA more than 180° (32). This IHF binding assists DnaA in unwinding the AT-rich region of E. coli oriC during the initiation of replication (4, 5). Until recently, IHF binding to other chromosomal replication origins has not been reported.
Interestingly, C. cresentus Cori has one IHF binding site that overlaps CtrA binding site c and matches the consensus sequence proposed by Goodman and colleagues (14), and this site was implicated in the control of chromosomal replication (14; Siam and Marczynski, Abstr. 100th Gen. Meet. Am. Soc. Microbiol.). CtrA
P binding in Cori at site c is altered in the presence of the histone-like protein IHF as IHF binding to its site overlapping site c inhibits binding of CtrA
P, thereby possibly altering the state of replication repression (Siam and Marczynski, Abstr. 100th Gen. Meet. Am. Soc. Microbiol.). In fact, mutations at the IHF binding site resulted in elimination of autonomous plasmid replication (Siam and Marczynski, Abstr. 100th Gen. Meet. Am. Soc. Microbiol.). Thus, since IHF is more abundant in the stalked cells (13), it is hypothesized that in the absence of CtrA prior to the onset of the S phase, IHF binds to Cori and bends the DNA, allowing the DnaA-bound boxes in close proximity to the AT-rich region to set the scene for replication initiation (Siam and Marczynski, Abstr. 100th Gen. Meet. Am. Soc. Microbiol.). Thus, analogous to the E. coli oriC replication initiation mechanism, it is suggested that the IHF protein plays an important role in priming Cori for replication initiation in C. crescentus (Siam and Marczynski, Abstr. 100th Gen. Meet. Am. Soc. Microbiol.). It is also hypothesized that as chromosomal replication is completed and the stalk cell moves into the predivisional cell stage, the level of CtrA protein increases and CtrA may displace IHF (Siam and Marczynski, Abstr. 100th Gen. Meet. Am. Soc. Microbiol.). Thus, the roles of IHF and CtrA at Cori provide a model for replication control.
Accordingly, we tested for an IHF binding site in oriRp. E. coli IHF was overexpressed and purified as described previously (25). DNase I footprinting assays were performed with E. coli IHF by using pMW1070 32P end labeled at HincII and BamHI sites (Fig. 5A and B). Only one IHF binding site was detected. The footprint contains a sequence that is similar to the proposed consensus sequence in which the 5' region is AT rich, and the 3' region matches the consensus sequence (WATCAANNNNTTR) (14) (Fig. 5C). The sequence of the Cori IHF binding site, which overlaps CtrA binding site c, also matches the proposed consensus sequence (Fig. 5C) (Siam and Marczynski, Abstr. 100th Gen. Meet. Am. Soc. Microbiol.). As observed inside Cori, the IHF binding site in oriRp also overlaps a central CtrA binding site (site III) (Fig. 5A and B).
|
-proteobacteria, it has not been determined whether IHF binding sites are present within the corresponding chromosomal replication origins. Nevertheless, based upon the molecular data pertaining to the replication origins in C. crescentus and R. prowazekii, it is hypothesized that the role of IHF is conserved in chromosomal replication initiation in
-proteobacteria.
Homologs of the C. crescentus CtrA protein have been identified in the
-proteobacteria S. meliloti, R. capsulatus, A. tumefaciens, B. abortus, and R. prowazekii (3); however, relatively little is known about the biological functions of these proteins. Their N-terminal receiver domains (including the position 51 aspartate residue), as well as their C-terminal DNA binding domains, are highly conserved. The S. meliloti CtrA, like the C. crescentus CtrA, is essential, and transcription of S. meliloti ctrA may also be autoregulated (3). The R. capsulatus CtrA homolog, on the other hand, is not essential for viability, and its cellular functions are different from those of C. crescentus CtrA (21). R. capsulatus CtrA regulates the synthesis of a phage-like agent that transfers genes between R. capsulatus cells. CtrA homologs in A. tumefaciens and B. abortus have not been subjected to similar analyses, and it is not known if they are essential for viability. However, potential CtrA binding sites have been found in the transcription promoter of the methyltransferase gene, ccrM, in A. tumefaciens (20). The C. crescentus ccrM gene is essential and is regulated by CtrA (30).
In this study, the R. prowazekii CtrA homolog, CzcR, was purified and analyzed. DNase I footprinting with R. prowazekii CzcR detected five distinct binding sites in Cori (Fig. 2A) that exactly matched the sites (sites a to e) bound by C. crescentus CtrA in Cori (Fig. 2B). Thus, recognition of the consensus binding sequence TTAA-N7-TTAA is conserved in CzcR. The actual binding specificities of other CtrA homologs have not been investigated. However, since CzcR is less homologous to C. crescentus CtrA than the other homologs are, it is very likely that the S. meliloti, R. capsulatus, A. tumefaciens, and B. abortus CtrA proteins also recognize the TTAA-N7-TTAA sequence.
Based upon our results, a schematic diagram of the placement of the hemE and RP001 genes, the AT-rich region, potential DnaA boxes, the CtrA binding sites, and the IHF binding site in oriRp is shown in Fig. 1A. A similar schematic diagram of Cori is shown for comparison in Fig. 1B. The intergenic regions of oriRp and Cori are different sizes (393 and 708 bp, respectively) (Fig.1). Both origins have five CtrA/CzcR binding sites with comparable spacing patterns. The only exception is CtrA binding site I, which overlaps the coding region of hemE. The similarities in the genetic organizations of Cori and oriRp strongly support the previous proposal that essential replication origin elements are retained during genome reduction in R. prowazekii and the proposal that the flanking hemE and RP001 genes serve as proximal markers for the chromosomal replication origin in
-proteobacteria (7). Very recently, it has been determined that the chromosomal replication origins in S. meliloti (9) and A. tumefaciens (15) also possess flanking hemE and RP001 genes.
Putative DnaA boxes were identified in Cori and oriRp on the basis of comparison to the E. coli consensus sequence. There are identical numbers of DnaA boxes in both origins, although the positions and the DnaA box sequences differ slightly for the two origins. In Cori, a DnaA box overlaps the right half of the CtrA binding site (site e), whereas in oriRp, a DnaA box overlaps both halves of CtrA binding site IV. In oriRp, an IHF binding site overlaps the central response regulator binding site, suggesting that the mechanism of replication initiation is similar to that proposed for E. coli (4, 5) and C. crescentus (Siam and Marczynski, Abstr. 100th Gen. Meet. Am. Soc. Microbiol.), bending the DNA to bring the DnaA boxes in close proximity to the AT-rich region. The locations of the hemE and RP001 promoters and potential strong promoters in oriRp are not known at this time.
| ACKNOWLEDGMENTS |
|---|
This work was supported by a Fonds pour la Formation de Chercheurs et l'Aide á la Recherche (FCAR) Ph.D. fellowship and a Department of Microbiology & Immunology F.C. Harrison Fellowship to A.K.C.B. and R.S. and by Medical Research Council of Canada (MRC) grant MT-13453 and MRC Scholarship Award 273-46 to G.T.M.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
-proteobacteria Caulobacter crescentus and Rickettsia prowazekii. J. Bacteriol. 183:1824-1829.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |