Previous Article | Next Article 
Journal of Bacteriology, November 2002, p. 5966-5970, Vol. 184, No. 21
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.21.5966-5970.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Evidence for a Type III Secretion System in Aeromonas salmonicida subsp. salmonicida
Sarah E. Burr,1 Katja Stuber,1,
Thomas Wahli,2 and Joachim Frey1*
Institute of Veterinary Bacteriology,1
Centre for Fish and Wildlife Health, Institute of Animal Pathology, University of Berne, CH-3012 Berne, Switzerland2
Received 2 May 2002/
Accepted 5 August 2002

ABSTRACT
Aeromonas salmonicida subsp.
salmonicida, the etiological agent
of furunculosis, is an important fish pathogen. We have screened
this bacterium with a broad-host-range probe directed against
yscV, the gene that encodes the archetype of a highly conserved
family of inner membrane proteins found in every known type
III secretion system. This has led to the identification of
seven open reading frames that encode homologues to proteins
functioning within the type III secretion systems of
Yersinia species. Six of these proteins are encoded by genes comprising
a
virA operon. The
A. salmonicida subsp.
salmonicida yscV homologue,
ascV, was inactivated by marker replacement mutagenesis and
used to generate an isogenic
ascV mutant. Comparison of the
extracellular protein profiles from the
ascV mutant and the
wild-type strain indicates that
A. salmonicida subsp.
salmonicida secretes proteins via a type III secretion system. The recently
identified ADP-ribosylating toxin AexT was identified as one
such protein. Finally, we have compared the toxicities of the
wild-type
A. salmonicida subsp.
salmonicida strain and the
ascV mutant against RTG-2 rainbow trout gonad cells. While infection
with the wild-type strain results in significant morphological
changes, including cell rounding, infection with the
ascV mutant
has no toxic effect, indicating that the type III secretion
system we have identified plays an important role in the virulence
of this pathogen.

INTRODUCTION
Aeromonas salmonicida subsp.
salmonicida, the causal agent of
furunculosis in salmonids, causes large economic losses in the
aquaculture of trout and salmon. The disease is characterized
by the presence of hemorrhagic and necrotic lesions in the gills,
gut, and muscle. Due to the high mortality and contagious nature
of the disease, large amounts of antibiotics are often used
in closed and open waters for therapy of furunculosis (
19).
Vaccination has become an important strategy in the control
of furunculosis among farmed fish (
10); however, current vaccines
display considerable variability in efficacy, and epizootics
commonly occur in fish farms. In order to develop more effective
control measures, a better understanding of the virulence attributes
of
A. salmonicida is needed. To date, several potential virulence
factors of
A. salmonicida have been reported. These include
the surface layer protein (
9), salmolysin (
25), the serine protease
AspA (
29), and the glycerolipid-cholesterol acyltransferase
complexed with lipopolysaccharide (
18). However, the roles these
factors play in pathogenesis in vivo remain unclear. We have
recently reported the identification of an ADP-ribosyltransferase
toxin (AexT) in
A. salmonicida subsp.
salmonicida that was shown
to play a direct role in virulence (
6). This toxin has been
shown to possess high sequence similarity to
Pseudomonas aeruginosa exoenzyme S (ExoS), a protein that is secreted by a type III
secretion system (TTSS) (
31). This information, coupled with
observations that secretion of AexT occurs only in contact with
fish cells or, alternately, in low-calcium medium, prompted
us to speculate that a TTSS is present in
A. salmonicida subsp.
salmonicida. To this end, we have screened this bacterium with
a broad-host-range probe against
yscV (formerly designated
lcrD)
of
Yersinia entercolitica, a gene that encodes an inner membrane
component of the type III secretion apparatus (
21). The results
of this study have led to the identification of several TTSS
genes that together comprise an analogue of the
virA locus,
which is central to the TTSS of many gram-negative pathogens.
In this communication, we present the findings of these studies
and demonstrate that knockout mutagenesis of the
ycsV homologue
in
A. salmonicida subsp.
salmonicida prevents secretion of the
AexT toxin. Furthermore, we utilize a fish cell infection model
to show that inactivation of the
yscV homologue significantly
reduces the bacterium's pathogenicity.

MATERIALS AND METHODS
Bacterial strains, growth conditions, and cloning vectors.
A summary of the bacterial strains and plasmids used in this
study is provided in Table
1.
A. salmonicida strains were cultured
on Luria-Bertani (LB) agar plates at 18°C unless otherwise
indicated.
Escherichia coli strains were routinely grown in
LB agar or broth at 37°C. Liquid cultures of
A. salmonicida were grown in Trypticase soy broth (TSB; Becton Dickinson).
The media used for selection included sucrose (15% [wt/vol])
in Trypticase soy agar (TSA; Becton Dickinson) and sucrose (15%
[wt/vol]) in TSB. When indicated, antibiotics were added to
the culture media at the following final concentrations: for
Escherichia coli, ampicillin, 100 µg/ml; tetracycline,
20 µg/ml; and kanamycin, 50 µg/ml; for
A. salmonicida,
rifampin, 20 µg/ml; and kanamycin, 40 µg/ml.
Screening for the presence of TTSS genes in A. salmonicida.
A. salmonicida subsp.
salmonicida strain JF2267 was screened
for the presence of a TTSS with a probe directed against
yscV.
The
yscV gene was first amplified from
Y. enterocolitica strain
NZ63-91 with the primers LCRD-L (CCG
GAATTCATCCCCATGATCTTGAGT)
and LCRD-R (CCG
GAATTCTATCGCTACCCAAGTCTG). The presence of
EcoRI
restriction sites in the two primers (underlined) allowed for
the subsequent cloning of the PCR product into pBSK. In order
to generate a digoxigenin (DIG)-labeled probe, the
EcoRI fragment
was excised from purified plasmid and used as a template for
PCR (with primers LCRD-L and LCRD-R) carried out in the presence
of 40 µM DIG-11-dUTP (Roche Diagnostics, Rotkreuz, Switzerland).
Total DNA extracted from
A. salmonicida subsp
salmonicida strain
JF2267 by the guanidium hydrochloride method (
20) was screened
by the dot blot technique. The DNA was denatured in a mixture
containing 0.4 M NaOH and 10 mM EDTA and applied directly to
positively charged nylon membranes. Processing of the membranes
and subsequent hybridization with the
yscV DIG-labeled probe
were performed as described previously (
17). Southern blot analysis
was performed with the
yscV DIG-labeled probe under low-stringency
conditions (
2), with total DNA isolated from strain JF2267 and
digested with restriction endonucleases
SacI and
SalI (Roche
Diagnostics).
DNA manipulation, cloning, and sequencing.
All cloning procedures and genetic methods were carried out according to standard protocols (2). A partial gene library of A. salmonicida subsp. salmonicida strain JF2267 was constructed from agarose gel-purified SacI-SalI-digested fragments 4 to 6 kb in size cloned into vector pBSK. Recombinant plasmids were transformed into E. coli XL1-Blue, and positive clones were screened by colony blotting. Plasmids were prepared from positive clones with the QIA Prep Spin Mini Prep kit (Qiagen) according to the instructions supplied.
For complete sequencing of positive clones, nested deletions were generated from the initial cloned DNA fragment with a double-stranded nested deletion kit (Pharmacia LKB). Primer walking was carried out on total DNA isolated from A. salmonicida subsp. salmonicida strain JF2267 by using the Vectorette system (Genosys) according to the manufacturer's instructions.
DNA sequencing was performed with the dRhodamine Terminator Cycle Sequencing kit (Applied Biosystems) according to the manufacturer's protocol with either the T3 and T7 primers or custom-synthesized internal primers (Microsynth). The details of all oligonucleotide sequences used are available upon request. All sequences were determined on both strands. Reaction products were analyzed on an ABI Prism 310 genetic analyzer (Applied Biosystems).
Sequence alignment and editing were performed with the software Sequencher (Gene Codes Corporation). Comparisons of DNA sequences and their corresponding amino acid sequences with sequences in the EMBL/GenBank and NBRF databases were performed with BLAST (1). The molecular mass and theoretical isoelectric pH (pI) of the TTSS proteins were calculated with ProtParam (13).
Marker replacment mutagenesis.
The A. salmonicida subsp. salmonicida gene ascV was inactivated by marker replacement mutagenesis. A 1,061-bp fragment from ascV was excised by using the restriction enzymes KpnI and SpeI (Roche Diagnostics) and replaced with the kanamycin (Km) cassette from pSSVI186 (28) that had been previously excised on a 1.3-kb KpnI-SpeI fragment. The inactivated ascV and flanking genes were then cloned into the mobilizable suicide vector pSUP202sac (27). The resulting plasmid was transformed into E. coli S17-1 (23) for subsequent conjugation into A. salmonicida subsp. salmonicida. In order to provide a means for selection against E. coli, spontaneous rifampin-resistant (Rifr) clones of A. salmonicida subsp. salmonicida strain JF2267 were isolated following growth of the organism on rifampin agar plates (40 µg/ml) for two passages. A single Rifr clone was selected (strain JF2646) and filter mated (23) with E. coli S17-1 carrying the pSUP202sac-
ascV plasmid for 3 days at 15°C. Double-crossover mutants were selected directly by growth on TSA containing 15% sucrose (wt/vol), 40 µg of kanamycin per ml, and 20 µg of rifampin per ml at 15°C for 7 days. The absence of the wild-type ascV gene and insertion of the kanamycin cassette were verified by PCR with the primer pairs AcrD-fwd (GGGAATTCGATGAAGCCCGTTTTGCC) and AcrD-rev (GTGCGGCCGCACAGGCAGACCCTCCCGAG) and KMTN903-R (CCAATTCTGATTAGAAAAACTC) and KMTN903-L (AAGGGGTGTTATGAGCCATATT).
SDS-PAGE and immunoblot analyzes.
Proteins were separated on 12% acrylamide slabs by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) according to the method of Laemmli (26). Once separated, proteins were either stained with Coomassie brilliant blue or electroblotted onto nitrocellulose membranes (Bio-Rad Laboratories). Membranes were blocked for at least 1 h in 1% milk buffer. In order to detect AexT, the membranes were incubated with rabbit polyclonal anti-AexT immunoglobulin G (IgG) (6) diluted 1:1,000 in milk buffer, followed by incubation with a phosphate-labeled conjugate (goat anti-rabbit IgG heavy and light chains; Kirkegaard & Perry) diluted 1:2,000 in milk buffer. The proteins were then visualized with 5-bromo-4-chloro-3-indolylphosphate-nitroblue tetrazolium (Sigma).
In vitro cell assay.
Rainbow trout (Oncorhynchus mykiss) gonad cells (RTG-2, ATCC CCL-55) were grown as described previously (6). RTG-2 cells grown in a monolayer (6 x 105 cells per 2-cm2 well in 1 ml of medium) were infected with A. salmonicida cells suspended in phosphate-buffered saline (PBS) (pH 7.4) at a multiplicity of infection of 20:1 (bacterium/fish cell ratio). The addition of PBS (pH 7.4) to fish cells was used as a negative control. After 6 h of infection at 18°C, the fish cells were photographed under a green-filtered phase-contrast microscope (Zeiss Aixovert 100).
Nucleotide sequence accession number.
The nucleotide sequences reported in this communication have been submitted to the EMBL Nucleotide Sequence Database under accession no. AJ458292.

RESULTS AND DISCUSSION
Cloning and sequence analysis of the virA locus.
YscV (formerly called LcrD) is the archetype for a family of
inner membrane proteins found in every known TTSS. These proteins
are highly conserved, and all members can be aligned over the
entire length of their amino acid sequence (
12,
21). We therefore
chose to utilize the gene encoding this protein for screening
a virulent isolate of
A. salmonicida subsp.
salmonicida. We
utilized a probe directed against the
yscV gene of
Y. enterocolitica and screened total DNA from
A. salmonicida subsp.
salmonicida strain JF2267, a strain previously isolated from an arctic char
(
Savelinus alpinus) displaying typical furunculosis symptoms
(
6). The results of dot blot analysis revealed a strong signal
with the
yscV probe, suggesting the gene was present in strain
JF2267. Subsequent Southern blot analysis of total DNA isolated
from strain JF2267 and digested with restriction endonucleases
SacI and
SalI revealed a 4.8-kb fragment that hybridized with
the
yscV probe. This fragment was cloned on pBSK, and the nucleotide
sequence was determined.
DNA sequence analysis revealed the presence of seven open reading frames (ORFs) encoding homologues to Yersinia proteins. In Yersinia species, six of these proteins are encoded by genes found within the virA locus, specifically tyeA, sycN, yscX, yscY, yscV, and lcrR (3, 15, 16, 21, 22, 26) (Fig. 1). The gene encoding the seventh protein, lcrG is found on a separate locus downstream of lcrR (5). Because the ORF of the tyeA homologue appeared to be incomplete on the initial cloned fragment, we utilized the primer-walking technique to obtain the complete sequence of this gene. In doing this, we also obtained the sequence of an ORF encoding a YopN homologue (11) and a partial ORF that appears to encode a YscN homologue (4, 30) (Fig. 1).
In keeping with the nomenclature currently used for the designation
of TTSS genes in
Yersinia species, the archetype for these systems,
we have given the
yscN,
yscX,
yscY, and
yscV homologues the
designations
ascN,
ascX,
ascY, and
ascV, respectively, with
asc representing
Aeromonas secretion). By the same token, the
lcrR and
lcrG homologues have been designated
acrR and
acrG;
the
yopN homologue has been designated
aopN. For simplicity's
sake, the
tyeA homologue (for translocation of Yops into eukaryote
cells) and the
sycN homologue (for specific Yop chaperone) have
been termed "
acr1" and "
acr2" in analogy to their
P. aeruginosa counterparts (Fig.
1). All genes have been designated based
solely on their sequence similarity to
Yersinia and
Pseudomonas TTSS genes. Relevant characteristics of the proteins encoded
by these ORFs are summarized in Tables
2 and
3.
Further analysis of the nucleotide sequence of the TTSS genes
identified in
A. salmonicida subsp.
salmonicida has revealed
a potential promoter region upstream of
aopN (Fig.
1). In addition
to -10 (TATAATG) and -35 (TTGGCA) consensus sequences, the promoter
also possesses an ExsA consensus element (TAAAAATA) (
14), which
in
P. aeruginosa is bound by the transcriptional activator ExsA
(
14). While we were unable to identify any potential transcription
termination sites in the DNA fragment that we have cloned, we
did identify another potential promoter region preceding the
acrG gene (Fig.
1). This promoter also contains -10 (TAGAATA)
and -35 (GTGACA) consensus sequences as well as a potential
ExsA consensus element (ACAAAAGC). These data suggest that in
A. salmonicida subsp.
salmonicida, the genes comprising the
virA locus may be transcribed by a single operon that in turn
may be regulated by an ExsA homologue. We speculate that regulation
of the
virA operon occurs in a manner similar to that seen in
P. aeruginosa and
Yersinia species (
5,
32).
Secretion of AexT.
To determine whether the TTSS genes we have identified in A. salmonicida subsp. salmonicida are part of a functional secretion system, the ascV gene was inactivated by marker replacement mutagenesis with a Kmr cassette. We then examined the extracellular protein profiles of A. salmonicida subsp. salmonicida strain JF2646 (a rifampin-resistant derivative of strain JF2267 used in the construction of the
ascV mutant [see Materials and Methods]) and the
ascV mutant strain JF2678, under low-calcium conditions. The bacteria were grown overnight in TSB, and the culture supernatant was analyzed by SDS-PAGE. The results revealed a number of protein bands present in the culture supernatant of strain JF2646 that were not seen in that of strain JF2678 (results not shown), indicating that the type III secretion genes we have identified are part of a functional system. Because A. salmonicida subsp. salmonicida has previously been shown to secrete the ADP-ribosylating toxin AexT, when grown under low-calcium conditions, we speculated that AexT is secreted in a type III-dependent manner. If this were true, then AexT should be detected in the culture supernatant of strain JF2646, but not that of strain JF2678 (
ascV). To confirm this hypothesis, we performed an immunoblot on culture supernatants from both strains by using anti-aexT antibodies. The results can be seen in Fig. 2. AexT is found in the culture supernatant of JF2646 (ascV+) cells, but not in the supernatant from JF2678 (
ascV) cultures, indicating this toxin is secreted into the external environment via the TTSS we have identified.
Toxicity of the ascV mutant.
Finally, we were interested to determine whether the TTSS in
A. salmonicida subsp.
salmonicida plays a role in the virulence
of this organism. We assayed the toxicity of
A. salmonicida subsp.
salmonicida strain JF2646 and that of its
ascV mutant
derivative, strain JF2678, by infection of cultured rainbow
trout (
Oncorhynchus mykiss) gonad cells (RTG-2 cells). Six hours
following inoculation of RTG-2 cells with the bacteria, the
cells that had been infected with the
ascV+ cells (JF2646) displayed
characteristic cell rounding and had become detached from the
plastic support (Fig.
3A). In contrast, RTG-2 cells infected
with the isogenic
ascV deletion mutant displayed no marked morphological
changes in spite of the high numbers of bacterial cells in the
cultures (Fig.
3B). RTG-2 fish cells that were inoculated with
PBS were used as a negative control (Fig.
3C), and as expected,
they displayed no morphological changes.
The inability of the
ascV mutant to cause damage to the RTG-2
cells indicates that this gene is required for the toxicity
of
A. salmonicida subsp.
salmonicida against fish cells in vitro.
Because AscV displays such high sequence homology to corresponding
genes in other TTSSs (e.g., 73% identity and 80% similarity
to YscV from
Yersinia species and 72% identity and 78% similarity
to PcrD from
P. aeruginosa), we can expect it is an integral
component of the TTSS apparatus. Therefore, AscV in itself is
not likely to be directly responsible for the toxic effect of
strain JF2646 toward RTG-2 cells. Rather, it can be expected
to play a role in the secretion or translocation of toxins,
including AexT, or other virulence factors into the external
environment or into the cytosol of target cells.
While the TTSS of A. salmonicida subsp. salmonicida certainly appears to play a role in the pathogenesis of this organism in vitro, its role in the disease process in vivo has yet to be established. However, the identification of a TTSS in A. salmonicida subsp. salmonicida is clearly an important step toward a better understanding of the virulence mechanisms of this pathogen.

ACKNOWLEDGMENTS
We are grateful to Shelia MacIntyre, University of Reading,
for providing us with plasmid pSUP202sac and Lea Lagcher, University
of Berne, for cultivation of the RTG-2 cells. We are also grateful
to Guy Cornelis, University of Basel, for stimulating discussions
and help with nomenclature.
This work was supported by the research fund of the Institute for Veterinary Bacteriology, University of Berne.

FOOTNOTES
* Corresponding author. Mailing address: Institute of Veterinary Bacteriology, University of Berne, Laenggassstrasse 122 CH-3012, Berne, Switzerland. Phone: 41 31 6312 414. Fax: 41 31 6312 634. E-mail:
joachim.frey{at}vbi.unibe.ch.

Present address: Microbiological Laboratory, Swiss Federal Veterinary Office, Bern-Liebfeld, Switzerland. 

REFERENCES
1 - Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
2 - Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1999. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
3 - Barve, S. S., and S. C. Straley. 1990. lcrR, a low-Ca2+-response locus with dual Ca2+-dependent functions in Yersinia pestis. J. Bacteriol. 172:4661-4671.[Abstract/Free Full Text]
4 - Bergman, T., K. Erickson, E. Galyov, C. Persson, and H. Wolf-Watz. 1994. The lcrB (yscN/U) gene cluster of Yersinia pseudotuberculosis is involved in Yop secretion and shows high homology to the spa gene clusters of Shigella flexneri and Salmonella typhimurium. J. Bacteriol. 176:2619-2626.[Abstract/Free Full Text]
5 - Bergman, T., S. Hakansson, Å. Forsberg, L. Norlander, A. Macellaro, A. Bäckman, I. Bölin, and H. Wolf-Watz. 1991. Analysis of the V antigen lcrGVH-yopBD operon of Yersinia pseudotuberculosis: evidence for a regulatory role of LcrH and LcrV. J. Bacteriol. 173:1607-1616.[Abstract/Free Full Text]
6 - Braun, M., K. Stuber, Y. Schlatter, T. Wahli, P. Kuhnert, and J. Frey. 2002. Characterization of an ADP-ribosyltransferase toxin (AexT) from Aeromonas salmonicida subsp. salmonicida. J. Bacteriol. 184:1851-1858.[Abstract/Free Full Text]
7 - Bullock, W. O., J. M. Fernandez, and J. M. Short. 1987. XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with beta-galactosidase selection. BioTechniques 5:376-378.
8 - Cheng, L. W., O. Kay, and O. Schneewind. 2001. Regulated secretion of YopN by the type III machinery of Yersinia enterocolitica. J. Bacteriol. 183:5293-5301.[Abstract/Free Full Text]
9 - Chu, S., S. Cavaignac, J. Feutrier, B. M. Phipps, M. Kostrzynska, W. W. Kay, and T. J. Trust. 1991. Structure of the tetragonal surface virulence array protein and gene of Aeromonas salmonicida. J. Biol. Chem. 266:15258-15265.[Abstract/Free Full Text]
10 - Ellis, A. E. 1997. Immunization with bacterial antigens: furunculosis. Dev. Biol. Stand. 90:107-116.[Medline]
11 - Forsberg, A., A. M. Viitanen, M. Skurnik, and H. Wolf-Watz. 1991. The surface-located YopN protein is involved in calcium signal transduction in Yersinia pseudotuberculosis. Mol. Microbiol. 5:977-986.[Medline]
12 - Galán, J. E., C. Ginocchio, and P. Costeas. 1992. Molecular and functional characterization of the Salmonella invasion gene invA: homology of InvA to members of a new protein family. J. Bacteriol. 174:4338-4349.[Abstract/Free Full Text]
13 - Gill, S. C., and P. H. von Hippel. 1989. Calculation of protein extinction coefficients from amino acid sequence data. Anal. Biochem. 182:319-326. (Erratum, 189:283, 1990.)
14 - Hovey, A. K., and D. W. Frank. 1995. Analyses of the DNA-binding and transcriptional activation properties of ExsA, the transcriptional activator of the Pseudomonas aeruginosa exoenzyme S regulon. J. Bacteriol. 177:4427-4436.[Abstract/Free Full Text]
15 - Iriarte, M., and G. R. Cornelis. 1999. Identification of SycN, YscX, and YscY, three new elements of the Yersinia Yop virulon. J. Bacteriol. 181:675-680.[Abstract/Free Full Text]
16 - Iriarte, M., M. P. Sory, A. Boland, A. P. Boyd, S. D. Mills, I. Lambermont, and G. R. Cornelis. 1998. TyeA, a protein involved in control of Yop release and in translocation of Yersinia Yop effectors. EMBO J. 17:1907-1918.[CrossRef][Medline]
17 - Kuhnert, P., J. Hacker, I. Muhldorfer, A. P. Burnens, J. Nicolet, and J. Frey. 1997. Detection system for Escherichia coli-specific virulence genes: absence of virulence determinants in B and C strains. Appl. Environ. Microbiol. 63:703-709.[Abstract]
18 - Lee, K. K., and A. E. Ellis. 1990. Glycerophospholipid:cholesterol acyltransferase complexed with lipopolysaccharide (LPS) is a major lethal exotoxin and cytolysin of Aeromonas salmonicida: LPS stabilizes and enhances toxicity of the enzyme. J. Bacteriol. 172:5382-5393.[Abstract/Free Full Text]
19 - Munro, A. L., and T. S. Hastings. 1993. Furunculosis, p. 122-142. In V. Inglis, R. J. Roberts, and N. R. Bromage (ed.), Bacterial diseases of fish. Blackwell Scientific, Oxford, United Kingdom.
20 - Pitcher, D. G., N. A. Saunders, and R. J. Owen. 1989. Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett. Appl. Microbiol. 8:151-156.
21 - Plano, G. V., S. S. Barve, and S. C. Straley. 1991. LcrD, a membrane-bound regulator of the Yersinia pestis low-calcium response. J. Bacteriol. 173:7293-7303.[Abstract/Free Full Text]
22 - Plano, G. V., and S. C. Straley. 1993. Multiple effects of lcrD mutations in Yersinia pestis. J. Bacteriol. 175:3536-3545.[Abstract/Free Full Text]
23 - Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1:784-791.[CrossRef]
24 - Skrzypek, E., and S. C. Straley. 1993. LcrG, a secreted protein involved in negative regulation of the low-calcium response in Yersinia pestis. J. Bacteriol. 175:3520-3528.[Abstract/Free Full Text]
25 - Titball, R. W., and C. B. Munn. 1985. The purification and some properties of H-lysin from Aeromonas salmonicida. J. Gen. Microbiol. 131:1603-1609.[Abstract/Free Full Text]
26 - Viitanen, A.-M., P. Toivanen, and M. Skurnik. 1990. The lcrE gene is part of an operon in the lcr region of Yersinia enterocolitica O:3. J. Bacteriol. 172:3152-3162.[Abstract/Free Full Text]
27 - Vipond, R., I. R. Bricknell, E. Durant, T. J. Bowden, A. E. Ellis, M. Smith, and S. MacIntyre. 1998. Defined deletion mutants demonstrate that the major secreted toxins are not essential for the virulence of Aeromonas salmonicida. Infect. Immun. 66:1990-1998.[Abstract/Free Full Text]
28 - Viret, J. F. 1993. Meganuclease I-SceI as a tool for the easy subcloning of large DNA fragments devoid of selection marker. BioTechniques 14:325-326.[Medline]
29 - Whitby, P. W., M. Landon, and G. Coleman. 1992. The cloning and nucleotide sequence of the serine protease gene (aspA) of Aeromonas salmonicida ssp. salmonicida. FEMS Microbiol. Lett. 78:65-71.[Medline]
30 - Woestyn, S., A. Allaoui, P. Wattiau, and G. R. Cornelis. 1994. YscN, the putative energizer of the Yersinia Yop secretion machinery. J. Bacteriol. 176:1561-1569.[Abstract/Free Full Text]
31 - Yahr, T. L., J. Goranson, and D. W. Frank. 1996. Exoenzyme S of Pseudomonas aeruginosa is secreted by a type III pathway. Mol. Microbiol. 22:991-1003.[CrossRef][Medline]
32 - Yahr, T. L., L. M. Mende-Mueller, M. B. Friese, and D. W. Frank. 1997. Identification of type III secreted products of the Pseudomonas aeruginosa exoenzyme S regulon. J. Bacteriol. 179:7165-7168.[Abstract/Free Full Text]
Journal of Bacteriology, November 2002, p. 5966-5970, Vol. 184, No. 21
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.21.5966-5970.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Boyd, J. M., Dacanay, A., Knickle, L. C., Touhami, A., Brown, L. L., Jericho, M. H., Johnson, S. C., Reith, M.
(2008). Contribution of Type IV Pili to the Virulence of Aeromonas salmonicida subsp. salmonicida in Atlantic Salmon (Salmo salar L.). Infect. Immun.
76: 1445-1455
[Abstract]
[Full Text]
-
Bossi-Kupfer, M., Genini, A., Peduzzi, R., Demarta, A.
(2007). Tracheobronchitis caused by Aeromonas veronii biovar sobria after near-drowning. J Med Microbiol
56: 1563-1564
[Abstract]
[Full Text]
-
Fehr, D., Burr, S. E., Gibert, M., d'Alayer, J., Frey, J., Popoff, M. R.
(2007). Aeromonas Exoenzyme T of Aeromonas salmonicida Is a Bifunctional Protein That Targets the Host Cytoskeleton. J. Biol. Chem.
282: 28843-28852
[Abstract]
[Full Text]
-
Fehr, D., Casanova, C., Liverman, A., Blazkova, H., Orth, K., Dobbelaere, D., Frey, J., Burr, S. E.
(2006). AopP, a type III effector protein of Aeromonas salmonicida, inhibits the NF-{kappa}B signalling pathway.. Microbiology
152: 2809-2818
[Abstract]
[Full Text]
-
Dacanay, A., Knickle, L., Solanky, K. S., Boyd, J. M., Walter, J. A., Brown, L. L., Johnson, S. C., Reith, M.
(2006). Contribution of the type III secretion system (TTSS) to virulence of Aeromonas salmonicida subsp. salmonicida. Microbiology
152: 1847-1856
[Abstract]
[Full Text]
-
Ebanks, R. O., Knickle, L. C., Goguen, M., Boyd, J. M., Pinto, D. M., Reith, M., Ross, N. W.
(2006). Expression of and secretion through the Aeromonas salmonicida type III secretion system.. Microbiology
152: 1275-1286
[Abstract]
[Full Text]
-
Erova, T. E., Pillai, L., Fadl, A. A., Sha, J., Wang, S., Galindo, C. L., Chopra, A. K.
(2006). DNA Adenine Methyltransferase Influences the Virulence of Aeromonas hydrophila. Infect. Immun.
74: 410-424
[Abstract]
[Full Text]
-
Broms, J. E., Edqvist, P. J., Carlsson, K. E., Forsberg, A., Francis, M. S.
(2005). Mapping of a YscY Binding Domain within the LcrH Chaperone That Is Required for Regulation of Yersinia Type III Secretion. J. Bacteriol.
187: 7738-7752
[Abstract]
[Full Text]
-
Sha, J., Pillai, L., Fadl, A. A., Galindo, C. L., Erova, T. E., Chopra, A. K.
(2005). The Type III Secretion System and Cytotoxic Enterotoxin Alter the Virulence of Aeromonas hydrophila. Infect. Immun.
73: 6446-6457
[Abstract]
[Full Text]
-
Burr, S. E., Pugovkin, D., Wahli, T., Segner, H., Frey, J.
(2005). Attenuated virulence of an Aeromonas salmonicida subsp. salmonicida type III secretion mutant in a rainbow trout model. Microbiology
151: 2111-2118
[Abstract]
[Full Text]
-
Ghosh, P.
(2004). Process of Protein Transport by the Type III Secretion System. Microbiol. Mol. Biol. Rev.
68: 771-795
[Abstract]
[Full Text]
-
Vilches, S., Urgell, C., Merino, S., Chacon, M. R., Soler, L., Castro-Escarpulli, G., Figueras, M. J., Tomas, J. M.
(2004). Complete Type III Secretion System of a Mesophilic Aeromonas hydrophila Strain. Appl. Environ. Microbiol.
70: 6914-6919
[Abstract]
[Full Text]
-
Yu, H. B., Rao, P. S. S., Lee, H. C., Vilches, S., Merino, S., Tomas, J. M., Leung, K. Y.
(2004). A Type III Secretion System Is Required for Aeromonas hydrophila AH-1 Pathogenesis. Infect. Immun.
72: 1248-1256
[Abstract]
[Full Text]
-
Chacon, M. R., Soler, L., Groisman, E. A., Guarro, J., Figueras, M. J.
(2004). Type III Secretion System Genes in Clinical Aeromonas Isolates. J. Clin. Microbiol.
42: 1285-1287
[Abstract]
[Full Text]
-
Garrity-Ryan, L., Shafikhani, S., Balachandran, P., Nguyen, L., Oza, J., Jakobsen, T., Sargent, J., Fang, X., Cordwell, S., Matthay, M. A., Engel, J. N.
(2004). The ADP Ribosyltransferase Domain of Pseudomonas aeruginosa ExoT Contributes to Its Biological Activities. Infect. Immun.
72: 546-558
[Abstract]
[Full Text]
-
Burr, S. E., Stuber, K., Frey, J.
(2003). The ADP-Ribosylating Toxin, AexT, from Aeromonas salmonicida subsp. salmonicida Is Translocated via a Type III Secretion Pathway. J. Bacteriol.
185: 6583-6591
[Abstract]
[Full Text]
-
Stuber, K., Burr, S. E., Braun, M., Wahli, T., Frey, J.
(2003). Type III Secretion Genes in Aeromonas salmonicida subsp. salmonicida Are Located on a Large Thermolabile Virulence Plasmid. J. Clin. Microbiol.
41: 3854-3856
[Abstract]
[Full Text]