Journal of Bacteriology, November 2002, p. 6387-6388, Vol. 184, No. 22
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.22.6387-6388.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Protein Splicing of the Deinococcus radiodurans Strain R1 Snf2 Intein
Maurice W. Southworth and Francine B. Perler*
New England Biolabs, Beverly, Massachusetts 01915
Received 22 May 2002/
Accepted 16 August 2002
 |
ABSTRACT
|
|---|
Adjacent intein fragments fused to a Snf2/Rad54 helicase-related protein and Snf2/Rad54 helicase were reported for Deinococcus radiodurans R1, leading to the speculation that a frameshift was required for splicing or that trans splicing occurred. However, a type strain (ATCC 13939, RF18410) yielded a single protein that splices by the Ala1 protein splicing pathway, with splicing dependent on adjacent residues.
 |
TEXT
|
|---|
Over 130 inteins have been identified in archaea, eubacteria, and eukarya (see InBase [5] at http://www.neb.com/neb/inteins.html). Inteins splice as proteins to form a functional host protein (the extein) and the excised intein. The protein splicing pathway (4) is initiated by an acyl rearrangement of the intein N-terminal Cys/Ser/Thr to form a linear (thio)ester intermediate. A trans-esterification reaction shifts the N-extein onto the side chain of the Cys/Ser/Thr at the beginning of the C-extein (the +1 residue). The resultant branched (thio)ester intermediate is resolved by Asn cyclization. Another acyl shift converts the extein (thio)ester linkage to a peptide bond. Inteins without an N-terminal nucleophile use an alternate splicing pathway that differs only in the mechanism of branched intermediate formation (6). Namely, attack at the N-terminal splice junction by the amino acid at position +1 does not require prior formation of a (thio)ester. Inteins present at two conserved insertion sites splice by this Ala1 mechanism: the DnaB inteins exemplified by the Mycobacterium leprae intein and the KlbA inteins (5, 6, 8). The Deinococcus radiodurans strain R1 Snf2/Rad54 helicase-related DR1258 and DR1259 genes (GenBank accession number AE001973) contain fragments of an intein beginning with Ala (7), leading to the speculation that a splicing precursor is formed after a frameshift or that this is a second example of a naturally occurring split intein (3, 5).
Sequencing the D. radiodurans R1 Snf2 intein.
Genomic DNA prepared from the D. radiodurans R1 type strain obtained from the American Type Culture Collection (ATCC 13939, RF18410) was a gift from John Battista (Louisiana State University). The D. radiodurans strain R1 Snf2 intein and partial extein sequences were amplified by PCR with forward primer 5'AAACTCCTCGAGCTCGGCAAACGC and reverse primer 5'GGTTTGAGGAGGTGGGCGAGGGT. The PCR product was directly sequenced in both directions at the New England Biolabs core facility. The sequence is identical to the published sequence (7) with the exception that this original type strain isolate has only one cytosine after the intein codon for Gln212, while the homologous DNA sequence published under accession no. AE001973 (ATCC 13939, RF78101) contains two cytosines. In the sequence published under accession no. AE001973, these two cytosines generate a frameshift mutation within the D. radiodurans strain R1 Snf2 intein, separating the Snf2/Rad54 helicase precursor into different open reading frame (ORF) products encoded by the DR1258 and DR1259 genes (7). In the newly sequenced isolate, the Snf2/Rad54 helicase-related protein (DR1258), the intein, and the Snf2/Rad54 helicase (DR1259) form a single ORF product. This sequence difference could have arisen anytime during the 20 years separating the deposition of the two strains with the American Type Culture Collection. No experimental data are currently available that address the question of whether this Snf2 protein is essential or whether the two proteins from RF78101 are functional when expressed separately or after splicing in trans.
Cloning and splicing of the D. radiodurans R1 Snf2 intein.
The D. radiodurans strain R1 Snf2 intein (I) was cloned into a well-studied context with the Escherichia coli maltose binding protein (M) as the N-extein and part of Dirofilaria immitis paramyosin (P) as the C-extein (6). Splicing and the presence of a single ORF were confirmed by observation of the predicted products generated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting (data not shown) and by protein sequencing. A MIP precursor with a Genenase I (New England Biolabs) site preceding the intein yielded spliced MP and excised I (Fig. 1). N-terminal sequencing (6) of the 29-kDa Genenase I digestion product of MP yielded the expected sequence spanning the splice junction (VLELGK//TVQTLN).

View larger version (92K):
[in this window]
[in a new window]
|
FIG. 1. Characterization of the D. radiodurans strain R1 Snf2 intein as a MIP fusion. Expression overnight at 20°C of a MIP precursor with Leu-Gly-Lys preceding the intein and Thr-Val-Gln-Thr following the intein resulted in production of spliced exteins (MP, 72 kDa) plus free intein (I, 39 kDa) in the absence of detectable MIP precursor (111 kDa). Shown are results for the control MP protein (lane 1), soluble cell extract (lane 2), flowthrough after affinity chromatography over amylose resin (lane 3), eluate from amylose column (lane 4), Genenase I-cleaved eluate (lane 5), and a broad-range protein marker (New England Biolabs) (lane 6) on a sodium dodecyl sulfate-polyacrylamide gel stained with Coomassie blue.
|
|
Since inteins sometimes exhibit preferences for adjacent residues and/or temperature-dependent splicing in heterologous exteins, various combinations of extein sequences were tested in vivo at 37 and 20°C (Table 1). Constructs with Leu-Glu-Lys or Leu-Ala-Lys preceding the intein yielded mainly insoluble MIP precursor at 37°C. Expression of these precursors at 20°C eliminated the solubility problem and stimulated splicing when the C-extein sequence was Thr-Val-Gln-Thr. Low-temperature induction is thought to aid in folding. Changing only one amino acid to generate the native N-terminal splice junction sequence (Leu-Gly-Lys) also eliminated the solubility problem and yielded spliced product at both temperatures. Changing the C-extein residues from Thr-Gly-Leu-Asn to Thr-Val-Gln-Thr, which is more similar to the native sequence (Thr-Leu-Gln-Thr), also stimulated splicing (Table 1, compare +1 and +4 samples).
Like other inteins, the D. radiodurans strain R1 Snf2 intein splices more efficiently when native extein residues are present, supporting the hypothesis that inteins have coevolved with their exteins to achieve efficient splicing. A single change at a position two residues before the intein (Gly to Glu or Ala) drastically inhibited splicing and decreased solubility. Although Glu has a bulky, charged side chain, Ala is very similar in physical properties to Gly. It is therefore likely that the structural flexibility of Gly is important for both overall folding of the precursor and formation of the active site.
The D. radiodurans strain R1 Snf2 intein is inserted into an abridged consensus P-loop, the nucleoside triphosphate-binding motif "A" site GXGK(S/T) (1). P-loop motifs are frequent intein insertion sites (5). P-loop motifs are extremely common, with the Pyrococcus horikoshii genome having over 150 (2). Both the D. radiodurans strain R1 Snf2 intein and the M. leprae DnaB intein begin with Ala and are inserted into P-loops. However, besides the conserved motif residues, the flanking extein sequences are not similar and it is likely that the D. radiodurans strain R1 Snf2 intein represents a third insertion site for Ala1 inteins.
Nucleotide sequence accession number.
The D. radiodurans strain R1 Snf2 intein sequence has been deposited in GenBank under accession number AF512685.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: New England Biolabs, 32 Tozer Rd., Beverly, MA 01915. Phone: (978) 927-5054. Fax: (978) 921-1350. E-mail: perler{at}neb.com. 
 |
REFERENCES
|
|---|
- Gorbalenya, A. E., E. V. Koonin, A. P. Donchenko, and V. M. Blinov. 1989. Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Res. 17:4713-4730.[Abstract/Free Full Text]
- Kawarabayasi, Y., et al. 1998. Complete sequence and gene organization of the genome of a hyper-thermophilic archaebacterium, Pyrococcus horikoshii OT3 (supplement). DNA Res. 5:147-155.[CrossRef][Medline]
- Makarova, K. S., L. Aravind, Y. I. Wolf, R. L. Tatusov, K. W. Minton, E. V. Koonin, and M. J. Daly. 2001. Genome of the extremely radiation-resistant bacterium Deinococcus radiodurans viewed from the perspective of comparative genomics. Microbiol. Mol. Biol. Rev. 65:44-79.[Abstract/Free Full Text]
- Noren, C. J., J. Wang, and F. B. Perler. 2000. Dissecting the chemistry of protein splicing and its applications. Angew. Chem. Int. Ed. Engl. 39:450-466.[CrossRef][Medline]
- Perler, F. B. 2002. InBase: the intein database. Nucleic Acids Res. 30:383-384.[Abstract/Free Full Text]
- Southworth, M. W., J. Benner, and F. B. Perler. 2000. An alternative protein splicing mechanism for inteins lacking an N-terminal nucleophile. EMBO J. 19:5019-5026.[CrossRef][Medline]
- White, O., et al. 1999. Genome sequence of the radioresistant bacterium Deinococcus radiodurans R1. Science 286:1571-1577.[Abstract/Free Full Text]
- Yamamoto, K., B. Low, S. A. Rutherford, M. Rajagopalan, and M. V. Madiraju. 2001. The Mycobacterium avium-intracellulare complex dnaB locus and protein intein splicing. Biochem. Biophys. Res. Commun. 280:898-903.[CrossRef][Medline]
Journal of Bacteriology, November 2002, p. 6387-6388, Vol. 184, No. 22
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.22.6387-6388.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Johnson, M. A., Southworth, M. W., Herrmann, T., Brace, L., Perler, F. B., Wuthrich, K.
(2007). NMR structure of a KlbA intein precursor from Methanococcus jannaschii. Protein Sci.
16: 1316-1328
[Abstract]
[Full Text]
-
Paul, J. H., Williamson, S. J., Long, A., Authement, R. N., John, D., Segall, A. M., Rohwer, F. L., Androlewicz, M., Patterson, S.
(2005). Complete Genome Sequence of {phi}HSIC, a Pseudotemperate Marine Phage of Listonella pelagia. Appl. Environ. Microbiol.
71: 3311-3320
[Abstract]
[Full Text]