This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Skibinski, D. A. G.
Right arrow Articles by Andrews, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Skibinski, D. A. G.
Right arrow Articles by Andrews, S. C.

 Previous Article  |  Next Article 

Journal of Bacteriology, December 2002, p. 6642-6653, Vol. 184, No. 23
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.23.6642-6653.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Regulation of the Hydrogenase-4 Operon of Escherichia coli by the {sigma}54-Dependent Transcriptional Activators FhlA and HyfR

David A. G. Skibinski,1,2 Paul Golby,1,{dagger} Yung-Sheng Chang,1 Frank Sargent,3 Ralf Hoffman,1 R. Harper,1 John R. Guest,2 Margaret M. Attwood,2 Ben C. Berks,4 and Simon C. Andrews1*

School of Animal and Microbial Sciences, The University of Reading, Reading RG6 6AJ,1 Department of Molecular Biology & Biotechnology, University of Sheffield, Sheffield S10 2TN,2 The Centre of Metalloprotein Spectroscopy & Biology, School of Biological Sciences, University of East Anglia, Norwich NR4 7TJ,3 Department of Biochemistry, University of Oxford, Oxford, United Kingdom4

Received 6 May 2002/ Accepted 30 August 2002


arrow
ABSTRACT
 
The hyf locus (hyfABCDEFGHIJ-hyfR-focB) of Escherichia coli encodes a putative 10-subunit hydrogenase complex (hydrogenase-4 [Hyf]); a potential {sigma}54-dependent transcriptional activator, HyfR (related to FhlA); and a putative formate transporter, FocB (related to FocA). In order to gain insight into the physiological role of the Hyf system, we investigated hyf expression by using a hyfA-lacZ transcriptional fusion. This work revealed that hyf is induced under fermentative conditions by formate at a low pH and in an FhlA-dependent fashion. Expression was {sigma}54 dependent and was inhibited by HycA, the negative transcriptional regulator of the formate regulon. Thus, hyf expression resembles that of the hyc operon. Primer extension analysis identified a transcriptional start site 30 bp upstream of the hyfA structural gene, with appropriately located -24 and -12 boxes indicative of a {sigma}54-dependent promoter. No reverse transcriptase PCR product could be detected for hyfJ-hyfR, suggesting that hyfR-focB may be independently transcribed from the rest of the hyf operon. Expression of hyf was strongly induced (~1,000-fold) in the presence of a multicopy plasmid expressing hyfR from a heterologous promoter. This induction was dependent on low pH, anaerobiosis, and postexponential growth and was weakly enhanced by formate. The hyfR-expressing plasmid increased fdhF-lacZ transcription just twofold but did not influence the expression of hycB-lacZ. Interestingly, inactivation of the chromosomal hyfR gene had no effect on hyfA-lacZ expression. Purified HyfR was found to specifically interact with the hyf promoter/operator region. Inactivation of the hyf operon had no discernible effect on growth under the range of conditions tested. No Hyf-derived hydrogenase or formate dehydrogenase activity could be detected, and no Ni-containing protein corresponding to HyfG was observed.


arrow
INTRODUCTION
 
Escherichia coli is capable of three alternative modes of energy generation: aerobic respiration, anaerobic respiration and fermentation. In the absence of the appropriate electron acceptors (O2, NO3-, NO2-, sulfur or nitrogen oxides, or fumarate), E. coli resorts to mixed-acid fermentation, yielding a maximum of just 3 mol of ATP per mol of glucose consumed (12). During fermentative growth, glycolytic carbon sources are converted to pyruvate that is in turn converted to acetyl coenzyme A and formate by pyruvate formatelyase (22) The formate produced may then be either excreted or further metabolized to H2 and CO2 by a membrane-associated, non-energy-conserving formate hydrogenlyase (Fhl-1) system consisting of formate dehydrogenase H (Fdh-H) and the hydrogenase-3 complex (Hyc) (12, 17, 37).

The genes required for the synthesis of Fhl-1 form the formate regulon, which includes three transcriptional units, namely, the hyc and hyp-fhlA operons and the fdhF gene (13, 26, 28, 37, 49). The hyc operon (hycABCDEFGHI) encodes the Hyc complex of Fhl-1 (encoded by hycBCDEFGH), as well as a negative-transcriptional regulator (HycA) of the formate regulon and a protease (HycI) required for the maturation of the large subunit of hydrogenase-3 (HycE) (13, 32, 36). The remaining component of Fhl-1 is Fdh-H, encoded by fdhF (28). The hyp (hydrogenase pleiotropic) operon (hypABCDE-fhlA) is located immediately upstream of, and is divergently transcribed from, the hyc operon. The products of the hyp genes are involved in hydrogenase maturation (26, 41).

Optimal expression of the formate regulon requires anaerobiosis, the absence of nitrate (or other compounds which may act as electron acceptors for the respiratory oxidation of formate), the presence of formate, and an acidic pH (10, 29, 30, 40, 51). These environmental factors exert their effects at the transcriptional level, and it would appear that pH, anaerobiosis, and respiratory acceptors operate indirectly through their effects on intracellular formate levels (10, 25, 26, 33, 40, 41). Thus, formate is the primary environmental signal that mediates induction of the formate regulon. FhlA (encoded by fhlA) is the formate-sensing transcriptional activator that directly controls the formate regulon (27, 41). FhlA binds to an upstream activating sequence located about 100 bp upstream of cognate transcriptional start sites and, in the presence of formate, activates transcription from the {sigma}54-dependent promoters (8, 9, 11, 23, 24, 25, 41, 42). HycA negatively regulates transcription of the formate regulon (36). It is not known whether HycA acts by directly interacting with FhlA or by preventing FhlA binding to upstream activating sequence regions (36). FhlA also appears to sense molybdate, and it seems that full induction of the formate regulon requires adequate levels of this element (an essential component of the active site of the Fdh-H component of Fhl-1) (43, 44).

Sequence analysis of the 55.8' to 56.0' region of the E. coli genome has revealed a 12-gene locus, designated the hyf operon (hyfABCDEFGHI-hyfR-focB) (1). Seven genes of the hyf operon (hyfABCGHIJ) encode homologues of the seven Hyc subunits. In addition, the hyf operon contains three genes (hyfD, hyfE, and hyfF) apparently specifying intergral membrane subunits that have no direct counterparts in the Hyc complex. Two of these three subunits are related to subunits of the proton-translocating NADH:quinone oxidoreductases (complex I). It is proposed that the hyf operon encodes a novel hydrogenase complex (hydrogenase-4 [Hyf]) which, together with Fdh-H, forms a second formate hydrogenlyase pathway (Fhl-2) in E. coli that, unlike the Fhl-1 system, is an energy-conserving, proton-translocating system (1). The hyfR gene encodes an FhlA homologue that is a potential formate-sensing, {sigma}54-dependent transcriptional activator, and focB encodes a putative formate transporter homologous with FocA (1). A potential {sigma}54-dependent promoter is located upstream of the hyf operon and approximately 110 bp downstream of a putative FhlA (and/or HyfR)-binding site (1).

This paper describes the use of a hyfA-lacZ transcriptional fusion to study hyf expression under a range of growth conditions and in different mutant backgrounds. The hyf operon was found to resemble the hyc operon in being induced anaerobically by formate at a low pH in an FhlA- and {sigma}54-dependent manner. Overproduction of HyfR elicited a massive induction of the hyf operon under fermentative conditions at low pH, and this effect was {sigma}54 dependent. HyfR overproduction had no effect on hyc expression. However, the coeffector(s) used by HyfR has yet to be identified. No mutant phenotype could be assigned to the hyf lesion, no hyf operon-encoded proteins could be detected, and no Hyf-dependent H2 evolution or formate dehydrogenase activity was observed, so the physiological role of the Hyf system remains uncertain.


arrow
MATERIALS AND METHODS
 
Media, growth conditions, and strains. The strains of E. coli used in this study are listed in Table 1. The growth media are specified herein or in the appropriate figure legends. Cultures were grown at 37°C anaerobically in stationary Bijoux bottles unless stated otherwise. Standard genetic procedures were performed as described by Sambrook et al. (34).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains, plasmids, and phage used in this study

Controlled-batch and continuous-culture growths were performed in an LH Series Fermentor (500 series) containing 690 to 900 ml of standard minimal medium, which consisted of 20 mM glucose and 0.2% Vishniac's trace elements [0.2% (NH4)2SO4, 0.1% K2HPO4, 0.1% NaH2PO4, 0.02% MgSO47H2O, 5 µM nickel chloride, 1.6 µM ferric citrate, 1 µM sodium molybdate, 1 µM sodium selenite] (50), with pH controlled at 6.5 or 7.5 with 2 M KOH. The hyfA-lacZ fusion of strain DS5 was well expressed under anaerobic conditions in the medium described above. Glucose and fermentation products (ethanol, formate, acetate, succinate, and lactate) were measured as previously described (6, 7, 38) or by high-pressure liquid chromatography with a Shodex Ionopak KC-811 column and 0.1% orthophosphoric acid as the liquid phase.

To investigate the effects of the hyfR, fhlA, hycB-hycH, and ntrA ({sigma}54) mutations on expression of the hyf operon, the {Delta}hyfR::spc (construction described below), fhlA::{lambda} placMu53 kan, {Delta}hycB-hycH::cat, and {Delta}(ntrD208::Tn10) mutations of strains JRG3618, SV83, HDJ123, and BN450, respectively, were transferred by P1-mediated transduction to the corresponding lacZ fusion strain DS5, creating strains DS6, DS7, DS8, DS10, and DS11, respectively (Table 1). Strain DS9 was created by transducing the hyfA-lacZ fusion from DS5 to HD701. The entire hyf operon was cloned by coligating the 10.5-kb Eco147I-XmaIII (hyfA-hyfI') fragment of pLC25-14 with the 3.9-kb XmaIII-EcoRI ('hyfI-focB) fragment of pGS944 into the SmaI and EcoRI sites of pSU18, producing pGS1020, containing a ~15-kb EcoR1471-EcoRI (hyfA-hyfR-focB) insert.

Inactivation of the hyf operon. Three hyf mutants containing chromosomal {Delta}hyfA-hyfB::spc, {Delta}hyfR::spc, or {Delta}hyfB-R::spc mutations were generated. For the {Delta}hyfA-hyfB::spc mutation, the 3.5-kb NruI ('dapA-hyfB') fragment of pLC25-14 was cloned into the SmaI site of pSU18-{Delta}H (a derivative of pSU18 carrying a HindIII deletion generated by HindIII digestion, followed by end filling and religation), creating pPG11. This plasmid was digested with HindIII to eliminate the 0.4-kb hyfA'-hyfB' fragment, which was replaced with a 2-kb HindIII fragment containing the Spr cassette of pUX-{Omega} (Table 1), producing pPG12. The 3.2-kb EcoRI-HindIII hyfA'-spc-'hyfB'-containing fragment of pPG12 was isolated, treated with Klenow fragment to end fill the 5' overhangs, and then cloned into the HincII site of pMAK705 to generate pGS1037 (Table 1).

The {Delta}hyfR::spc mutation was created by replacing the 1.58-kb MunI fragment of the hyfR gene of pGS944 with a 2-kb HindIII fragment containing the Spr cassette from pUX-{Omega} to produce pPG13 (Table 1). The 4.3-kb SalI-EcoRI fragment ('hyfI-hyfR'-spc-'hyfR-focB) of pPG13 was isolated, end filled, and cloned into the HincII site of pMAK705 to generate pGS1038. Production of the {Delta}hyfB-hyfR::spc mutation involved replacing the 10.7-kb 'hyfB-hyfR' DraII fragment of pGS1020 with a 2-kb end-filled EcoRI Spr fragment from pUX-{Omega} to yield pPG14 (Table 1). The 4.5-kb HindIII-EcoRI hyfAB'-spc-'hyfR-focB fragment of pPG14 was isolated, end filled, and cloned into the HincII site of pMAK705 to create pGS1039. Plasmids pGS1037, pGS1038, and pGS1039 were then used to replace the wild-type hyf operon of MC4100 with the mutant versions, as described by Hamilton et al. (20), producing mutants JRG3615, JRG3618, and JRG3621, respectively (Table 1), which were confirmed by PCR amplification and Southern blotting (data not shown).

Construction of hyfA-, focB-, and hyfR-lacZ transcriptional fusions. Two hyfA-lacZ transcriptional fusions were created. One was made by cloning the Klenow end-filled 0.987-kb EcoRV-HindIII fragment of pGS213 (containing the bcp-hyfA intergenic region and part of the hyfA-coding region) into the SmaI site of pRS415 (45) to generate pGS1102. The other was produced by cloning the Klenow end-filled 1.29-kb EcoRV-BamHI fragment of pGS213 (containing the bcp-hyfA intergenic region and the hyfA-coding region) into the SmaI site of pRS415 to generate plasmid pGS1103. The hyfR-lacZ fusion was made by cloning the 609-bp SmaI-NruI, 'hyfJ-hyfR'-containing fragment of pGS944 into the SmaI site of pRS415, generating pGS1131. The focB-lacZ fusion was produced by cloning the 1.2-kb EcoRV-PvuII 'hyfR-focB' fragment of pGS944 into the SmaI site of pRS415 to generate pGS1132. Fusions were transferred to {lambda}RZ5 by in vivo recombination in corresponding MC4100 transformants, as described by Simons et al. (45). The resulting lacZ fusion phage was established as a single-copy prophage in MC4100 ({Delta}lac) as previously described (45).

Reverse transcriptase (RT)-mediated primer extension analysis and Northern blotting. Total RNA was isolated from MC4100 (pGS1020) grown under anaerobic conditions in L broth plus 50 mM formate by using the RNeasy kit (Qiagen). The transcriptional start site of the hyfA gene was determined by primer extension (18) with a primer designed to anneal to the hyfA region of the hyf transcript, hyfA-hyfF (ACAGGTATTACATCCTGTACACCACAGTGG). Primer extension experiments were also performed with the following primers, designed to anneal to the proximal regions of the hyfR and focB genes: hyfR-1, GGCAAACATCGCCTCG TCTGACATAGCCAT; hyfR-2, TACCGCTTCAATTGTTATTCCTTGTGTCGG; focB-1, CGCTTCATCCCTAATCGCGTCGCTGCGCCA; and focB-2, TTCTGGCGCTCAACTGCAAGTCGAAAGAAA. The sequencing ladders were produced by using the T7 Sequenase DNA-sequencing kit (Amersham) together with alkaline-denatured pGS213 as template and the primers described above. Northern blotting was performed as previously described (18) using RNA purified from MC4100 and HD700 (hyc mutant), with or without pGS1020, grown under anaerobic conditions in L broth in the presence of 0.4% glucose and 50 mM formate. The hybridization probes employed were the 10.7-kb DraII fragment of pGS1020 (encompassing the hyfB-hyfR region), the 473-bp HindIII-EcoRV fragment of pGS1018 (containing a fragment of hyfR), and the 469-bp NsiI fragment of pGS944 (containing a fragment of focB).

One-step RT-PCR was used to amplify fragments at the beginning and end of the putative hyf operon according to the manufacturer's (GibcoBRL) instructions. Total RNA was isolated from MC4100, grown as described above, and treated with RNase-free RQ1 DNase (Promega) prior to RT-PCR. Primers (not shown; see Fig. 1 for positions) were 24 to 30 nucleotides in length, with Tm values of ~64°C. Control reactions with chromosomal DNA as template, without template, and without RT were performed.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 1. Gene organization of the hyf region and maps of derived plasmids. The locations and orientations of genes (hatched arrows) within the hyf region are shown, together with the positions of restriction sites used for cloning purposes. Corresponding RT-PCR products are indicated as solid lines, and the dashed line indicates an RT-PCR that failed to give any product (see Materials and Methods for details). The inserts of relevant plasmids containing segments of the hyf region are shown as dark horizontal lines, the Spr cassette is denoted by a black horizontal bar, and deleted DNA is indicated by the dark horizontal broken lines.

Overproduction and isolation of HyfG, HyfH, HyfI, and HyfR and antiserum production. The hyfG, hyfH, hyfI, and hyfR genes were overexpressed as maltose-binding protein (MBP) fusions. The overexpression constructs were produced by first PCR amplifying the hyfG-, hyfH-, and hyfI-coding regions with Pfu and the following primers: hyfG-f, GTGAACGTTAATTCATCGTCAAATCGT; hyfG-r, CCAAGCTTTCCTTACTTCAGCGGCGAA; hyfH-f, ATGCTGAAGTTACTGAAAACTATTATG; hyfH-r, CCAAGCTTGACTCATAGCTGCTCCTTA; hyfI-f, GGCATGAGTCCAGTGCTTACACAACAT; and hyfI-r, CCAAGCTT TCTTCAGTCATGTAACCCCCGG (start and stop codons are italicized and introduced HindIII sites are in boldface). The hyfG, hyfH, and hyfI PCR products were HindIII digested and cloned between the SmaI and HindIII sites of pMal-c2 to generate pPG7, pPG8, and pPG9, respectively (Table 1). For the malE-hyfR construct, the proximal 500-bp region of the hyfR-coding region was PCR amplified with the primers hyfR500-F (ATGGCTATGTCAGACGAGGCGATGTTT) and hyfR500-R (ACGAGCGACGTCAGCGATCAGATCGTC) (the AatII site is in boldface, and the hyfR-start codon is italicized). The 0.5-kb PCR product was digested with AatII and coligated with the 1.5-kb AatII-HindIII 'hyfR fragment of pGS1018 between the SmaI and HindIII sites of pMal-c2 to give pPG10.

Transformants of DH5{alpha}, carrying the malE-hyf fusion plasmids, were propagated in L broth plus 100 µg of Ap/ml and induced with 0.3 mM IPTG (isopropyl-ß-D-thiogalactopyranoside) upon reaching an optical density at 650 nm of 0.5. Growth was continued for a further 3 h, allowing the fusions to reach ~20% of total protein before the cells were harvested and then lysed, typically in 1.5 vol of column buffer (20 mM HEPES [pH 7.4], 200 mM NaCl, 1 mM EDTA, 10% glycerol, 1 mM dithiothreitol, 1 mM benzamidine) by using a French pressure cell (20,000 lb/in2). The soluble supernatants were harvested after centrifugation at ~20,000 x g for 30 min at 4°C, and the MalE-Hyf hybrid proteins were purified by using a 50-ml amylose resin (New England Biolabs) column according to the manufacturer's instructions. The MalE-Hyf proteins were cleaved with factor Xa (note that the MalE-HyfH fusion protein could not be cleaved with factor Xa). Because the free HyfG, HyfI, and HyfR polypeptides were only weakly soluble, they were purified to homogeneity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by electroelution. The HyfG, HyfI, and HyfR polypeptides and the MalE-HyfH fusion were used to raise antibodies in rabbits. Immunoassay experiments with the resulting antisera gave strong immunostaining responses to the corresponding antigen at high antiserum dilutions (up to 40,000-fold), indicating that the antisera are of a high titer.

HyfH was also overproduced to ~20% of total cell protein as a His6-tag fusion by using BL21/DE3(pPG6). The plasmid pPG6 was made as follows. A 0.54-kb fragment was PCR amplified as described above using pGS944 as template and the primers HyfH-His-f (GGGAATTCATATGCTGAAGTTACTGAAA) and HyfH-His-r (GGCTCGAGTAGCTGCTCCTTAGCC) (NdeI site is in boldface, start codon is italicized, and XhoI site is in boldface). The NdeI- and XhoI-digested PCR product was cloned into the corresponding sites of pET21a. Overproduced HyfH-His6 was completely insoluble and was purified by SDS-PAGE and electroelution.

SDS-PAGE and Western blotting were performed as previously described (19).

Placing hyfR under control of the lac promoter (Plac). The proximal segment of the hyfR-coding region was PCR amplified from pGS944 with Pfu DNA polymerase and the primers hyfR1-F (CCGAATTCATATGGCTATGTCAGACGAGGCG) and hyfR1-R (CCGGATCCGATGATGATCGCGATCTTTC) (EcoRI, BamHI, and NruI sites are in boldface; NdeI site is in italics; and start codon is underscored), which were designed to introduce an NdeI site at the initiation codon and to introduce flanking EcoRI and NsiI restriction sites for cloning purposes. The 470-bp EcoRI- and NsiI-digested PCR product was cloned into the EcoRI and PstI sites of pUC118 to generate pGS1017. Then the 1,580-bp NruI-NsiI distal segment of the hyfR-coding region of pGS944 was cloned together with the 470-bp NruI-PstI fragment of pGS1107 between the NruI and PstI sites of pGS1017, creating pGS1018, containing the complete hyfR-coding region with an NdeI site at the initiation codon. The 2.03-kb hyfR-containing NdeI-HindIII fragment of pGS1018 was cloned into the corresponding sites of pET21a to give pGS1019. Finally, the ~2-kb XbaI-HindIII fragment of pGS1019 (containing the hyfR gene with a ribosome-binding site from pET21a located just upstream of the initiation codon) was cloned between the XbaI and HindIII sites of pSU18 to give pGS1087 in which the hyfR gene is appropriately located downstream of the lac promoter (Plac) enabling Plac-dependent expression of hyfR.

Gel retardation. A 250-bp bcp-hyfA intergenic region was PCR amplified with primers hyfRB1-F and hyfRB1-R (CCGAATTCCTGGCTGAAAGAACACGC and CCGAATTCCACCACAAAGCGGTTCAT, respectively [EcoRI sites are in boldface]) with Pfu DNA polymerase and pGS1020 as template. The purified fragment was digested with EcoRI, labeled with [32P]dATP by using the Klenow fragment, and separated from unincorporated nucleotides by using a Pharmacia nick spin column. The labeled PCR product (~1 ng) was added to a binding mixture consisting of 18% glycerol, 0.1% Triton X-100, 10 mM Tris-HCl (pH 7.5), 500 mM NaCl, 5 mM dithiothreitol, 1 µg of poly(dI-dC) DNA, and up to 40 µg of protein (MBP-HyfR or, as a control, MBP-HyfI) in a total volume of 40 µl and incubated for 40 min at 37°C. Gel retardation was performed in gels (preelectrophoresed for 1 h) containing 6% polyacrylamide, 1% Triton X-100, and 1x TBE (95 mM Tris-borate, 2 mM EDTA, pH 8) by using a Mini Protean system (Bio-Rad) at a constant 100 V for 1.5 h, followed by autoradiography.

Hydrogen evolution and enzyme assays. Hydrogen evolution activity was assayed as described by Ballantine and Boxer (4). Levels of hydrogenase activity obtained for MC4100 (1.75 µmol of benzylviologen min-1 mg of protein-1) were similar to those previously reported (4.19 µmol of benzylviologen min-1 mg of protein-1 [36]), although we note that the levels of hydrogenase activity reported vary considerably (37, 38, 46). Formate dehydrogenase H (Fdh-H) activity was measured in toluene-treated cells by monitoring formate-dependent benzylviologen reduction at 600 nm (2, 4). ß-Galactosidase measurements were made as described previously (14), with all values derived from at least two samples, each assayed in duplicate.

63Ni labeling. 63Ni labeling experiments were performed with strains grown anaerobically to stationary phase in TYEP medium (pH 6.6) (5a) containing 0.4% glucose, 50 mM sodium formate, and 5 µM 63Ni (63NiCl2, 5 µCi ml-1). Cells were harvested at 3,200 x g for 5 min, washed in saline, resuspended in Tris buffer (20 mM Tricine, 5% sucrose, pH 8), and then incubated with 10 mM EDTA (pH 8) at room temperature for 5 min. Cells were then incubated with lysozyme (1 mg ml-1) for 10 min at room temperature and vortexed briefly. The spheroplasts thus generated were harvested (3,000 x g, 30 s, room temperature) and lysed by resuspension in 300 µl of TrM (20 mM Tricine, 0.5% MgSO47H2O, pH 7.5) with vortexing for 10 min. Triton X-100 (33 µl, 1%) and glycine (30 µl, 50%) were added, and the nucleic acids were removed by the addition of 30 µl of 10% streptomycin sulfate, inoculation on ice for 30 min, and centrifugation (12,000 x g, 5 min, room temperature). The supernatants were electrophoresed in 5% native polyacrylamide gels containing 0.1% Triton X-100. Electrophoresed gels were dried under a vacuum at 70°C and then autoradiographed with BioMax MS film and a BioMax intensifying screen (Kodak) for 2 weeks at -70°C.


arrow
RESULTS
 
Transcriptional organization and expression of the hyf operon. The first 10 genes (hyfA-hyfJ) of the hyfABCDEFGHIJ-hyfR-focB operon are organized in a manner suggesting that adjacent genes are translationally coupled (1). However, the hyfR and focB genes are preceded by 29 and 20 bp of noncoding DNA, respectively, indicating that they are not subject to translational coupling and may be independently transcribed. Thus, in order to study hyf operon expression and to investigate the transcriptional organization of the operon, four lacZ transcriptional fusions were generated: two hyfA-lacZ fusions (pGS1102 and pGS1103), a hyfR-lacZ fusion (pGS1131), and a focB-lacZ fusion (pGS1132) (Fig. 1 and Table 1). Preliminary experiments with transformants of the wild-type (MC4100) containing the multicopy hyfA-, hyfR-, and focB-lacZ fusion plasmids showed that only the hyfA-lacZ fusions were active (in L broth containing 0.4% glucose under anaerobic and aerobic conditions), indicating that the hyfR and focB genes do not possess independent promoters and are thus likely to be transcribed as part of the hyf operon (data not shown). The two hyfA-lacZ fusions displayed very similar activities, and for this reason, only one (pGS1102) was used in subsequent work. Such studies were facilitated by transferring the hyfA-lacZ fusion of pGS1102 to the chromosome of MC4100 (see Materials and Methods and Table 1) to create a single-copy version of the hyf-lacZ fusion (DS5). No further investigations were performed with the other lacZ fusions.

The hyf operon is anaerobically induced by formate in the absence of high-potential electron acceptors. The expression of the hyfA-lacZ fusion under aerobic conditions in rich broth was detectable only in the postexponential phase of growth (<0.02 µmol of o-nitrophenyl-ß-D-galactopyranoside/min/mg) and was not significantly affected by formate (Fig. 2A). However, under anaerobic-fermentative conditions, expression was measurable at all stages of growth but was ~4-fold greater in stationary phase than in the logarithmic phase (Fig. 2B). Anaerobic-fermentative expression was induced ~3-fold by the presence of formate, with expression remaining growth phase dependent. Expression under anaerobic-respiratory conditions with nitrate or trimethylamine-N-oxide (TMAO) was slightly lower (by 1.5- to 2-fold) than that under fermentation conditions (Fig. 2B and C), and formate again failed to affect hyf expression. However, when fumarate was employed as the anaerobic terminal-electron acceptor, expression was induced up to ~6-fold by formate (Fig. 2D). Thus, hyf expression is induced by formate in the absence of the respiratory-electron acceptors O2, NO3-, and TMAO. The failure of fumarate to inhibit the formate-dependent induction of hyf expression is probably related to its relatively low redox potential (E0' = 0.03 V cf. 0.82, 0.42, and 0.13 V for O2, NO3-, and TMAO, respectively). It is probable that the lack of formate induction in the presence of O2, NO3-, and TMAO arises from efficient formate consumption by the respiration-linked formate dehydrogenases (formate dehydrogenases N and O), resulting in relatively low levels of intracellular formate. Alternatively, it is possible that that formate-dependent induction of hyf expression is stimulated by low redox potentials.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 2. The effect of respiratory-electron acceptors and formate on hyf expression. ß-Galactosidase activities (solid lines) and growths (broken lines) are shown for strain DS5 (MC4100 hyfA-lacZ) in L broth as follows: (A) aerobically with (triangles) or without (diamonds) 50 mM sodium formate (Form) or aerobically in 0.4% glucose (Glu) with (+) or without (x) 50 mM sodium formate; (B) anaerobically in 0.4% glucose with (triangles) or without (diamonds) formate; (C) anaerobically with 0.4% glycerol and either 40 mM sodium nitrate (squares and circles) or 40 mM TMAO (triangles and diamonds) with (squares and triangles) or without (circles and diamonds) formate (F); (D) anaerobically with glycerol and 40 mM sodium fumarate with (triangles) or without (diamonds) formate (Form). ß-Galactosidase values are the averages of duplicate cultures, each assayed twice. Standard deviation was generally within 10%. ONPG, o-nitrophenyl-ß-D-galactopyranoside; OD650, optical density at 650 nm.

Induction of anaerobic hyf transcription by formate is pH dependent. To determine whether the formate-dependent induction of hyf expression is influenced by pH, expression was measured under fermentative growth conditions in media buffered at high, neutral, and low pHs (Fig. 3). Expression of hyfA-lacZ was ~6-fold higher in medium buffered initially to pH 6.1 rather than that at pH 7.0 or 7.8, indicating that hyf is induced by low external pH. The addition of 50 mM sodium formate increased expression two- to threefold further in medium buffered to pH 6.1 or 7.0 but had no effect on expression at pH 7.8 (Fig. 3). Thus, the expression of hyf is clearly related to both the external pH and the presence of formate (Fig. 3). In the absence of added formate, hyf induction requires an external pH below ~6.0, but in the presence of added formate, induction occurs at a higher external pH (below ~6.5). These results indicate that the hyf operon is induced by formate at a low external pH (pH 6.5), a pattern of transcriptional regulation that closely resembles that of the hyc operon (33, 48).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. Effect of formate and pH on expression of the hyf operon. Experiments were performed with DS5 under anaerobic conditions in TYEP medium containing 0.4% glucose with (broken line) or without (solid line) 50 mM formate. The starting pH (7.8, 7.0, or 6.1, indicated above the data points) was achieved by adjusting the ratio of K2HPO4 to KH2PO4. Samples were harvested in stationary phase (~8 h), and the final pH of the medium (at the point of harvesting) was determined. The presence of formate at pH 6.1 resulted in a ~10-fold decrease in growth (data not shown). Variation was within 10% of the mean. Other details are as described in the legend to Fig. 2.

FhlA and {sigma}54 mediate the formate-dependent induction of hyf transcription. The {sigma}54-dependent transcriptional activator, FhlA, induces expression of the genes of the formate regulon in response to elevated intracellular formate levels (27, 41). In order to test whether the hyf operon is also a member of the FhlA/formate regulon, an fhlA-null mutation (fhlA::placMu53 kan) was introduced into the hyfA-lacZ reporter strain (DS5) to create DS7 (fhlA::placMu53 kan hyfA-lacZ), which was used to investigate the FhlA-dependent formate induction of hyf expression (Fig. 4). No induction of hyf expression by formate was observed in the fhlA mutant (Fig. 4), but expression was enhanced fivefold by a multicopy fhlA plasmid (pSH9) in both the fhlA mutant (DS7) and wild-type (DS5) backgrounds (Fig. 4). Taken together, these results imply that FhlA mediates the formate-dependent induction of hyf-operon transcription and suggest that the expression of hyf is limited by the cellular levels of FhlA.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 4. Effect of FhlA, {sigma}54, hydrogenase-3, and HycA on the expression of the hyf operon (hyfA-lacZ fusion). Strains were grown to stationary phase (8 to 10 h) anaerobically in TYEP medium (initial pH 6.6) containing 0.4% glucose with (filled bars) or without (open bars) 30 mM formate. The strains employed were as follows: hyfA-lacZ, DS5; hyfA-lacZ fhlA::placMu, DS7; fhlA::placMu, DS8; hyfA-lacZ fhlA++, DS5(pSH9); hyfA-lacZ fhlA/fhlA++, DS7(pSH9); hyfA-lacZ ntrA, DS11; hyfA-lacZ hycB-hycH, DS10; and hyfA-lacZ hycA, DS9. Some activity detected in strain DS7 was contributed by the fhlA-lacZ fusion generated by the integration of {lambda}placMu into the fhlA gene in order to create the fhlA mutation. The ß-galactosidase activity produced by the fhlA-lacZ fusion was determined by analysis of the strain DS8 (MC4100, fhlA::{lambda}placMu53 kan). This activity was then subtracted from that measured in DS7, giving the ß-galactosidase activity contributed by the hyfA-lacZ fusion (designated 'hyfA-lacZ fhlA'). For growths with DS11, the medium was supplemented with 0.2% glutamine (0.2% glutamine had no effect on hyf-lacZ expression for DS5 [data not shown]). Other details are as described in the legend to Fig. 3.

The possible involvement of {sigma}54 in hyf transcription was tested by introducing an ntrA ({sigma}54) mutation into the hyfA-lacZ reporter strain. This abolished the induction of hyf expression by formate, providing further support for the {sigma}54 dependence of hyf operon transcription (Fig. 4).

It was considered possible that the effects of the fhlA and ntrA mutations on hyf operon expression could be an indirect consequence of weak hyc expression (which is also {sigma}54 and FhlA dependent), resulting in low levels of Fhl-1 and a subsequent inability to decompose formate under fermentative conditions. This was investigated by introducing a hycB-hycH deletion into the hyfA-lacZ reporter strain (to create DS10). The hycB-hycH mutation had no significant effect on hyf expression, confirming that the positive effects of FhlA on hyf expression were not caused by metabolic changes arising from lack of expression of the hyc operon (Fig. 4).

HycA is an antiactivator of formate-dependent hyf transcription. The product of the first gene of the hyc operon, hycA, negatively regulates transcription of the genes in the formate/FhlA regulon (36). The hyfA-lacZ fusion was introduced into strain HD701 (MC4100, {Delta}hycA) to study the effect of the hycA deletion on hyf expression (Fig. 4). The formate-dependent induction of hyfA-lacZ expression was increased three- to fourfold by the hycA mutation (Fig. 4). These results are consistent with HycA acting as an antiactivator of FhlA and with FhlA in turn acting as a formate-dependent transcriptional activator of the hyf operon.

HyfR regulates hyf expression. To determine whether HyfR, like its homologue, FhlA, regulates transcription of the hyf operon, the effect of hyfR inactivation on hyfA-lacZ expression was studied (Fig. 5; note use of logarithmic scale). Somewhat surprisingly, the hyfR mutation had no effect on hyfA-lacZ expression. However, introducing pGS1087, a multicopy plasmid encoding a Plac-controlled hyfR gene, into the hyfA-lacZ reporter strain (DS5) resulted in a massive induction (>1,000-fold) of hyf expression (Fig. 5). This effect was not seen in the ntrA mutant, demonstrating that the HyfR-dependent induction of hyf expression is {sigma}54 dependent (Fig. 5). HyfR-dependent induction was unaffected by the fhlA mutation, indicating that FhlA does not participate in the transcriptional activation of hyf by HyfR. The induction was highly growth phase dependent, with expression being ~1,000-fold higher in the postexponential and stationary phases than in the exponential phase (data not shown). The HyfR-dependent postexponential-phase induction of hyf was accompanied by a drop in the pH of the medium below ~6.0 (data not shown), which indicates that HyfR-mediated transcriptional activation requires a low external pH. In support of this suggestion, HyfR induction of hyf was reduced by about 20-fold when the pH of the growth medium was maintained above pH 7.0 (Fig. 5). Additionally, induction of hyf by HyfR was slightly (~2-fold) enhanced by formate (Fig. 5) and was extremely weak under aerobic conditions (Fig. 5). These results indicate that transcriptional activation by HyfR is strongly inhibited by oxygen, strongly enhanced by low pH, and weakly stimulated by formate.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 5. Effect of HyfR on expression of the hyf operon (hyfA-lacZ fusion). Anaerobic cultures in TYEP medium containing 0.4% glucose with (closed bars) or without (open bars) 50 mM formate were sampled in the stationary phase (8 to 10 h). The strains were as follows: hyfA-lacZ, DS5; hyfA-lacZ hyfR, DS6; hyfA-lacZ/hyfR++, DS5(pGS1087); hyfA-lacZ hyfR/hyfR++, DS6(pGS1087); hyfA-lacZ ntrA/hyfR++, DS11(pGS1087); hyfA-lacZ fhlA::placMu /hyfR++, DS7(pGS1087); and fhlA::placMu/hyfR++, DS8(pGS1087). Note that the pH of cultures dropped from 6.6 to a final pH of ~5.7, except for those starting at pH 7.8 (as indicated), which fell to pH 7.0. DS11(pGS1087) was grown in the presence of 0.2% glutamine, which had no significant effect on expression. Other details are as described in the legend to Fig. 3.

Provision of the entire hyf operon in multicopy by transformation with the plasmid pGS1020 had no significant effect on hyfA-lacZ expression levels under fermentative conditions in the presence of 50 mM formate (data not shown), suggesting that hyfR expression from the hyf operon is too weak to produce levels of HyfR sufficient to induce the hyfA-lacZ fusion, at least under the growth conditions employed here.

Effect of HyfR on fdhF-lacZ and hycB-lacZ gene expression. The above data show that both FhlA and HyfR act as transcriptional activators for the hyf operon. The other major targets for activation by FhlA are the hyc operon and the fdhF gene. To study whether these genes are also HyfR dependent, the effects of the multicopy hyfR plasmid (pGS1020) and the corresponding vector (pSU18) on the activity of the fdhF-lacZ and hycB-lacZ transcriptional fusions were compared. The hyfR plasmid enhanced fdhF-lacZ expression just ~2-fold during anaerobic growth in TYEP medium containing 0.4% glucose (data not shown). It is unclear whether this relatively weak HyfR-dependent induction of fdhF expression is physiologically significant, although it is consistent with the suggestion that FdhH (encoded by fdhF) and the Hyf complex form a second Fhl system in E. coli (1). No significant HyfR effect was observed for hycB-lacZ expression, indicating that the hyc operon is not subject to transcriptional regulation by HyfR and that, despite the close similarities of the DNA-binding regions of the two proteins (1), the DNA-binding specificity of HyfR is distinct from that of FhlA.

The hyf transcriptional start site is associated with a {sigma}54-dependent promoter. The transcriptional start site of the hyfA gene was identified by RT-mediated primer extension using a primer designed to anneal 24 bp downstream from the predicted transcriptional start site of hyfA (see Materials and Methods) together with RNA isolated from MC4100(pGS1020) grown under anaerobic conditions in L broth plus 50 mM formate. One major cDNA product was observed corresponding to a single transcriptional start site (coordinate A-1226 [1]). This site is 30 bp upstream of the hyfA start codon and ideally positioned 12 bp downstream of a previously predicted {sigma}54-dependent promoter-binding site (Fig. 6) (1). No cDNA products were observed when primer extension experiments were performed with primers to the hyfR and focB genes (data not shown), providing further evidence for the absence of hyfR- or focB-specific promoters. No clear hybridization bands corresponding to hyf transcripts were observed in Northern blotting experiments (see Materials and Methods for details), in either the presence or the absence of multicopy hyf (data not shown). This may reflect the low abundance or instability of the hyf message.



View larger version (83K):
[in this window]
[in a new window]
 
FIG. 6. Identification of the hyf transcriptional start site by RT-mediated primer extension. RNA was isolated from MC4100(pGS1020) grown anaerobically in L broth containing 0.4% glucose and 50 mM formate. Lanes 1 and 2 indicate the primer extension product with primer hyfA-hyfF. The sequencing ladder (lanes A, C, G, and T) was generated by using primer hyfA-hyfF and pGS213 as template. The corresponding complementary sequence (with the deduced +1, -12, and -24 sites underscored with residues matching the consensus in bold and large type) and the transcriptional start site (indicated by horizontal arrow) are shown.

To determine whether any of the hyf genes are cotranscribed, RT-PCR was used to amplify various regions at the beginning and the end of the putative hyf operon transcript by using RNA isolated from MC4100 grown as described above. The following RT-PCR products were obtained: hyfA-hyfB, hyfC-hyfD, hyfG-hyfH-hyfI, hyfH-hyfI-hyfJ, hyfR-hyfR, and hyfR-focB (data summarized schematically in Fig. 1). However, despite several attempts (and positive results with chromosomal DNA), it was not possible to obtain a hyfJ-hyfR RT-PCR product, suggesting that the hyfR-focB genes are not part of the hyf operon and are transcribed independently. This finding somewhat contradicts the lack of hyfR-lacZ activity and the failure to detect a hyfR RT primer extension product. These discrepancies may be a consequence of the location of the putative hyfR promoter some distance upstream of the hyfR structural gene.

Interaction of HyfR with the hyfA upstream region. Gel retardation experiments were performed to determine whether HyfR specifically interacts with the hyfA promoter (PhyfA) region. A 250-bp fragment containing the bcp-hyfA intergenic region was PCR amplified, radiolabeled, and incubated with factor Xa-treated MalE-HyfR. In the presence of HyfR, a relatively minor band of very low mobility was observed (Fig. 7). The intensity of the retarded band was directly related to the amount of the MalE-HyfR mixture included in the reaction and was not observed when MalE-HyfR was replaced by MalE-HyfI (Fig. 7), suggesting that retardation depends on the presence of HyfR. The retarded band is presumed to correspond to a HyfR-PhyfA complex that is unable to penetrate the acrylamide gel upon electrophoresis due to the poor solubility and/or large size of HyfR. The HyfR-PhyfA retardation band was much reduced in the presence of the excess unlabeled-hyfA fragment but was unaffected by the presence of excess unlabeled-pUC118 DNA (Fig. 7). This indicates that the interaction of HyfR with the PhyfA fragment is nucleotide sequence specific.



View larger version (73K):
[in this window]
[in a new window]
 
FIG. 7. Gel retardation analysis of HyfR interaction with the hyfA promoter region. A 32P-labeled 250-bp bcp-hyfA fragment (~1 ng) was incubated with the indicated quantities of MBP-HyfR or 40 µg of MBP-HyfI (as negative control). Where indicated, either 420 ng of unlabeled (cold) bcp-hyfA DNA or 500 ng of unlabeled (cold-control) pUC119 DNA was added. Other details are as described in Materials and Methods.

Lack of immunological and biochemical evidence for hyf expression. In an attempt to detect the expression of hyf-encoded proteins, Western blots containing whole-cell extracts from various E. coli strains (wild-type and mutant strains carrying deletions in the hyc and hyf operons) grown fermentatively in rich medium in the presence of formate and glucose were immunostained with antisera specific for the large and small subunits of hydrogenase-4 (HyfG and HyfI, respectively), the TYKY homologue (HyfH), or the proposed hyf regulator (HyfR). No immunoreactive bands attributable to the relevant Hyf polypeptides were detected, even when the transcriptional levels from the hyf operon were increased by using transformants carrying pGS1087 (Plac-hyfR) or pGS1020 (hyfA-hyfJR-focB) (data not shown). The anti-Hyf antisera were of high titer (see Materials and Methods), suggesting that the failure to detect Hyf polypeptides was probably due to their low abundance. This may be related to low rates of translational initiation and/or poor codon usage for the hyf genes (1). Anti-HycE antiserum (a gift from A. Bock) was also employed in Western blot studies of whole-cell extracts of HD700 ({Delta}hycA-hycH), HD705 ({Delta}hycE), HD709 ({Delta}hycI), JRG3934 ({Delta}hycB-hycH {Delta}hyfB-hyfR), and MC4100 (wild type) grown fermentatively in TYEP medium with 0.4% glucose and 30 mM formate (data not shown). Although the processed and unprocessed forms of HycE were detected in the appropriate strains, no band corresponding to HyfG was observed despite the high sequence identity (73%) between HycE and HyfG (1).

Whole-cell 63Ni labeling studies were performed in an attempt to identify an Ni-containing protein corresponding to HyfG. Autoradiographic analysis of native polyacrylamide gels containing 63Ni-labeled, Triton X-100-solubilized whole-cell extracts of the wild type, various mutants ({Delta}hycE, {Delta}hycI, {Delta}hyaB, {Delta}hybC, {Delta}hyaB {Delta}hybC {Delta}hycE, {Delta}hyaC {Delta}hybB {Delta}hycB-hycH, {Delta}hycE {Delta}hyfB-hyfR), and pGS1020 (hyfA-hyfR focB) transformants grown fermentatively with formate failed to reveal any bands likely to correspond to HyfG, although bands corresponding to the large subunits (HyaB, HybC, and HycE) of hydrogenase-1, -2, and -3 were observed with the HyaB band being the predominant species (data not shown).

Bagramyan and coworkers (3, 3a) recently reported on Hyf-dependent H2 production in E. coli grown fermentatively at pH 7.5 with glucose (no formate). This Hyf-dependent activity was reported to be absent in strains grown in medium supplemented with formate or at a low pH. In order to test for the presence of Hyf-dependent H2 production, the hydrogenase-1, -2, and -3 triple mutant, FTD147 ({Delta}hyaB {Delta}hybC {Delta}hycE), carrying chromosomal in-frame deletions in the genes encoding the large subunits of hydrogenase-1, -2, and -3 was employed. H2 production assays were performed at pH 6.8 and 7.5 with the triple mutant, the wild type (MC4100), and a pGS1087 transformant of FTD147 grown fermentatively in rich broth containing 0.4% glucose and buffered to either pH 6.5 or 7.5 with 0.1 M Tris-phosphate buffer. The H2 production at an acidic pH was abolished by the deletion of the hyaB, hybC, and hycE genes, and no H2 production attributable to Hyf was detected at either pH (data not shown). In addition, although the measurement of gas evolution by using inverted Durham tubes (40) showed H2 production under fermentative conditions for MC4100, no gas was produced by the hycE mutant (HD705) even when transformed with pGS1087 or pGS1020 (data not shown). Finally, no Hyf-dependent formate dehydrogenase activity (formate-dependent benzyl viologen reduction) was discernible for strains (MC4100, JRG3621, and HD705) grown and assayed at pH 6.6 or 7.6, although Hyc-dependent activity was clearly observed at pH 6.6 (data not shown). Thus, the experiments described above failed to detect the presence of any Hyf protein or any Hyf-dependent biochemical activity in MC4100 under conditions of optimal hyf transcription. Moreover, the findings of Bagramyan et al. (3, 3a) concerning Hyf-dependent H2 production under fermentative conditions at pH 7.5 could not be confirmed.

Growth properties of the hyc and hyf mutants. Anaerobic controlled-batch cultivations of JRG3621 ({Delta}hyfB-hyfR) and MC4100 under fermentative conditions at pH 6.5 and 7.5 (see Materials and Methods) failed to reveal any differences in growth or in the yield of fermentation products (data not shown). As expected, HD705 ({Delta}hycE) grown under these conditions produced twice as much formate at pH 6.5 as the hycE+ strains. Aerobic and anaerobic glucose-limited chemostat cultivation of JRG3621 ({Delta}hyfB-hyfR) and MC4100 at pH 6.5 revealed no differences in growth or fermentation product yield attributable to the hyf operon (data not shown). In addition, fermentative batch growths at pH 6.5 or 7.5 failed to reveal any significant effect of the hyfB-hyfR mutation on growth or acid production even when combined with the hyc mutation. Thus, no growth or metabolic defect resulting from hyf inactivation could be demonstrated.


arrow
DISCUSSION
 
The studies described here focused on the regulation of hyf expression. Primer extension and lacZ fusion studies indicated a single {sigma}54-dependent promoter for the hyf operon that was located just upstream of hyfA. However, RT-PCR experiments failed to generate a hyfJ-hyfR product, suggesting that hyfR-focB possesses an independent promoter and that the hyfA promoter may specify a hyfA-hyfJ transcript. The transcriptional regulation of the hyf (hyfA-hyfJ) operon appears similar to that exhibited by the closely related hyc operon in that both are induced by FhlA under fermentative conditions in response to formate and low pH. Likewise, the FhlA-dependent activation of hyf expression resembles that of hyc in being inhibited by the antiactivator HycA. Thus, the hyf operon clearly belongs to the formate/FhlA regulon of E. coli, and this would be consistent with the Hyf complex having a role similar to that of the Hyc complex in fermentative formate metabolism (Fig. 8). However, the similarities between the hyf and hyc regulation do not extend to their response to HyfR. The work reported here strongly suggests that HyfR acts as a {sigma}54-dependent transcriptional activator of hyf but not of hyc. Thus, the transcriptional control exerted by HyfR represents a major difference between the hyf and hyc operons.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 8. Model depicting the transcriptional regulation of the formate regulon. Thick arrows indicate gene-product relationships of key members of the formate regulon. Dashed arrows are used to show induction (+) or repression (-) effects. Regulatory proteins and their corresponding genes are shown in gray. Arrows above or below the operons or genes indicate transcriptional organization.

Overproduction of HyfR increased hyf expression by up to 1,000-fold. This induction was highly dependent upon the growth conditions and appears to involve direct interaction of HyfR with the hyf operator/promoter region. Induction by HyfR required anaerobiosis, low pH (<6.0), and entry into the postexponential phase of growth. Interestingly, inclusion of formate in the growth medium had only a weak (~2-fold) effect on HyfR-dependent hyf activation. It is not clear whether this weak formate effect is significant or whether, like FhlA, HyfR responds to intracellular formate concentrations. The induction of hyf by HyfR was only observed when hyfR was placed under the control of the inducible Plac promoter. No HyfR-dependent induction of hyf was seen when HyfR production relied upon expression from the hyfR gene located within the single- or multicopy hyf operon. This suggests that the expression of hyfR from the hyf operon is extremely weak under the conditions employed in this study.

FhlA is reported to utilize Mo (apparently associated with MoeA [43]) and formate as coeffectors during fermentative growth at a low external pH. Low external pH is not thought to be directly sensed by FhlA; instead, formate uptake is believed to be activated by low pH, resulting in higher intracellular formate levels at a low external pH (37). A similar mechanism may explain the pH and weak formate dependence of HyfR. HyfR is closely similar to FhlA at the primary-structure level (46% identity [1]) and might therefore be expected to possess similar sensory properties. Alignment of the FhlA and HyfR amino acid sequences showed that, although the N-terminal signal-sensing A domains of the two proteins are similar, the HyfR protein possesses an amino acid motif absent in FhlA (1). This motif, -C-X6-H-C-X-C-P-X-C-X-P-, is predicted to serve as a binding site for an iron-sulfur cluster or a metal cofactor, which could be involved in sensing redox or other signals (1). Identifying the precise environmental and/or metabolic factors recognized by HyfR could provide important clues concerning the physiological purpose of the Hyf system.

Although transcriptional activity was clearly demonstrated for the hyfA-lacZ fusion, and RT primer extension and RT-PCR products were identified for the hyf transcript, no Hyf-protein products were detected either immunologically or by 63Ni labeling, even when optimal hyf expression conditions and pGS1087 (Plac-hyfR) or pGS1020 (hyfA-hyfR-focB) transformants were used. In addition, no Hyf-dependent formate dehydrogenase or hydrogenase activity was observed and no growth defects or differences in fermentation product generation were seen for hyf mutants. This inability to reveal any Hyf translation product, Hyf-related biochemical activity, or hyf-associated phenotype is consistent with extremely weak expression of the components of the hyf operon in MC4100, which is in turn supported by the weak codon usage of the hyf structural genes. It is possible that good expression of the hyf operon requires prolonged postexponential-phase growth at low redox potential and low pH. Clearly, the required conditions were not achieved in the batch cultures of the E. coli strains used here.


arrow
ACKNOWLEDGMENTS
 
We thank A. Böck for kindly providing strains and other materials used in this study.

This work was supported by a BBSRC grant awarded to S.C.A., B.C.B., and J.R.G., a BBSRC Committee Studentship awarded to D.A.G.S. and M.A., and a Royal Society Research grant awarded to S.C.A. F.S. is a Royal Society University Research Fellow, and B.C.B. is an RJP Williams Senior Research Fellow at Wadham College, Oxford, United Kingdom.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: School of Animal and Microbial Sciences, The University of Reading, Reading RG6 6AJ, United Kingdom. Phone: 118 931 8463. Fax: 118 931 0180. E-mail: s.c.andrews{at}reading.ac.uk. Back

{dagger} Present address: The VLA Weybridge, Weybridge, Surrey KT15 3NB, United Kingdom. Back


arrow
REFERENCES
 
    1
  1. Andrews, S. C., B. C. Berks, J. McClay, A. Andrew, M. A. Quail, P. Golby, and J. R. Guest. 1997. A 12-cistron Escherichia coli operon (hyf) encoding a putative proton-translocating formate hydrogenlyase system. Microbiology 143:3633-3647.[Abstract/Free Full Text]
  2. 2
  3. Axley, M. J., D. Drahame, and T. C. Stadtman. 1990. Escherichia coli formate hydrogen-lyase: purification and properties of the selenium-dependent formate dehydrogenase component. J. Biol. Chem. 265:18213-18218.[Abstract/Free Full Text]
  4. 3
  5. Bagramyan, K., A. Vassilian, N. Mnatsakanyan, and A. Trchounian. 2000. Participation of hydrogenase 4, encoded by hyf operon, in liberation of molecular hydrogen and proton-potassium exchange by Escherichia coli. Biol. Membr. 17:604-615.
  6. 3
  7. Bagramyan, K., N. Mnatsakanyan, A. Poladian, A. Vassilian, and A. Trchounian. 2002. The roles of hydrogenases 3 and 4, and the F0F1-ATPase, in H-2 production by Escherichia coli at alkaline and acidic pH. FEBS Lett. 516:172-178.[CrossRef][Medline]
  8. 4
  9. Ballantine, S. P., and D. H. Boxer. 1986. Isolation and characterisation of a soluble active fragment of hydrogenase isoenzyme 2 from the membranes of anaerobically grown Escherichia coli. Eur. J. Biochem. 156:277-284.[Medline]
  10. 5
  11. Bartolome, B., Y. Jubete, E. Martinez, and F. De La Cruz. 1991. Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives. Gene 102:75-78.[CrossRef][Medline]
  12. 5
  13. Begg, Y. A., J. N. Whyte, and B. A. Haddock. 1977. The identification of mutants of Escherichia coli in formate dehydrogenase and nitrate reductase activities using dye indicator plates. FEMS Microbiol. Lett. 2:47-50.[CrossRef]
  14. 6
  15. Bergmeyer, H.-U., and E. Bernt. 1965. {alpha}-D-Glucose; determination with glucose oxidase and peroxidase, p. 123-130. In H.-U. Bergmeyer (ed.), Methods of enzymic analysis. Verlag Chemie Academic Press, New York, N.Y.
  16. 7
  17. Beutler, H.-O. 1984. Two and one carbon compounds; ethanol, p. 598-606. In H.-U. Bergmeyer (ed.), Methods of enzymic analysis, vol. VI. Verlag Chemie, Deerfield Beach, Fla.
  18. 8
  19. Birkmann, A., and A. Böck. 1989. Characterization of a cis regulatory DNA element necessary for formate induction of the formate dehydrogenase gene (fdhF) of Echerichia coli. Mol. Microbiol. 3:187-195.[CrossRef][Medline]
  20. 9
  21. Birkmann, A., H. Hennecke, and A. Böck. 1989. Construction of chimaeric promoter regions by exchange of the upstream regulatory sequences from fdh and nif genes. Mol. Microbiol. 3:697-703.[CrossRef][Medline]
  22. 10
  23. Birkmann, A., F. Zinoni, R. G. Sawers, and A. Böck. 1987. Factors affecting transcriptional regulation of the formate hydrogen-lyase pathway of Escherichia coli. Arch. Microbiol. 148:44-51.[CrossRef][Medline]
  24. 11
  25. Birkmann, A., R. G. Sawers, and A. Böck. 1987. Involvement of the ntrA gene product in the anaerobic metabolism of Escherichia coli. Mol. Gen. Genet. 210:535-542.[CrossRef][Medline]
  26. 12
  27. Böck, A., and G. Sawers. 1996. Fermentation, p. 262-282. In F. C. Neidhardt et al. (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C.
  28. 13
  29. Bohm, R., M. Sauter, and A. Böck. 1990. Nucleotide sequence and expression of an operon in Escherichia coli coding for formate hydrogenlyase components. Mol. Microbiol. 4:231-243.[Medline]
  30. 14
  31. Casadaban, M. J., and S. N. Cohen. 1979. Lactose genes fused to exogenous promoters in one step using a Mu-lac bacteriophage: in vivo probe for transcriptional control sequences. Proc. Natl. Acad. Sci. USA 76:4530-4533.[Abstract/Free Full Text]
  32. 15
  33. Chang, A. C. Y., and S. N. Cohen. 1978. Construction and characterisation of amplifiable multicopy DNA cloning vehicles derived from the PISA cryptic mini-plasmid. J. Bacteriol. 134:1141-1156.[Abstract/Free Full Text]
  34. 16
  35. Clarke, L., and J. Carbon. 1976. A colony bank containing synthetic ColE1 hybrid plasmids representative of the entire E. coli genome. Cell 9:91-99.[CrossRef][Medline]
  36. 17
  37. Gennis, R. B., and V. Stewart. 1996. Respiration, p. 217-261. In F. C. Neidhardt et al. (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C.
  38. 18
  39. Golby, P., D. J. Kelly, J. R. Guest, and S. C. Andrews. 1998. Transcriptional regulation and organization of the dcuA and dcuB genes, encoding homologous anaerobic C4-dicarboxylate transporters in Escherichia coli. J. Bacteriol. 180:6586-6596.[Abstract/Free Full Text]
  40. 19
  41. Golby, P., D. J. Kelly, J. R. Guest, and S. C. Andrews. 1998. Topological analysis of DcuA, an anaerobic C4-dicarboxylate transporter of Escherichia coli. J. Bacteriol. 180:4821-4827.[Abstract/Free Full Text]
  42. 20
  43. Hamilton, C. M., M. Aldea, B. K. Washburn, P. Babitzke, and S. R. Kusher. 1989. New method for generating deletions and gene replacements in Escherichia coli. J. Bacteriol. 171:4617-4622.[Abstract/Free Full Text]
  44. 21
  45. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580.[Medline]
  46. 22
  47. Kessler, D., and J. Knappe. 1996. Anaerobic dissimilation of pyruvate, p. 199-205. In F. C. Neidhardt et al. (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C.
  48. 23
  49. Korsa, I., and A. Böck. 1997. Characterization of fhlA mutations resulting in ligand-independent transcriptional activation and ATP hydrolysis. J. Bacteriol. 179:41-45.[Abstract/Free Full Text]
  50. 24
  51. Leonhartsberger, S., A. Ehrenreich, and A. Böck. 2000. Analysis of the domain structure and the DNA binding site of the transcriptional activator FhlA. Eur. J. Biochem. 267:3672-3684.[Medline]
  52. 25
  53. Lutz, S., R. Bohm, A. Beier, and A. Böck. 1990. Characterisation of divergent NtrA-dependent promoters in the anaerobically expressed gene cluster coding for hydrogenase 3 components of Escherichia coli. Mol. Microbiol. 4:13-20.[CrossRef][Medline]
  54. 26
  55. Lutz, S., A. Jacobi, V. Schlensog, R. Bohm, G. Sawers, and A. Böck. 1991. Molecular characterisation of an operon (hyp) necessary for the activity of the three hydrogenase isoenzymes in Escherichia coli. Mol. Microbiol. 5:123-135.[Medline]
  56. 27
  57. Maupin, J. A., and K. T. Shanmugam. 1990. Genetic regulation of formate hydrogenlyase of Escherichia coli: role of the fhlA gene product as a transcriptional activator for a new regulatory gene, fhlB. J. Bacteriol. 172:4798-4806.[Abstract/Free Full Text]
  58. 28
  59. Pecher, A., F. Zinoni, and A Böck. 1985. The seleno-polypeptide of formic dehydrogenase (formate hydrogen-lyase linked) from Escherichia coli: genetic analysis. Arch. Microbiol. 141:359-363.[CrossRef][Medline]
  60. 29
  61. Pecher, A., F. Zinoni, C. Jatisatienr, R. Wirth, H. Hennecke, and A. Böck. 1983. On the redox control of synthesis of anaerobically induced enzymes in enterobacteriaceae. Arch. Microbiol. 136:131-136.[CrossRef][Medline]
  62. 30
  63. Peck, H. D., and H. Gest. 1957. Formic dehydrogenase and the hydrogenlyase enzyme complex in coli-aerogenes bacteria. Biochem. J. 57:10-16.
  64. 31
  65. Prenthi, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis using a selectable DNA fragment. Gene 29:303-313.[CrossRef][Medline]
  66. 32
  67. Rossmann, R., T. Maier, F. Lottspeich, and A. Böck. 1995. Characterisation of a protease from Escherichia coli involved in hydrogenase maturation. Eur. J. Biochem. 227:545-550.[Medline]
  68. 33
  69. Rossmann, R., G. Sawers, and A. Böck. 1991. Mechanism of regulation of the formate-hydrogenlyase pathway by oxygen, nitrate, and pH: definition of the formate regulon. Mol. Microbiol. 5:2807-2814.[CrossRef][Medline]
  70. 34
  71. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. RNase (DNase free). In J. Sambrook, E. F. Fritsch, and T. Maniatis (ed.), Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  72. 35
  73. Sargent, F., N. R. Stanley, B. C. Berks, and T. Palmer. 1999. Sec-independent protein translocation in Escherichia coli: a distinct and pivotal role for the TatB protein. J. Biol. Chem. 274:36073-36082.[Abstract/Free Full Text]
  74. 36
  75. Sauter, M., R. Bohm, and A. Böck. 1992. Mutational analysis of the operon (hyc) determining hydrogenase 3 formation in Escherichia coli. Mol. Microbiol. 6:1523-1532.[Medline]
  76. 37
  77. Sawers, G. 1994. The hydrogenases and formate dehydrogenases of Escherichia coli. Antonie Leeuwenhoek 66:57-88.
  78. 38
  79. Sawers, R. G., S. P. Ballantine, and D. H. Boxer. 1985. Differential expression of hydrogenase isoenzymes in Escherichia coli K-12: evidence for a third isoenzyme. J. Bacteriol. 164:1324-1331.[Abstract/Free Full Text]
  80. 39
  81. Schaller, K.-H., and G. Triebig. 1984. Formate; determination with formate dehydrogenase, p. 668-672. In H.-U. Bergmeyer (ed.), Methods of enzymic analysis, vol. VI. Verlag Chemie, Deerfield Beach, Fla.
  82. 40
  83. Schlensog, V., A. Birkmann, and A. Böck. 1989. Mutations in trans which affect the anaerobic expression of a formate dehydrogenase (fdhF) structural gene. Arch. Microbiol. 152:83-89.[CrossRef][Medline]
  84. 41
  85. Schlensog, V., and A. Böck. 1990. Identification and sequence analysis of the gene encoding the transcriptional activator of the formate hydrogenlyase system of Escherichia coli. Mol. Microbiol. 4:1319-1327.[CrossRef][Medline]
  86. 42
  87. Schlensog, V., S. Lutz, and A. Böck. 1994. Purification and DNA-binding properties of FhlA, the transcriptional activator of the formate hydrogenlyase system from Escherichia coli. J. Biol. Chem. 269:19590-19596.[Abstract/Free Full Text]
  88. 43
  89. Self, W. T., and K. T. Shanmugam. 2000. Isolation and characterization of mutated FhlA proteins which activate transcription of the hyc operon (formate hydrogenlyase) of Escherichia coli in the absence of molybdate(1). FEMS Microbiol. Lett. 184:47-52.[Medline]
  90. 44
  91. Self, W. T., A. Hasona, and K. T. Shanmugam. 2001. N-terminal truncations in the FhlA protein result in formate- and MoeA-independent expression of the hyc (formate hydrogenlyase) operon of Escherichia coli. Microbiology 147:3093-3104.[Abstract/Free Full Text]
  92. 45
  93. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85-96.[CrossRef][Medline]
  94. 46
  95. Stoker, K., W. N. M. Reijnders, L. F. Oltmann, and A. H. Stouthamer. 1989. Initial cloning and sequencing of hydHG, an operon homologous to ntrBC and regulating the labile hydrogenase activity in Escherichia coli K-12. J. Bacteriol. 171:4448-4456.[Abstract/Free Full Text]
  96. 47
  97. Studier, F. W., and B. A. Moffatt. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189:113-130.[CrossRef][Medline]
  98. 48
  99. Suppmann, B., and G. Sawers. 1994. Isolation and characterisation of hypophosphite-resistant mutants of Escherichia coli: identification of the FocA protein, encoded by the pfl operon, as a putative formate transporter. Mol. Microbiol. 11:965-982.[Medline]
  100. 49
  101. Vieira, J., and J. Messing. 1987. Production of single-stranded plasmid DNA. Methods Enzymol. 153:3-34.[Medline]
  102. 50
  103. Vishniac, W., and M. Santer. 1957. The thiobacilli. Bacteriol. Rev. 21:195-209.[Free Full Text]
  104. 51
  105. Wimpenny, J. W. T., and J. A. Cole. 1967. The regulation of metabolism in facultative bacteria. III. The effect of nitrate. Biochim. Biophys. Acta 148:133-242.


Journal of Bacteriology, December 2002, p. 6642-6653, Vol. 184, No. 23
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.23.6642-6653.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Pandey, J., Koyuturk, M., Kim, Y., Szpankowski, W., Subramaniam, S., Grama, A. (2007). Functional annotation of regulatory pathways. Bioinformatics 23: i377-i386 [Abstract] [Full Text]  
  • Coppi, M. V. (2005). The hydrogenases of Geobacter sulfurreducens: a comparative genomic perspective. Microbiology 151: 1239-1254 [Abstract] [Full Text]  
  • Fukiya, S., Mizoguchi, H., Tobe, T., Mori, H. (2004). Extensive Genomic Diversity in Pathogenic Escherichia coli and Shigella Strains Revealed by Comparative Genomic Hybridization Microarray. J. Bacteriol. 186: 3911-3921 [Abstract] [Full Text]  
  • Blokesch, M., Rohrmoser, M., Rode, S., Bock, A. (2004). HybF, a Zinc-Containing Protein Involved in NiFe Hydrogenase Maturation. J. Bacteriol. 186: 2603-2611 [Abstract] [Full Text]  
  • Self, W. T., Hasona, A., Shanmugam, K. T. (2004). Expression and Regulation of a Silent Operon, hyf, Coding for Hydrogenase 4 Isoenzyme in Escherichia coli. J. Bacteriol. 186: 580-587 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Skibinski, D. A. G.
Right arrow Articles by Andrews, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Skibinski, D. A. G.
Right arrow Articles by Andrews, S. C.