Previous Article | Next Article ![]()
Journal of Bacteriology, December 2002, p. 6836-6844, Vol. 184, No. 24
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.24.6836-6844.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
and Susan T. Lovett*
Department of Biology and Rosenstiel Basic Medical Sciences Research Center, Brandeis University, Waltham, Massachusetts 02454-9110
Received 17 June 2002/ Accepted 17 September 2002
|
|
|---|
|
|
|---|
The RadA/Sms predicted protein sequence is a composite of three characteristic regions. It contains a putative zinc finger at its N terminus with a CXXC-Xn-CXXC motif. Its middle region is related to the RecA strand exchange protein and the DnaB replicative DNA helicase (24), containing both Walker A and Walker B boxes characteristic of ATPases. The highly conserved motif among prokaryotic RadA orthologs, KNRFG, is found at the C-terminal edge of this RecA-related region. The C-terminal 150 amino acids of RadA/Sms is related to Lon protease, an ATP-dependent serine protease that binds to DNA (51) and that regulates capsular polysaccharide synthesis and the SOS response (16). The active-site serine is present in E. coli RadA/Sms, but this residue is replaced by alanine in many of the eubacterial radA/sms orthologs. Orthologs of radA/sms carrying all three sequence motifs are ubiquitous among the eubacteria and can be seen in the genomes of at least 40 eubacterial genera to date. The radA gene of archaea, despite its name, is not related to the radA/sms gene of eubacteria, except that both have similarity to recA of prokaryotes and RAD51 of eukaryotes. There is one bona fide eukaryotic radA/sms form in Arabidopsis thaliana, which may have entered the plant genome via the chloroplast of eubacterial origin.
A role for radA/sms in recombination is suggested by the facts that the repair pathways affected by radA are recA dependent (13) and that recombination mutants have concomitant defects in repair of radiation-induced DNA lesions. However, radA/sms does not affect survival as severely as do other mutations that result in defects in double-strand-break repair, such as recA, recB, recC, or recN (40). As determined by conjugational recombination, radA mutants are not appreciably affected in the ability to recombine (13). However, conjugational recombination differs significantly from repair recombination, and several mutations resulting in strong defects in recombinational repair (such as recJ, recN, recFOR, and ruvABC) have only minor effects on conjugational recombination frequencies (reviewed in reference 27). A radA/sms ortholog mutant in Bacillus subtilis has been reported to be defective in transformational inheritance (23).
We examined here the role of radA in DNA damage survival and conjugational recombination. In addition, we constructed double mutants with mutations in both radA and other known recombination function genes to reveal properties of radA that may be redundant to those of other genes. Sensitivity to various types of DNA-damaging agents, such as UV irradiation, MMS, hydrogen peroxide, hydroxyurea (HU), and phleomycin, were assayed. The radA/sms gene does indeed play a role in recombination and DNA repair. Its effects on repair were revealed most strongly in mutants deficient in postsynaptic DNA processing, especially those lacking the RecG branch migration helicase, suggesting that RadA may also play a role in this type of branched-structure processing.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Escherichia coli K-12 strains
|
::FRT allele with a precise deletion of the entire radA coding region was constructed by the method of Datsenko and Wanner (12) with PCR primers 5' CCGCCATCCTGCGGGCGGCACAGCATTAACGAGGTACACCTGTAGGCTGGAGCTGCTTCG and 5' TCAGGTAATCAAATGACGACATATCTCCCTCCGTATATCTCATATGAATATCCTCCTTAG to amplify the kan gene of plasmid pKD4 flanked by FRT site-specific recombination sites and radA-specific sequences. The resultant PCR fragment carried a 40-bp homologous region where the allele was substituted by recombination into the chromosome of strain BW26308, producing STL5821. From this strain, the allele was transduced into AB1157 by using P1, with selection for Kmr (producing strain STL6036); subsequent deletion of the kan gene at the flanking FRT sites was accomplished by transformation with FLP recombinase-encoding plasmid pCP20, selecting for Apr at 30°C. After streaking STL6036 onto LB medium at 42°C to cure the plasmid, deletion strain STL6430 was produced. Genetic crosses with CAG18442 (42) confirmed the appropriate genetic location, and Southern blotting and PCRs confirmed deletion of the radA coding sequence. DNA damage survival assays. For UV survival determinations, cells were grown in LB liquid medium to exponential stage (optical density at 600 nm [OD600], 0.4 to 0.6), serially diluted in 56/2 buffer (50), and plated on LB agar plates. The plates were immediately irradiated with various doses of UV (254 nm) and incubated at 37°C in the dark overnight. The total viable cells in serially diluted unirradiated cells were determined. Resistance to MMS was determined for at least eight independent cultures in 2 ml of LB medium after overnight growth, and resistance to mitomycin C (MMC), phleomycin, and HU was determined for at least eight independent cultures in 2 ml of LB medium after growth to exponential phase (OD600, 0.4 to 0.6). To score for survival of cells to these DNA-damaging agents, the cultures were serially diluted in 56/2 buffer and plated directly onto LB plates containing 0.1% MMS, 1 µg of MMC/ml, 0.5 µg of phleomycin/ml, or 10 mM HU. Chemicals were purchased from Sigma, Inc. Plates containing MMS were used within 48 h. Hydrogen peroxide sensitivity was measured with exponentially growing liquid cultures, with hydrogen peroxide added to cultures to a final concentration of 5 mM. After incubation of shaking cultures at 37°C for 20 min, 50 µg of catalase per ml was added directly to the cultures to inactivate the peroxide. The cultures were serially diluted in 56/2 buffer and plated directly onto LB plates. Total viable cells were determined by serial dilution with 56/2 buffer followed by plating on LB medium. Cell counts were determined on all platesafter overnight growth at 37°C.
Assay for conjugational recombination. All strains were assayed for conjugational inheritance in parallel with the radA+ control strain. Matings were performed using a 10:1 recipient-to-donor ratio, with recipient cells grown to an OD600 of 0.4 and donor cells grown to an OD600 of 0.3. The matings were allowed to proceed for 30 min at 37°C, and then the cultures were shaken vigorously and serially diluted in 56/2 buffer. STL6804 was used as the Hfr donor in recombination proficiency tests. (The radA gene was mutated in the Hfr donor to prevent complementation of radA in the zygote due to early transfer of radA+ in the cross.) The Leu+ Ser+ Smr recombinants were selected on streptomycin-minimal medium plates lacking leucine after serial dilution and plating. As a control for the efficiency of conjugal transfer, the strains were also crossed with STL7130, a similar Hfr donor lysogenic for lambda at attB. Production of zygotically induced infective centers was assayed as previously described (30). Although the data are not reported, none of the strains listed below (see Table 3) had any defects in conjugational transfer of lambda. Viable counts were determined by plating serially diluted unmated cultures on LB plates. All plates were counted after 1 or 2 days of growth at 37°C.
|
View this table: [in a new window] |
TABLE 3. Conjugational inheritance in radA mutantsa
|
|
|
|---|
::FRT, a complete and precise deletion of the entire open reading frame. We tested the survival of these three single mutants to a group of DNA-damaging agents to which recA and other recombination mutants of E. coli K-12 are sensitive.
Unlike the results of a previous report (13), we were unable to demonstrate any consistent defect in survival after UV light exposure for the radA1 single mutant (Fig. 1 and 2), although slight sensitivity was evident in one of the six experiments (Fig. 1A). This is not an allele effect, since we were also unable to demonstrate UV sensitivity for the other radA alleles, radA100 and radA3
(B. Levinson, C. E. Beam, and S. T. Lovett, unpublished results). As reported earlier (39), these mutants did show sensitivity to the methylating agent MMS (Table 2), although their decrease in survival was much less than the more than four orders of magnitude of killing seen for the recA mutant of E. coli at the same MMS concentration. None of the mutants was sensitive to oxidative damage in the presence of hydrogen peroxide, and all showed a weak sensitivity to the cross-linking agent MMC. The presumed null alleles radA1 and radA3, but not the radA100 point mutation, conferred modest sensitivity to phleomycin, a compound related to the antitumor agent bleomycin, that induces strand breaks in DNA (4, 44). Conversely, HU, an inhibitor of deoxynucleotide synthesis, was an effective killer of the radA100 point mutant but had much less effect on the presumed null mutants carrying radA1 or radA3. The last results suggest that the radA100 putative zinc finger mutation has specific and limited effects on RadA function in vivo. The radA single mutants had modest, if any, defects in conjugational inheritance (Table 3), results in agreement with a previously published report (13).
![]() View larger version (24K): [in a new window] |
FIG. 1. Synergy of radA with mutations affecting recombinational UV repair. Shown are UV survival curves for AB1157-derived strains both singly and doubly deficient for radA, recA, recJ, recQ, and recB. (A) AB1157, rec+ ( ); STL5280, radA1::kan (); JC10287, recA ( ); STL4799, recA radA1::kan ( ); (B) AB1157, rec+ ( ); STL5280, radA1::kan (); STL1548, recQ1802::Tn3 ( ); JC12123, recJ284::Tn10 ( ); STL5048, recQ1802::Tn3 radA1::kan ( ); STL5042, recJ284::Tn10 radA1::kan ( ); (C) AB1157, rec+ ( ); STL5280, radA1::kan (); N2101, recB268::Tn10 ( ); STL5480, recB268::Tn10 radA1::kan ( ). Error bars indicate standard errors of the determinations.
|
![]() View larger version (25K): [in a new window] |
FIG. 2. RadA is synergistic with Holliday junction-processing genes in UV repair. UV survival curves are shown for E. coli strains both singly and multiply deficient for radA, recG, ruvA, and ruvC. All strains assayed for UV survival were derived from the AB1157 background. (A) AB1157, rec+ ( ); STL5280, radA1::kan (); N2096, ruvA 63 ( ); CS140, ruvC53 ( ); STL5046, ruvC53 radA1::kan ( ); STL5037, ruvA 63 radA1::kan ( ); (B) AB1157, rec+ ( ); STL5280, radA1::kan (); N4452, recG 265::cat ( ); STL6588, recG 265::cat radA1::kan ( ); (C) AB1157, rec+ ( ); STL5280, radA1::kan (); STL6586, recG 265::cat ruvC53 ( ); STL6640, recG 265::cat radA1::kan ruvC53 ( ); STL6571, recG 265::cat ruvA 63( ); STL6592, recG 265::cat radA1::kan ruvA 63 ( ). Error bars indicate standard errors of the determinations.
|
|
View this table: [in a new window] |
TABLE 2. Relative survival of radA and rec mutant strains to DNA-damaging agentsa
|
With respect to UV survival, the radA mutation exacerbated the UV sensitivity of several mutants, including the recA, recJ, recQ (Fig. 1A and B), recG, ruvA, and possibly ruvC mutants (Fig. 2A and B). The effect was especially great with recG: although neither single mutant showed pronounced survival defects, the double mutant was severely affected. The recG radA ruv triple mutants were as sensitive (Fig. 2C), if not more so, than the recA mutants (Fig. 1A) that are defective in all pathways of homologous recombination and in induction of the SOS response. No effect on the recB mutants was afforded by addition of the radA mutation (Fig. 1C). The RecG, RuvA, and RuvC proteins play a role in the processing of branched recombinational intermediates, such as Holliday junctions, and therefore act at a late step in recombination pathways (42, 49). The RecQ and RecJ proteins in concert may reveal single-strand DNA to initiate recombination (reviewed in reference 21). There is some evidence that these proteins also play a role in processing of replication forks stalled by UV lesions (9). The RecJ exonuclease also has a postsynaptic role in stabilization of joint molecules, both in vitro and in vivo (8, 15)
In other DNA damage survival assays (Table 2), genetic synthetic effects were again strongest between radA and recG, where radA was found to sensitize recG mutants to all agents tested 5- to 500-fold. The sensitivity of the double mutants approached or exceeded the sensitivity of recA mutants that are deficient in homologous recombination and induction of the SOS response. For MMC, phleomycin, and hydrogen peroxide, although both recG and radA single mutants were only modestly sensitive, the recG radA double mutant showed profound defects in survival. This genetic effect is consistent with the idea that recG and radA/sms share some redundant role in DNA damage tolerance or repair.
Mutants in the Holliday junction helicase and resolvase, RuvA and RuvC, were very sensitive to all agents tested. The addition of a mutation in radA exacerbated DNA damage sensitivity of ruvA or ruvC mutants to all agents except the replication inhibitor HU. Strains with mutations in recJ (encoding exonuclease) and recQ (encoding helicase), like those with mutations in radA, were only modestly sensitive to the array of DNA-damaging agents, with the strongest killing effects demonstrated by either MMS or phleomycin. A mutation in radA was found to sensitize recJ and recQ mutants to the killing effect of MMS and recQ and recB mutants to that of phleomycin.
An unexpected but consistent result was the suppression of sensitivity of recA and recB mutants to hydrogen peroxide and to HU by mutations in radA. This contrasts to the slightly enhancing effect of a radA mutation on the extreme sensitivity to UV light (Fig. 1), MMS, MMC, and phleomycin (Table 2) conferred by recA. The suppressive result seems to suggest that functional RadA may convert some kinds of DNA damage, such as that after oxidation or replication inhibition, into a form that is lethal in the absence of RecABCD-dependent repair.
Several different double and triple mutant combinations were tested for effects on conjugational recombination (Table 3). Although conjugational recombination was reduced by approximately 4 orders of magnitude by a mutation in recA, mutations in radA, recG, ruvA, or ruvC reduced recombination no more than about 10-fold. A mutation in radA substantially reduced residual recombination of recG or ruv mutants, and the radA recG ruv triple mutants achieved recombination deficiency comparable to that of recA mutants. Again, this result is consistent with the idea that RadA plays a role in recombination that is redundant to that of the Holliday junction-processing proteins RecG and RuvABC.
|
|
|---|
Recombinational repair processes can, in various ways, alleviate blocks to DNA replication imposed by genotoxic assaults and restore chromosome integrity (for reviews, see references 10, 20, 21, 36). Lesions in DNA, such as those produced by UV light or by the cross-linking agent MMC, can block DNA polymerases during replication, leading to the accumulation of single-strand DNA gaps or double-strand breaks. Other agents can directly or indirectly via processing enzymes cause the accumulation of single-strand nicks or double-strand breaks. Recombination can restore broken chromosomes or broken replication forks in a manner dependent on the double-strand-break-processing helicase/nuclease RecBCD and the strand invasion protein RecA. In contrast, single-strand DNA gaps are filled by a recombinational mechanism involving RecA and the RecFOR proteins (45).
Recombinational reactions involve the formation of branched intermediate structures that are processed by the RecG helicase and by the RuvAB helicase in concert with the Holliday junction endonuclease RuvC. RecG and the Ruv proteins have redundant effects on genetic recombination and DNA repair (25), such that loss of either function causes a modest reduction whereas the loss of both has a severe effect. We show here that RadA/Sms joins this redundant team of processing enzymes; loss of all three functions produces a strain with severe conjugational recombination defects that is comparable to recA strand transferase mutants of E. coli. Since conjugational recombination occurs primarily via the RecBCD-dependent pathway (7, 27), RadA/Sms is implicated in recombination initiated from double-strand ends (Fig. 3).
![]() View larger version (19K): [in a new window] |
FIG. 3. Double-strand-break (DSB)-mediated recombination. A broken fork can be repaired by recombinational reactions. (Likewise, ends of conjugative DNA or transducing fragments can be integrated via this mechanism.) Double-strand ends are resected by RecBCD nuclease; RecBCD also assists in loading of RecA onto single-strand DNA. The RecA-single-strand DNA filament promotes strand invasion into a homologous duplex molecule (the sister chromosome), forming a D-loop intermediate. Branch migration helicases can extend the region of pairing to form a Holliday junction (HJ), which can be resolved by cleavage mediated by Holliday junction endonucleases such as RuvC. Ligation of strand scissions restores an intact recombinant chromosome. RadA may participate in recombination by stabilizing any of these joint intermediates or by mediating branch migration or cleavage.
|
![]() View larger version (26K): [in a new window] |
FIG. 4. Fork regression and repair. Lesions can stall DNA polymerase. Fork regression catalyzed by RecG or RuvAB helicase activity can move the lesion into double-strand DNA, where it can be repaired. 5' to 3' degradation of the lagging strand by RecJ/RecQ may facilitate repair when the lagging strand has moved ahead of the leading strand. The regressed fork forms a Holliday junction, which can be cleaved by RuvC. Double-strand break repair can then restore integrity of the fork. Alternatively, RecBCD degradation of the double-strand arm or reversed branch migration can restore a fork structure.
|
![]() View larger version (33K): [in a new window] |
FIG. 5. Alignment of E. coli RadA/Sms with human Dmc1 showing similarity through the putative Zn finger region. Arrows indicate the conserved cysteines of the Zn finger.
|
The role of the Lon protease domain of RadA is unknown. Although many radA/sms open reading frames are annotated in some genome databases as encoding "probable" or "predicted" ATP-dependent proteases, no protease activity has ever been experimentally demonstrated for RadA/Sms. The active-site serine of the comparable Lon domain is converted to alanine in many of the RadA bacterial forms (although E. coli RadA/Sms does retain the active-site serine), which in our opinion makes its improbable that a Lon-like protease activity contributes to its biological function. Assays detecting Lon protease have failed to demonstrate protease activity of purified RadA protein (A. Long, S. T. Lovett, and L. Hedstom, unpublished results). However, this domain is conserved among the RadA/Sms family, and truncations of this domain fail to complement radA (D. Resnicow and S. T. Lovett, unpublished results). This suggests that the Lon protease domain of RadA/Sms plays an important function, perhaps by protein or nucleic acid interactions similar to those of the Lon protease.
We thank M. Berlyn of the E. coli genetic stock center and A. J. Clark, R. Kolodner, R. G. Lloyd, B. Michel, N. Sargentini, and B. Wanner for providing strains used in this study. We acknowledge D. Resnicow and B. Levinson for their work on the complementation analysis and cloning of radA mutants.
Present address: Chemical Abstracts Services, Columbus, OH 43202-1505. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»