This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Musfeldt, M.
Right arrow Articles by Schönheit, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Musfeldt, M.
Right arrow Articles by Schönheit, P.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 2002, p. 636-644, Vol. 184, No. 3
0021-9193/01/$04.00+0     DOI: 10.1128/JB.184.3.636-644.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Novel Type of ADP-Forming Acetyl Coenzyme A Synthetase in Hyperthermophilic Archaea: Heterologous Expression and Characterization of Isoenzymes from the Sulfate Reducer Archaeoglobus fulgidus and the Methanogen Methanococcus jannaschii

Meike Musfeldt and Peter Schönheit*

Institut für Allgemeine Mikrobiologie, Christian-Albrechts-Universität Kiel, D-24118 Kiel, Germany

Received 17 May 2001/ Accepted 5 November 2001


arrow
ABSTRACT
 
Acetyl coenzyme A (CoA) synthetase (ADP forming) (ACD) represents a novel enzyme of acetate formation and energy conservation (acetyl-CoA + ADP + Pi {rightleftharpoons} acetate + ATP + CoA) in Archaea and eukaryotic protists. The only characterized ACD in archaea, two isoenzymes from the hyperthermophile Pyrococcus furiosus, constitute 145-kDa heterotetramers ({alpha}2, ß2). The coding genes for the {alpha} and ß subunits are located at different sites in the P. furiosus chromosome. Based on significant sequence similarity of the P. furiosus genes, five open reading frames (ORFs) encoding putative ACD were identified in the genome of the hyperthermophilic sulfate-reducing archaeon Archaeoglobus fulgidus and one ORF was identified in the hyperthermophilic methanogen Methanococcus jannaschii. The ORFs constitute fusions of the homologous P. furiosus genes encoding the {alpha} and ß subunits. Two ORFs, AF1211 and AF1938, of A. fulgidus and ORF MJ0590 of M. jannaschii were cloned and functionally overexpressed in Escherichia coli. The purified recombinant proteins were characterized as distinctive isoenzymes of ACD with different substrate specificities. In contrast to the Pyrococcus ACD, the ACDs of Archaeoglobus and Methanococcus constitute homodimers of about 140 kDa composed of two identical 70-kDa subunits, which represent fusions of the homologous P. furiosus {alpha} and ß subunits in an {alpha}ß (AF1211 and MJ0590) or ß{alpha} (AF1938) orientation. The data indicate that A. fulgidus and M. jannaschii contains a novel type of ADP-forming acetyl-CoA synthetase in Archaea, in which the subunit polypeptides and their coding genes are fused.


arrow
INTRODUCTION
 
ADP-forming acetyl coenzyme A (CoA) synthetase (ACD) (acetyl-CoA + ADP + Pi {rightleftharpoons} acetate + ATP + CoA) is a novel enzyme that catalyzes the conversion of acetyl-CoA and other acyl-CoA esters to the corresponding acids and couples this reaction with the synthesis of ATP via the mechanism of substrate level phsophorylation (see reference 22). This unusual synthetase was first detected in the domain Eucarya, in the protists Entamoeba histolytica and Giardia lamblia, where it is involved in acetate formation and ATP production in course of a fermentative metabolism (15, 18). In prokaryotes, acetyl-CoA synthetase was first described in detail in the hyperthermophilic archaeon Pyrococcus furiosus (20), where it represents the major energy-conserving reaction during pyruvate and sugar conversion to acetate (22). Later studies demonstrated the presence of acetyl-CoA synthetase (ADP-forming) in all acetate-forming members of the Archaea tested, including anaerobic hyperthermophiles and mesophilic aerobic halophiles (21, 22). The one-step conversion of acetyl-CoA to acetate coupled to ATP synthesis is unusual in prokaryotes and appears to be restricted to the domain Archaea, since all acetate-forming members of the Bacteria studied so far, including the hyperthermophile Thermotoga maritima, utilize two almost "classical" enzymes, phosphate acetyltransferase and acetate kinase, for acetate formation and ATP synthesis (3, 22).

The only ACD in archaea to be characterized in detail with respect to its biochemical and molecular properties were two isoenzymes from the hyperthermophile P. furiosus (7, 11). Both isoforms constitute heterotetramers ({alpha}2ß2) of 145 kDa composed of two subunits, {alpha} (47 kDa) and ß (25 kDa). The isoenzymes function as acyl-CoA synthetases (ADP forming) which differ in their specificities and kinetic constants toward acetyl-CoA/acetate and various acyl-CoA esters and their corresponding acids. For example, ACD isoform I preferentially uses acetyl-CoA as substrate and apparently constitutes the physiologically relevant enzyme of acetate formation and energy conservation in the course of sugar and pyruvate fermentation (7, 11). ACD isoform II utilizes the aryl-CoA esters phenylacetyl-CoA and indolacetyl-CoA as substrates and has been implicated primarily in the fermentation of aromatic amino acids (1, 11).

Using the N-terminal amino acid sequences of the {alpha} and ß subunit ACD isoform I from P. furiosus, we identified the encoding genes, acdIA and acdIB (acetyl-CoA synthetase [ADP-forming] isoform I) via cloning and functional overexpression in Escherichia coli (13). The acdIA and acdIB genes were located on different sites in the Pyrococcus chromosome; i.e., they are not arranged in an operon.

Sequence comparison of deduced amino acid sequences of the acdIA and acdIB genes revealed similarities to several hypothetical proteins deduced from open reading frames (ORFs) in the genomes of various members of the Archaea, including other Pyrococcus species (P. horikoshii and P. abyssi), the hyperthermophilic sulfate reducer Archaeoglobus fulgidus, the hyperthermophilic methanogen Methanococcus jannaschii, and the bacterium E. coli. All these ORFs and hypothetical proteins apparently represent fusions of the homologous {alpha} and ß subunit-encoding genes and polypeptides of P. furiosus ACD isoform I (13).

In a parallel study, Sanchez et al. (17) reported the sequence of the gene encoding ACD in the eukaryotic protist Giardia lamblia, using the N-terminal amino acid sequences of homologous {alpha} and ß subunits of Pyrococcus ACD. The gene encoding the Giardia enzyme also represents a fusion of both homologous {alpha} and ß subunit-encoding genes of Pyrococcus. By sequence comparison of deduced amino acid sequence of the Giardia ACD, the authors (17) also detected several homologous hypothetical proteins, deduced from undefined ORFs, in the sequenced genomes of the Archaea members A. fulgidus and M. jannaschii and in the bacteria E. coli and Streptomyces coelicolor.

So far, the ORFs in Archaea that show similarity to ACD from Pyrococcus and Giardia have not been analyzed with respect to their coding function. Furthermore, the biochemical properties, including enzymatic activity, of the encoded, putative ACD homologous proteins have not been determined.

In this study we analyzed two ACD homologous ORFs, AF1211 and AF1938, in the hyperthermophilic sulfate-reducing archaeon A. fulgidus (8, 24) and one ORF, MJ0590, in the hyperthermophilic methanogen M. jannaschii (5). The coding functions of the hypothetical ORFs were identified via functional overexpression in E. coli. The recombinant proteins from Archaeoglobus and Methanococcus were purified and characterized as distinct isoforms of ADP-forming acetyl-CoA synthetases. All enzymes represent fusions of the homologous {alpha} and ß subunits of the Pyrococcus ACD. This the first biochemical characterization of a novel type of ACD in Archaea, in which the polypeptides and their encoding genes are fused.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and enzymes. For cloning and expression experiments, the E. coli strains JM 109 (25), BL21-CodonPlus(DE3)-RIL and BL21(DE3) (Novagen, Madison, Wis.) were grown on Luria-Bertani medium under standard conditions. pET-17b and pET-19b protein expression vectors were purchased from Novagen. Plasmid pUBS520 containing the E. coli dnaY gene encoding the tRNAArg for the codons AGA and AGG was kindly provided by W. Hausner (Kiel, Germany). Restriction enzymes, T4 DNA ligase, and other chemicals were from Roche Diagnistics (Mannhein, Germany), Sigma-Aldrich (Deisenhofen, Germany), Roth (Karlsruhe, Germany), Biomol (Hamburg, Germany), and MBI Fermentas (Vilnius, Lithuania). Plasmid preparation and gel purification were performed by using kits from Qiagen (Hilden, Germany) and Peqlab (Erlangen, Germany). DEAE-Sepharose Superdex 200 (16/60) and (26/60) were from Pharmacia Biotech (Freiburg, Germany), and Ni-nitrilotriacetic acid (NTA) agarose was from Qiagen.

Preparation of DNA and RNA. A. fulgidus strains 7324 (DSM 8774) and VC 16 (DSM 4304) were grown strictly anaerobically at 76°C in closed bottles on media by the method of Möller-Zinkhan et al. (12). Late-log-phase cells were cooled to 4°C, harvested by centrifugation at 10,000 x g for 20 min, and subsequently used for PCR and reverse transcriptase PCR (RT-PCR) experiments. DNA and RNA were extracted from 100 mg of wet cells by using the Qiagen genomic-tip kit with 100/G midi-columns as specified by the manufacturer. DNA from M. jannaschii was kindly provided from W. Hausner.

Identification of the putative acd genes. The ORFs encoding putative ACD were identified in a BLAST search (2) performed by the National Center for Biotechnology Information, National Institutes of Health, Bethesda, Md., using the known sequence from the acdAI and acdBI genes from P. furiosus (13) as the query.

Construction of the expression vectors. A. fulgidus ORF AF1211 was inserted into the pET-17b expression vector after PCR amplification of the coding regions. Two restriction sites (underlined) were introduced by PCR using a forward oligonucleotide primer, 5'GGCAATCTCATATGGAGCGCTTGTTTTACC'3, extended by a NdeI restriction site, and a reverse complement oligonucleotide primer, 5'ATGCTCGAGTTACACCTCCTCACCCAAAACCA'3, containing a XhoI site. A. fulgidus ORF AF1938 was inserted into the vector pET-19b using the same restriction sites and primers 5'CACCAGCCCATATGCTACTCCTCGAACACG'3 and 5'GAACTCGAGTCACGACTGAATTCTCCTTTTTGCG'3. M. jannaschii ORF MJ0590 was inserted into pET-17b with NdeI and XhoI by using primers 5'GAGAATTCCATATGTGGGGGAGGGATTATG'3 and 5'CCGCTCGAGTTATTTAATTATTCTTGCATCACC'3. PCR amplification was performed with the Expand High-Fidelity PCR system (Roche Diagnostics) as specified by the manufacturer. The 2,055-bp (AF1211), 2,022-bp (AF1938), and 2,112-bp (MJ0590) PCR products were digested with the restriction enzymes and cloned in the accordingly restricted expression vectors. The recombinant plasmids were named pET-17b(acd-AF1211), pET-19b(acd-AF1938), and pET-17b(acd-MJ0590), respectively. The inserted gene sequences were confirmed on both strands using the dideoxy chain termination method of Sanger et al. (19).

Heterologous expression of the putative acd genes. Expression vector pET-17b(acd-AF1211) was transformed into E. coli BL21(DE3) containing plasmid pUBS520. This plasmid was required for expression due to extra tRNAArg production of the codons AGA and AGG, which are less frequently used by E. coli. Cells were grown at 37°C in 400 ml of Luria-Bertani medium supplemented with ampicillin (100 µg/ml) and kanamycin (30 µg/ml) to an optical density at 600 nm of 0.8, and expression was initiated by the addition of 0.4 mM isopropyl-ß--thiogalactopyranoside (IPTG). After 3 h further growth the cells were harvested by centrifugation at 4°C. The pellet were frozen at -20°C. For the preparation of crude extract, cells were suspended in 10 ml of buffer (100 mM Tris-HCl, 10 mM MgCl2 [pH 8.0]) and passed through a French pressure cell at 150 MPa. Cell debris were removed by centrifugation at 100,000 x g for 1 h at 4°C. The resulting supernatant (S100) was analyzed for ACD activity. Expression vector pET-19b(acd-AF1938) was transformed into E. coli BL21(DE3)/pUBS520. Cells were grown at 37°C in Luria-Bertani medium supplemented with ampicillin (100 µg/ml) and kanamycin (30 µg/ml) to an optical density at 600 nm of 0.8, and expression was initiated by addition of 1 mM IPTG. Further growth was performed at 20°C for 2 h; under these conditions, a maximal yield of soluble protein was obtained. Cell extracts (S100 supernatant [see above]) were analyzed for ACD activity. Expression vector pET-17b(acd-MJ0590) was transformed in E. coli BL21-CodonPlus(DE3)-RIL. Growth of the cells, initiation of expression, and preparation of cells extracts were as described above for expression of pET-17b(acd-AF1211).

Purification of ACD-AF1211. Recombinant enzyme was purified from 5.5 g of frozen transformed E. coli cells, yielding 83 mg of protein of S100 (20 ml in 100 mMTris-HCl [pH 8.0]-10 mM MgCl2). The sample was heated for 30 min at 80°C to precipitate host cell proteins, which were removed by centrifugation (15 min at 13,000 x g). The supernatant (16 ml) was applied to a Macro-Prep DEAE support column (22 by 2.2 cm) (Bio-Rad). Protein was eluted at a flow rate of 2 ml/min with 120 ml of 50 mM piperacine (pH 6.5) at 4°C as well as three linear gradients of 0 to 2 M NaCl: 0 to 0.050 M NaCl (90 ml), 0.050 to 0.200 M NaCl (60 ml), and 0.2 to 2 M NaCl (60 ml). Fractions containing the highest ACD activity (273 ml; 0.250 to 0750 M NaCl) were pooled and concentrated to 2 ml by ultrafiltation (exclusion size, 10 kDa). The concentrated protein was applied to a Superdex 200 Hiload 26/60 gel filtration column equilibrated with 100 mM Tris-HCl (pH 8.0) containing 150 mM NaCl. Protein was eluted at a flow rate of 1 ml/min, and essentially pure enzyme (6 mg) was recovered at 193 ml. On storage at -20°C, enzyme activity remained nearly constant for several months.

Purification of ACD-AF1938. Recombinant enzyme was purified from 4.7 g of frozen transformed E. coli cells, yielding 95 mg of protein of S100 (20 ml) in 100 mM Tris-HCl-10 mM MgCl2 (pH 8.0). The sample was heated for 1 h at 70°C, and the precipitated proteins were removed by centrifugation (15 min at 13,000 x g). The supernatant (16 ml) was applied to a Ni-NTA agarose column (7 by 1 cm), which was equilibrated with 50 ml of 50 mM NaH2PO4 (pH 8.0) containing 300 mM NaCl (buffer A) and washed with 10 ml of 100 mM imidazole in buffer A, and the protein was eluted with 15 ml of 500 mM imidazole in buffer A. Fractions containing the highest activity (66 ml; 500 mM imidazole) were pooled to 1 ml by ultrafiltration (exclusion size, 10 kDa). The concentrated protein was applied to a Superdex 200 HiLoad 16/60 gel filtration column equilibrated with 100 mM Tris-HCl (pH 8.0) containing 150 mM NaCl. Protein was eluted at a flow rate of 1 ml/min, and essentially pure protein (200 µg) was recovered at 65.5 ml. The gel filtation resulted in a loss of activity of about 80%.

Purification of ACD-MJ0590. Recominant enzyme was purified from 4.4 g of frozen cells, yielding 44 mg of S100 (20 ml) in 100 mM Tris-HCl-10 mM MgCl2 (pH 8.0). The sample was heated for 1 h at 70°C and centrifuged for 15 min at 13,000 x g. The supernatant (17 ml) was applied to a DEAE Support column (22 by 2.2 cm), washed with 90 ml of 100 mM Tris-HCl (pH 8.0)-10 mM MgCl2, and eluted with a linear gradient from 0 to 2 M NaCl (60 ml). The protein was found in the flowthrough, but DNA and other proteins bound to the column. The flowthrough was concentrated to 1 ml by ultrafiltration (exclusion size, 20 kDa) and applied to a Superdex 200 HiLoad 16/60 gel filtation under the same conditions as those for the AFACS1938 protein. The protein (1.5 mg) eluted at 69.5 ml (160 kDa) and was more than 90% pure, as shown by a major band at 70 kDa and a faint band at about 62 kDa.

Analytical assays. The purity of the preparations was documented by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 12% polyacrylamide gel stained with Coomassie brilliant blue R250 (10). Protein concentrations were determined by the method of Bradford (4) with bovine serum albumin as the standard.

Enzyme assays and determination of kinetic parameters. The ACD activity (acetyl-CoA + ADP + Pi {rightleftharpoons} acetate + ATP + CoA) of the recombinant enzyme was measured in both directions as described previously (7). Acetyl-CoA formation from acetate was measured as CoA- and acetate-dependent ADP formation from ATP at 55°C by coupling the reaction of the oxidation of NADH via pyruvate kinase and lactate dehydrogenase. Acetate formation from acetyl-CoA was measured at 55°C by monitoring the ADP- and Pi-dependent release of CoA from acetyl-CoA with Ellman’s thiol reagent (23).

pH dependence and substrate specificity. The pH dependence was measured between 4.7 and 9.5 at 55°C in the direction of acetyl-CoA formation using either acetic acid (pH 4.7 to 5.2), piperazine (pH 5.0 to 5.6), morpholineethane sulfonic acid (MES) (pH 5.5 to 6.7), Tris-HCl (pH 7.0 to 8.0), ethanolamine (pH 8.5 to 9.0), or piperazine (pH 9.0 to 9.5) (each 100 mM). The substrate specificity was examined in both directions, either exchanging acetate with propionate, butyrate, isobutyrate, isovalerate, succinate, fumarate, phenylacetate, or indole-3-acetate or exchanging acetyl-CoA with propionyl-CoA, butyryl-CoA, or phenylacetyl-CoA. ATP was exchanged with GTP.

Temperature dependence and thermal stability of AF1211. The temperature dependence of the enzyme activity was measured between 20 and 98°C in 100 mM N-(2-hydroxyethyl)piperazine-N'-(3-propane-sulfonic acid) (EPPS) (pH 8.0) at the appropriate temperature. The activity was measured in the direction of acetate fomation. The thermostability of the purified enzyme (0.85 µg in 100 mM EPPS-10 mM MgCl2 [pH 8.0]) were tested in sealed vials, which were incubated at 70, 80, or 85°C, as indicated. The vials were then cooled on ice for 5 min, and the remaining enzyme activity was tested at 55°C in the direction of acetate formation (see above) and was compared to that of unheated controls.

RT-PCR with starch-grown cells of A. fulgidus strain 7324. Exponentially grown cells (100 mg) were disrupted by freezing by liquid nitrogen and subsequent thawing. RNA was isolated with the RNeasy isolation kit (Qiagen) as specified by the manufacturer. RT-PCR was carried out by the Qiagen oneStep RT-PCR kit. The reverse transcription phase at 45°C for 30 min was followed by a denaturation for 15 min. The PCR amplification consisted of 40 cycles of denaturation at 94°C for 30 s, primer hybridization at 55°C for 45 s, and elongation at 68°C for 1 min, with a terminal elongation time of 10 min at 68°C. For the RT-PCR, primers of 18 to 20 bp directed against the ends of the AF1211, AF1938, and (as a control gene) DNA ligase (AF0623) genes from A. fulgidus were used. The PCR products were confirmed by sequencing.


arrow
RESULTS
 
Identification of ORFs encoding putative ACDs in the hyperthermophilic archaea A. fulgidus and M. jannaschii. In a previous study, the genes acdAI and acdBI, coding for the {alpha} and ß subunits, respectively, of the first characterized archaeal ACD, isoenzyme I (ACD I), from the hyperthermophile P. furiosus, were identified via functional overexpression in E. coli (13). Based on sequence similarity, five ORFs, AF1211, AF1938, AF1511, AF1192, and AF0932, were identified by a BLAST search (2) in the genome of the sulfate reducer A. fulgidus (8), and one ORF (MJ0590) was identified in the genome of methanogen M. jannaschii (5). The deduced amino acid sequence of putative encoded polypeptides showed significant identity to the {alpha} and ß subunits of P. furiosus ACD I, as shown in Fig. 1. It is noteworthy that the {alpha} and ß subunit homologous domains of the putative ACD in A. fulgidus and M. jannaschii are fused and arranged either in {alpha}ß order (AF1211, AF1511, and MJ0590) or in ß{alpha} order (AF1938, AF1192, and AF0932) (Fig. 1). Included in Fig. 1 are sequence similarities of the ACD from G. lamblia (17) and of some selected homologous hypothetical proteins deduced from undefined ORFs, e.g., from, the bacteria E. coli (ORF YFIQ) and S. coelicolor (ORF SC8A6.03C) and the eukaryote Entamoeba histolytica (6).



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 1. Comparison of deduced amino acid sequences of the {alpha} subunit (462 aa) and the ß subunit (232 aa) of ACD I from P. furiosus with ACD II from P. furiosus (457 and 238 aa) (Utah Genome Center Website); ORF AF1211 (685 aa), AF1938 (673 aa), AF1511 (881 aa), AF1192 (664 aa), and AF0932 (666 aa) from A. fulgidus strain VC16 (8); ORF MJ0590 (704 aa) from M. jannaschii (5); ORF YFIQ from E. coli (886 aa) (14); ORF AF107206 from G. lamblia (726 aa) (7); and ORF AF286346 from Entamoeba histolytica (713 aa) (6) (deduced from genome sequences). The {alpha} and ß subunits of P. furiosus ACD I and the homologous domains of the putative proteins are shown in white and shaded boxes, respectively. The amino acid sequence identities of the domains to the {alpha} and ß subunits of P. furiosus ACD I are shown in white and shaded boxes, respectively. Thin lines represent areas without recognized homologies.

In the following, we analyzed two ORFs, AF1211 and AF1938, of A fulgidus, since these ORFs show the highest sequence identity to deduced P. furiosus ACD I. Furthermore, the encoded hypothetical proteins were arranged in two different orientations ({alpha}ß and ß{alpha} order) of the homologous Pyrococcus {alpha} and ß subunits. Then, the only homologous ORF in M. jannaschii, MJ0590 ({alpha}ß order), was analyzed. The coding functions of the ORFs were identified by heterologous overexpression in E. coli. The encoded recombinant proteins were purified and biochemically characterized.

Identification of ACD isoenzymes in A. fulgidus by functional overexpression of ORFs AF1211 and AF1938 in E. coli. ORF AF1211 comprises 2,055 bp coding for a polypeptide of 685 amino acids (aa) with a calculated molecular mass of 74.7 kDa. The coding sequence starts with ATG and stops with TGA. The coding function of the ORF AF1211 the gene was proven by functional overexpression in E. coli. The ORF was amplified by PCR and cloned into the vector pET-17b. The recombinant vector pET-17b(acd-AF1211) was cotransformed with the vector pUBS520 into E. coli BL21(DE3). After induction of the cells with 0.4 mM IPTG, a polypeptide of 70 kDa was overexpressed. No overexpression was observed when cotransformation with pUBS520 was omitted. Cell extracts of transformed E. coli, containing overexpressed 70-kDa protein, catalyzed ADP- and Pi-dependent acetate formation fom acetyl-CoA, defining the protein as ACD. The recombinant ACD was purified about 10-fold, to a specific activity of about 75 U/mg at 55°C at a yield of about 60%, by heat treatment (30 min at 80°C) and chromatography on DEAE-cellulose and Superdex (see Materials and Methods). The purified enzyme was electrophoretically homogenous as judged by the presence of one band in denaturing SDS-PAGE (Fig. 2).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 2. Purified recombinant A. fulgidus ACD isoenzymes, isolated from transformed E. coli, as analyzed by SDS-PAGE. The protein was separated on a 12% polyacrylamide gel and subsequently stained with Coomassie brilliant blue R250 (10). Lanes: 1, molecular mass standard (Sigma); 2, 0.9 µg of purified recombinant ACD-AF1211; 3, 0.9 µg of purified recombinant ACD-AF1938.

Biochemical characterization of recombinant ACD-AF1211. (i) Molecular and catalytic properties. The apparent molecular mass of the native protein was determined by gel filtration on Superdex and was about 140 kDa. SDS-PAGE revealed only one subunit with an apparent molecular mass of 70 kDa, indicating a homodimeric ({alpha}2) structure of the native enzyme. Kinetic constants of the purified recombinant ACD for substrates were determined for both reactions directions (acetyl-CoA + ADP + Pi {rightleftharpoons} acetate + ATP + CoA) from linear Lineweaver-Burk plots; apparent Km values for acetyl-CoA (10 µM) (Fig. 3), ADP (7 µM), and Pi (110 µM) and for acetate (340 µM), ATP (130 µM), and CoA (25 µM) were calculated. The apparent Vmax values at 55°C in the directions of acetate formation and acetyl-CoA formation were about 75 and 65 U/mg, respectively (Table 1). The pH optimum of the enzyme was at pH 7.0. About 50% of the activity was found at pH 6 and 8.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 3. Rate dependence of purified recombinant A. fulgidus ACD-AF1211 activity on the acetyl-CoA concentration at 55°C. The inset shows a double-reciprocal plot of the rate against the corresponding substrate concentration. The assay mixture contained 0.36 µg of enzyme.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Comparison of the molecular and kinetic properties of purified recombinant ACD-AF1211 and ACD-AF1938a

(ii) Temperature optimum and thermostability. The temperature dependency of ADP-ACS activity, measured between 20 and 95°C, showed an optimum at 77°C (Fig. 4A). From the linear part of the Arrhenius plot (Fig. 4B) between 20 and 65°C, an activation energy of 25 kJ/mol was calculated. The enzyme showed high stability to heat inactivation up to 80°C (Fig. 5). It did not lose significant activity at 70°C on incubation to 5 h, and it still showed a half-life of more than 100 min at 80°C. An almost complete loss of activity was observed after 100 min at 85°C.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 4. Effect of temperature on the specific activity of purified recombinant A. fulgidus ACD-AF1211. (A) Temperature dependence of the specific activity; (B) Arrhenius plot of the same data. Enzyme activity was measured in the direction of acetate formation (see Materials and Methods). The assay mixture contained 0.36 µg of enzyme.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 5. Thermostability of purified recombinant A. fulgidus ACD-AF1211. A 0.3-µg portion of enzyme was incubated in 60 µl of EPPS (pH 8.0) at 70°C ({blacksquare}), 80°C (•), or 85°C ({blacktriangleup}). At the times indicated, 25-µl aliquots were withdrawn and assayed for remaining activity at 55°C in the direction of acetate formation. 100% activity corresponded to an ACD-AF1211 specific activity of 60 U/mg.

(iii) Substrate specificities. The specificity of recombinant ACD-AF1211 for different organic acids, acyl-CoA esters, cations, and nucleotides was tested (Tables 1 and 2). Besides acetate (100%), the enzyme accepts propionate, butyrate, and isobutyrate at high rates; fumarate, isovalerate, and succinate (<10%) were less efficient. The aryl acids phenylacetate and indoleacetate were not used at significant rates (each was lower than 5%). In addition to acetyl-CoA (100%), the enzyme accepts propionyl-CoA and butyryl-CoA at similar rates, whereas almost no activity was observed with phenylacetyl-CoA (tested up to 300 µM in the assay) and less than 1% was observed in the presence of 1 mM phenylacetyl-CoA. The almost complete preference of ACD AF1211 for acetyl-CoA over phenylacetyl-CoA is indicated by the calculated apparent Kcat over apparent Km values given in Table 1. Enzyme activity required divalent cations. Mg2+ (100%), which was the most effective, could be partially replaced by Co2+ (51%), Mn2+ (38%), and to a lesser extent (<20%) Fe2+, Zn2+, Ni2+, Ca2+, and Cu2+. GTP was as effective as ATP as a substrate.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Substrate specificity of purified recombinant A. fulgidus isoenzymes ACD-AF1211 and ACD-AF1938a

Heterologous expression of ORF AF1938 and purification of recombinant ACD-AF1938. ORF AF1938 consists of 2,022 bp coding for a protein of 673 aa with a calculated molecular mass of 74.4 kDa. The sequence starts with ATG and stops with TGA. The ORF AF1938 was cloned in vector pET-19b containing an N-terminal His tag, resulting in a protein with additional 23-amino-acid leader sequence (MGHHHHHHHHHHSSGHINNNNLH). The vector pET-19b(acd-AF1938) was cotransformed with pUBS520 into E. coli BL21(DE3). The cells were induced with 1 mM IPTG, and a polypeptide of 70 kDa was overexpressed after incubation for 2 h at 20°C. Under these expression conditions, a maximal yield of soluble protein was obtained; however, most protein was still present as inclusion bodies. Cell extracts of transformed E. coli containing the overexpressed 70-kDa protein showed ACD, which was purified about 25-fold by heat treatment (60 min at 70°C), chromatography on Ni-NTA agarose, and gel filtration on Superdex 200. The gel filtration step resulted in a loss of activity of about 80%. The purified enzyme was electrophoretically homogenous as shown by a single band in denaturing SDS-PAGE.

Biochemical characterization of recombinant ACD-AF1938. (i) Molecular properties. SDS-PAGE of purified ACD-AF1938 revealed only one subunit with an apparent molecular mass of 72 kDa, which was 2 kDa larger than the ACD-AF1211 subunit, due to the presence of the 23 additional amino acids used in the expression system (Fig. 2). Gel filtration of the native enzyme revealed a single peak of about 140 kDa, indicating a homodimeric ({alpha}2) structure of the AF1938-encoded ACD.

(ii) Substrate specificity of ACD-AF1938. ACD-AF1938 catalyzed the reversible conversion of a variety of acids to the correspondings acyl-CoA esters. The specificity of the enzyme for these substrates and some kinetic constants are given in Tables 1 and 2 and compared to those of ACD-AF1211. In contrast to ACD-AF1211, ACD-AF1938 showed the highest activity with the aryl acids, indoleacetate (100%, 2 U/mg at 55°C) and phenylacetate (70%), as compared to acetate (10 to 13%). In the reverse direction, the enzyme showed a high affinity to phenylacetyl-CoA (apparent Km, 17 µM) (Fig. 6) but did not accept acetyl-CoA (tested up to 300 µM) at significant rates. At 1 mM acetyl-CoA, the enzyme activity was still less than 2% of the rate obtained with phenylacetyl-CoA. The almost complete preference of ACD-AF1938 for phenylacetyl-CoA over acetyl-CoA is indicated by the calculated apparent kcat over apparent Km values given in Table 1. ACD-AF1938 activity depends on divalent cations. Mg2+ (100%; 2 U/mg at 55°C), which was most effective, could partially be replaced by Mn2+, Zn2+, and Cu2+ (each 30 to 40%) but not by Co2+, Fe2+, and Ni2+ (each 0%). ATP (100%) was effectively replaced by GTP (70%).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 6. Rate dependence of purified recombinant A. fulgidus ACD-AF1938 activity on the phenylacetyl-CoA concentration at 55°C. The inset shows a double-reciprocal plot of the rate against the corresponding substrate concentration. The assay mixture contained 0.36 µg of enzyme.

In vivo transcription of ORFs AF1211 and AF1938. To test whether ORFs AF1211 and AF1938 are transcribed in vivo, RT-PCR experiments were performed to detect mRNA formation. The experiments were performed with A. fulgidus strain 7324, which forms acetate during growth on starch and peptides (yeast extract). Total RNA was extracted from exponentially grown A. fulgidus 7324 cells, and AF1211- and AF1938-specific RNA was amplified as cDNA by RT-PCR using specific primers. As shown in Fig. 7, AF1211- and AF1938-specific cDNAs of the expected length (2055 and 2022 bp) were detected, indicating in vivo transcription of both ORFs under these growth conditions.



View larger version (91K):
[in this window]
[in a new window]
  		FIG. 7. RT-PCR from cDNA amplified with specific primers to detect the mRNA formation after transcriptions of the gene AF0623 (DNA ligase) and the ORFs AF1211 (coding for ACD I) and AF1938 (coding for ACD II) from A. fulgidus strain 7324. Lanes: 1, marker (Fermentas); 2, AF0623 (control, DNA ligase); l4, AF1211; l6, AF1938; l3, 5, and 7, PCR from total RNA without transciption in cDNA through the RT (negative controls).

The data indicate that A. fulgidus ORFs AF1211 and AF1938 code for ACDs, which were assigned as isoenzymes based on their different substrate specificities. Both ACDs are homodimeric proteins composed of subunits that represent fusions of the homologous Pyrococcus {alpha} and ß subunits.

Identification of ACD in M. jannaschii by functional overexpression of ORF MJ0590 in E. coli. (i) Heterologous expression of ORF MJ0590. ORF MJ0590 comprises 2,112 bp coding for a polypeptide of 704 aa with a calculated molecular mass of 78.2 kDa. The coding sequence starts with ATG and stops with TGA. The ORF was amplified by PCR and cloned into the vector pET-17b. The recombinant vector pET-17b(acd-MJ0590) was transformed into E. coli BL21(DE3)CodonPlus-RIL. After induction of the cells with 0.4 mM IPTG, a polypeptide of 74 kDa was overexpressed, showing ACD activity.

(ii) Purification and characterization of ACD-MJ0590. The recombinant ACD-MJ0590 was purified from transformed E. coli by heat treatment and by chromatography on DEAE-cellulose and Superdex. The enzyme was more than 95% pure as judged by Coomassie blue staining of SDS-PAGE gels, which showed a major band at 74 kDa and a very faint band at 62 kDa (Fig. 8). The apparent molecular mass of the native enzyme, as determined by gel filtration on Superdex 200 was 160 kDa, indicating a homodimeric structure of the enzyme. The protein catalyzed ADP- and Pi-dependent formation of acetate from acetyl-CoA at a rate of 3 to 6 U/mg (at 55°C). The apparent Km values for ADP, Pi, and acetyl-CoA, calculated from linear Lineweaver-Burk plots, were 15, 470, and 37 µM, respectively. The enzyme was specific for acetyl-CoA (100%) and butyryl-CoA (120%) but did not take phenylacetyl-CoA (0%). In this respect, the ACD-MJ0590 is similar to ACD-AF1211 from A. fulgidus. In contrast to the A. fulgidus enzyme, a significant rate of the reverse reaction direction, i.e., the ATP- and CoA-dependent conversion of acetate (or other acids) to the corresponding CoA esters, could not be demonstrated.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 8. Purified recombinant M. jannaschii ACD-MJ0590, isolated from transformed E. coli cells, as analyzed by SDS-PAGE. The protein was separated on a 12% polyacrylamide gel and subsequently stained with Coomassie brilliant blue R250 (10). Lanes: 1, molecular mass standard (Sigma); 2, 1.6 µg of purified recombinant ACD-MJ0590.

The data indicate that the M. jannaschii ORF MJ0590 codes for a homodimeric ACD in which the subunit is a fusion of the homologous {alpha} and ß subunits of P. furiosus.


arrow
DISCUSSION
 
In the present study we analyzed the coding function of three unknown ORFs in the archaea A. fulgidus (AF1211 and AF1938) and M. jannaschii (MJ0590), which were identified by sequence similarity to the genes coding for ACD in the hyperthermophilic archaeon P. furiosus. Via overexpression in E. coli, it was shown that the ORFs function as genes coding for isoenzymes of ACD. This is the first report on the identification and characterization of this unusual synthetase, ACD, in sulfate-reducing and methanogenic members of the Archaea.

Biochemical characterization of the recombinant enzymes indicates a novel type of ACD in archaea, which differ from ACD isoenzymes (ACD I and ACD II [Fig. 1]) of the hyperthermophilic archaeon P. furiosus. The Pyrococcus isoenzymes are heterotetrameric {alpha}2ß2 proteins of 140 kDa, composed of two different subunits, {alpha} (25 kDa) and ß (47 kDa); the encoding genes are located on different sites of the P. furiosus chromosome, i.e., are not arranged in an operon structure. In contrast, the ACD isoenzymes from A. fulgidus and M. jannaschii are homodimeric enzymes composed of a single type of subunits of about 70 kDa. The subunits represent fusions of the homologous {alpha} and ß subunits of P. furiosus; accordingly, the genes coding for the A. fulgidus and M. jannaschii ACDs are fused, containing both {alpha} and ß coding homologous domains. The homologous subunits of ACD isoenzymes in A. fulgidus and M. jannaschii are fused in either an {alpha}ß order (AF1211 and MJ0590) or a ß{alpha} order (AF1938). Thus, ACD activity does not require a specific order of the subunit arrangements. A similar type of ACD, composed of fusions of homologous {alpha} and ß subunits of P. furiosus, has been described for the eukaryotic protist G. lamblia (16, 17) (Fig. 1).

Based on the differences of substrate specificity and kinetic constants toward various CoA esters and corresponding acids, the AF1211- and AF1938-encoded ACDs of A. fulgidus can be considered isoenzymes, ACD I and ACD II, respectively, by analogy to isoenzymes I and II of ACD in P furiosus. For example, ACD-AF1211 (ACD I) utilizes almost exclusively acetyl-CoA over phenylacetyl-CoA and thus is similar to ACD I from P. furiosus, which has been primarily implicated in acetate formation (1, 11). Conversely, ACD-AF1938 (ACD II) preferentially uses phenylacetyl-CoA over acetyl-CoA and thus is similar to P. furiosus ACD II, which has been preferentially implicated in aromatic amino acid degradation (1, 11). Finally, both Archaeoglobus ACD isoenzymes I and II convert branched-chain acids, such as isobutyrate and isovalerate, at similar rates (Table 2), which is also true for Pyrococcus ACD isoenzymes I and II that have been implicated in the degradation of branched-chain amino acid degradation (1, 11).

By analogy to P. furiosus (11), we propose a scheme (Fig. 9) for the possible functions of A. fulgidus ACD isoenzymes, ACD I (ACD-AF1211) and ACD II (ACD-AF1938) in sugar and peptide fermentation (11). Accordingly, ACD I, which has high affinity for acetyl-CoA and does not take phenylacetyl-CoA, is involved primarily in acetyl-CoA conversion to acetate as part of the starch and peptide fermentation via pyruvate. Acetate formation has been demonstrated for the growth of A. fulgidus strain 7324 on starch and peptides (yeast extract) (A. Labes and P. Schönheit, unpublished data), and RT-PCR experiments described in this paper indicated in vivo transcription of ORF AF1211 under these conditions. The formation of acetyl-CoA for pruvate is catalyzed by pyruvate:ferredoxin oxidoreductase. The encoding gene is present in the A. fulgidus genome, and the enzyme has been purified (9). Second, ACD II, which has a high affinity for phenylacetyl-CoA (aryl-CoA ester) is implicated primarily in the degradation of aryl-CoA esters to the corresponding acids, as part of the degradation of aromatic amino acids via aromatic 2-keto acids. Finally, both ACD I and ACD II participate in the degradation of branched-chain amino acids via branched-chain acyl-CoA esters (Fig. 9). It should be noted that the A. fulgidus genome contains P. furiosus homologous genes coding for enyzmes catalyzing the formation of aryl-CoA esters, such as indolepyruvate:ferredoxin oxidoreductase and the formation of branched-chain acyl-CoA esters, such as 2-ketoisovalerate:ferredoxin oxidoreductase (11).



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 9. Proposed physiological role of the A. fulgidus ACD isoenzymes ACD-AF1211 (ACD I) and ACD-AF1938 (ACD II) in the sugar and peptide metabolism, by analogy to the P. furiosus ACD isoenzymes I and II (11). TA, transaminase; POR, pyruvate:ferredoxin oxidoreductase; VOR, 2-ketoisovalerate:ferredoxin oxidoreductase, IOR, indolepyruvate:ferredoxin oxidoreductase.

Recently, Sanchez et al. (16) performed a detailed comparison of amino acid sequences of Pyrococcus and Giardia ACDs with a large number number of hypothetical proteins in the database, including Archaeoglobus and Methanococcus proteins, and also proteins with proved enzymatic function, such as succinyl-CoA synthetases, maloyl-CoA synthetase, pimeloyl-CoA synthetases, and ATP-citrate lyase, in various eubacteria and eukaryotes. By sequence alignments, the authors reported a large number of putative signature patterns and suggested that the ACDs of Pyrococcus and Giardia were members of a protein superfamily of acyl-CoA synthetases (nucleoside diphosphate-forming enzymes). Sanchez et al. (16) also proposed a phylogenetic relationship between different ACDs, which was, however, based only on sequence similarity of hypothetical proteins, with the exception of characterized ACDs from Pyrococcus and Giardia. Since sequence similarity of proteins does not necessarily indicate the same catalytic function, the biochemical characterization of hypothetical proteins is a prerequisite for phylogenetic studies. Therefore, the characterization of hypothetical proteins in the archaea A. fulgidus and M. jannaschii as functional ACD isoenzymes in this study significantly strengthen the proposed phylogenetic relationship of ACDs.

Interestingly, all characterized ACDs of Archaeoglobus, Methanococcus, Giardia, and Entamoeba spp. and the putative ACDs of Escherichia and Streptomyces spp. (Fig 1), which showed a high degree of sequence identity to the Pyrococcus ACD I, represent fusions of the homologous Pyrococcus {alpha} and ß subunits. This is also true for all putative members of the proposed ACD superfamily, with the exception of the succinyl-CoA synthetase (16). Thus, the separate arrangement of subunits and encoding genes of the Pyrococcus enzymes, which were the first ACDs to be characterized in detail, appears to be the exception.

At present it is not known whether the separate organization of genes and polypeptides in the Pyrococcus ACD is due to gene splitting from a fused ACD or, alternatively, whether the ACDs with fused polypeptides and genes are the result of a fusion event of an ancestral ACD with separate genes and polypeptides.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grants from the European Union and the Fonds der Chemischen Industrie.

Some kinetic constants were measured by Thomas Hansen. Some experiments concerning cloning and expression of ORF AF1938 and purification of the recombinant protein were performed by Bente Rudolph during an advanced student course.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institut für Allgemeine Mikrobiologie, Christian-Albrechts-Universität Kiel, Am Botanischen Garten 1-9, D-24118 Kiel, Germany. Phone: 49-431-880-4328. Fax: 49-431-880-2194. Email: peter.schoenheit{at}ifam.uni-kiel.de. Back


arrow
REFERENCES
 
    1
  1. Adams, M. W., J. F. Holden, A. L. Menon, G. J. Schut, A. M. Grunden, C. Hou, A. M. Hutchins, F. E. Jenney, C. Kim, K. Ma, G. Pan, R. Roy, R. Sapra, S. V. Story, and M. F. Verhagen. 2001. Key role for sulfur in peptide metabolism and in regulation of three hydrogenases in the hyperthermophilic archaeon Pyrococcus furiosus. J. Bacteriol. 183:716–724.[Abstract/Free Full Text]
    2. 2
  2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403–410.[CrossRef][Medline]
    3. 3
  3. Bock, A.-K., J. Glasemacher, R. Schmidt, and P. Schönheit. 1999. Purification and characterization of two extremely thermostable enzymes, phosphate acetyltransferase and acetate kinase, from the hyperthermophilic eubacterium Thermotoga maritima. J. Bacteriol. 181:1861–1867.[Abstract/Free Full Text]
    4. 4
  4. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248–254.[CrossRef][Medline]
    5. 5
  5. Bult, C. J., O. White, G. J. Olsen, L. Zhou, R. D. Fleischmann, G. G. Sutton, J. A. Blake, L. M. Fitzgerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage, B. A. Dougherty, J. F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F. Kirkness, K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. M. Geoghagen, and J. C. Venter. 1996. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science 273:1058–1073.[Abstract]
    6. 6
  6. Field, J., B. Rosenthal, and J. Samuelson. 2000. Early lateral transfer of genes encoding malic enzyme, acetyl-CoA synthetase and alcohol dehydrogenases from anaerobic prokaryotes to Entamoeba histolytica. Mol. Microbiol. 38:446–455.[CrossRef][Medline]
    7. 7
  7. Glasemacher, J., A.-K. Bock, R. Schmid, and P. Schönheit. 1997. Purification and properties of acetyl-CoA synthetase (ADP-forming), an archaeal enzyme of acetate formation and ATP synthesis, from the hyperthermophile Pyrococcus furiosus. Eur. J. Biochem. 244:561–567.[Medline]
    8. 8
  8. Klenk, H. P., R. A. Clayton, J. F. Tomb, O. White, K. E. Nelson, K. A. Ketchum, R. J. Dodson, M. Gwinn, E. K. Hickey, J. D. Peterson, D. L. Richardson, A. R. Kerlavage, D. E. Graham, N. C. Kyrpides, R. D. Fleischmann, J. Quackenbush, N. H. Lee, G. G. Sutton, S. Gill, E. F. Kirkness, B. A. Dougherty, K. McKenney, M. D. Adams, B. Loftus, and J. C. Venter. 1997. The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus. Nature 390:364–370.[CrossRef][Medline]
    9. 9
  9. Kunow, J., D. Linder, and R. K. Thauer. 1995. Pyruvate:ferredoxin oxidoreductase from the sulfate reducing Archaeoglobus fulgidus: molecular composition, catalytical properties, and sequence alignments. Arch. Microbiol. 163:21–28.[Medline]
    10. 10
  10. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685.[CrossRef][Medline]
    11. 11
  11. Mai, X., and M. W. W. Adams. 1996. Purification and characterization of two reversible and ADP-dependent acetyl coenzyme A synthetases from the hyperthermophilic archaeon Pyrococcus furiosus. J. Bacteriol. 178:5897–5903.[Abstract/Free Full Text]
    12. 12
  12. Möller-Zinkhan, D., G. Börner, and R. K. Thauer. 1989. Function of methanofuran, tetrahydromethanopterin, and coenzyme F420 in Archaeoglobus fulgidus. Arch. Microbiol. 152:362–368.[CrossRef]
    13. 13
  13. Musfeldt, M., M. Selig, and P. Schönheit. 1999. Acetyl coenzyme A synthetase (ADP forming) from the hyperthermophilic archaeon Pyrococcus furiosus: identification, cloning, separate expression of the encoding genes, acdAI and acdBI, in Escherichia coli, and in vitro reconstitution of the active heterotetrameric enzyme from its recombinant subunits. J. Bacteriol. 181:5885–5888.[Abstract/Free Full Text]
    14. 14
  14. Perna, N. T., G. Plunkett, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529–533.[CrossRef][Medline]
    15. 15
  15. Reeves, R. E., L. G. Warren, B. Susskind, and H. S. Lo. 1977. An energy-conserving pyruvate-to-acetate pathway in Entamoeba histolytica. Pyruvate synthase and a new acetate thiokinase. J. Biol. Chem. 252:726–731.[Abstract/Free Full Text]
    16. 16
  16. Sanchez, L. B., M. Y. Galperin, and M. Müller. 2000. Acetyl-CoA synthetase from the amitochondriate eukaryote Giardia lamblia belongs to the newly recognized superfamily of acyl-CoA synthetases (nucleoside diphosphate-forming). J. Biol. Chem. 275:5794–5803.[Abstract/Free Full Text]
    17. 17
  17. Sanchez, L. B., H. G. Morrison, M. L. Sogin, and M. Müller. 1999. Cloning and sequencing of an acetyl-CoA synthetase (ADP-forming) gene from the amitochondriate protist, Giardia lamblia. Gene 233:225–231.[CrossRef][Medline]
    18. 18
  18. Sanchez, L. B., and M. Müller. 1996. Purification and characterization of the acetate forming enzyme, acetyl-CoA synthetase (ADP-forming) from the amitochondriate protist, Giardia lamblia. FEBS Lett. 378:240–244.[CrossRef][Medline]
    19. 19
  19. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.[Abstract/Free Full Text]
    20. 20
  20. Schäfer, T., and P. Schönheit. 1991. Pyruvate metabolism of the hyperthermophilic archaebacterium Pyrococcus furiosus. Acetate formation from acetyl-CoA and ATP synthesis are catalysed by an acetyl-CoA synthetase (ADP-forming). Arch. Microbiol. 155:366–377.
    21. 21
  21. Schäfer, T., M. Selig, and P. Schönheit. 1993. Acetyl-CoA synthethase (ADP-forming) in archaea, a novel enzyme involved in acetate and ATP synthesis. Arch. Microbiol. 159:72–83.[CrossRef]
    22. 22
  22. Schönheit, P., and T. Schäfer. 1995. Metabolism of hyperthermophiles. World J. Microbiol. Biotechnol. 11:26–57.
    23. 23
  23. Srere, P. A., H. Brazil, and L. Gonen. 1963. The citrate condensing enzyme of pigeon breast muscle and moth flight muscle. Acta Chem. Scand. 17:129–134.
    24. 24
  24. Stetter, K. O., G. Lauerer, M. Thomm, and A. Neuner. 1987. Isolation of extremely thermophilic sulfate reducers: evidence for a novel branch of archaebacteria. Science 236:822–824.[Abstract/Free Full Text]
    25. 25
  25. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103–119.[CrossRef][Medline]

Journal of Bacteriology, February 2002, p. 636-644, Vol. 184, No. 3
0021-9193/01/$04.00+0     DOI: 10.1128/JB.184.3.636-644.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Brasen, C., Schmidt, M., Grotzinger, J., Schonheit, P. (2008). Reaction Mechanism and Structural Model of ADP-forming Acetyl-CoA Synthetase from the Hyperthermophilic Archaeon Pyrococcus furiosus: EVIDENCE FOR A SECOND ACTIVE SITE HISTIDINE RESIDUE. J. Biol. Chem. 283: 15409-15418 [Abstract] [Full Text]  
  • Labes, A., Schonheit, P. (2007). Unusual Starch Degradation Pathway via Cyclodextrins in the Hyperthermophilic Sulfate-Reducing Archaeon Archaeoglobus fulgidus Strain 7324. J. Bacteriol. 189: 8901-8913 [Abstract] [Full Text]  
  • Shikata, K., Fukui, T., Atomi, H., Imanaka, T. (2007). A Novel ADP-forming Succinyl-CoA Synthetase in Thermococcus kodakaraensis Structurally Related to the Archaeal Nucleoside Diphosphate-forming Acetyl-CoA Synthetases. J. Biol. Chem. 282: 26963-26970 [Abstract] [Full Text]  
  • McInerney, M. J., Rohlin, L., Mouttaki, H., Kim, U., Krupp, R. S., Rios-Hernandez, L., Sieber, J., Struchtemeyer, C. G., Bhattacharyya, A., Campbell, J. W., Gunsalus, R. P. (2007). The genome of Syntrophus aciditrophicus: Life at the thermodynamic limit of microbial growth. Proc. Natl. Acad. Sci. USA 104: 7600-7605 [Abstract] [Full Text]  
  • Hendrickson, E. L., Kaul, R., Zhou, Y., Bovee, D., Chapman, P., Chung, J., Conway de Macario, E., Dodsworth, J. A., Gillett, W., Graham, D. E., Hackett, M., Haydock, A. K., Kang, A., Land, M. L., Levy, R., Lie, T. J., Major, T. A., Moore, B. C., Porat, I., Palmeiri, A., Rouse, G., Saenphimmachak, C., Soll, D., Van Dien, S., Wang, T., Whitman, W. B., Xia, Q., Zhang, Y., Larimer, F. W., Olson, M. V., Leigh, J. A. (2004). Complete Genome Sequence of the Genetically Tractable Hydrogenotrophic Methanogen Methanococcus maripaludis. J. Bacteriol. 186: 6956-6969 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Musfeldt, M.
Right arrow Articles by Schönheit, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Musfeldt, M.
Right arrow Articles by Schönheit, P.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»