This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fontaine, L.
Right arrow Articles by Soucaille, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fontaine, L.
Right arrow Articles by Soucaille, P.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 2002, p. 821-830, Vol. 184, No. 3
0021-9193/01/$04.00+0     DOI: 10.1128/JB.184.3.821-830.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Molecular Characterization and Transcriptional Analysis of adhE2, the Gene Encoding the NADH-Dependent Aldehyde/Alcohol Dehydrogenase Responsible for Butanol Production in Alcohologenic Cultures of Clostridium acetobutylicum ATCC 824

Lisa Fontaine,1 Isabelle Meynial-Salles,1,{dagger} Laurence Girbal,1 Xinghong Yang,1 Christian Croux,1 and Philippe Soucaille1,2*

Centre de Bioingénierie Gilbert Durand, Laboratoire de Biotechnologies-Bioprocédés, UMR CNRS 5504, UR INRA 792, INSA, 31077 Toulouse cedex 4, France,1 Genencor International Inc., Palo Alto, California 943042

Received 10 April 2001/ Accepted 4 November 2001


arrow
ABSTRACT
 
The adhE2 gene of Clostridium acetobutylicum ATCC 824, coding for an aldehyde/alcohol dehydrogenase (AADH), was characterized from molecular and biochemical points of view. The 2,577-bp adhE2 codes for a 94.4-kDa protein. adhE2 is expressed, as a monocistronic operon, in alcohologenic cultures and not in solventogenic cultures. Primer extension analysis identified two transcriptional start sites 160 and 215 bp upstream of the adhE2 start codon. The expression of adhE2 from a plasmid in the DG1 mutant of C. acetobutylicum, a mutant cured of the pSOL1 megaplasmid, restored butanol production and provided elevated activities of NADH-dependent butyraldehyde and butanol dehydrogenases. The recombinant AdhE2 protein expressed in E. coli as a Strep-tag fusion protein and purified to homogeneity also demonstrated NADH-dependent butyraldehyde and butanol dehydrogenase activities. This is the second AADH identified in C. acetobutylicum ATCC 824, and to our knowledge this is the first example of a bacterium with two AADHs. It is noteworthy that the two corresponding genes, adhE and adhE2, are carried by the pSOL1 megaplasmid of C. acetobutylicum ATCC 824.


arrow
INTRODUCTION
 
Clostridium acetobutylicum is a gram-positive spore-forming anaerobic bacterium capable of converting different sugars and polysaccharides to organic acids (acetate and butyrate) and solvents (acetone, butanol, and ethanol). Acetone is produced from acetoacetyl coenzyme A (acetoacetyl-CoA) in a two-step process that involves a CoA transferase and an acetoacetate decarboxylase. The CoA transferase consists of two different subunits encoded by the ctfA and ctfB genes, which are part of the sol operon (13). The acetoacetate decarboxylase gene (adc), adjacent but not part of the sol operon, is transcribed in the opposite direction from its own promoter. Both the sol operon and the adc gene are located on the pSOL1 megaplasmid (9). Ethanol and butanol are produced from acetyl-CoA and butyryl-CoA, respectively, in two reductive steps catalyzed by aldehyde dehydrogenases and alcohol dehydrogenases (ADHs). The aad gene of C. acetobutylicum ATCC 824 (referred to as adhE in strain DSM 792) is part of the sol operon, and it encodes a bifunctional aldehyde/alcohol dehydrogenase (AADH) (13, 29). This enzyme is mainly involved in butanol formation. Two NADH-dependent butanol dehydrogenases (BDH) (BDH I and BDH II) have been purified, and their genes (bdhA and bdhB) have been cloned (43). These genes are adjacent on the chromosome but are each transcribed by their own promoters.

In continuous culture, C. acetobutylicum can be maintained in three different stable metabolic states (15): acidogenic (production of acetic and butyric acids) when grown at neutral pH on glucose, solventogenic (production of acetone, butanol, and ethanol) when grown at low pH on glucose, and alcohologenic (formation of butanol and ethanol but not acetone) when grown at neutral pH under conditions of high NAD(P)H availability. When solventogenesis is induced by lowering the pH of a continuous culture, transcription of the ctfA, ctfB, aad (all from the sol operon [13]), adc, bdhA, and bdhB genes was reported (12). In steady-state solventogenic cultures, bdhA transcripts are absent and aad and bdhB transcription is associated with NADPH-dependent BDH and butyraldehyde dehydrogenase (BYDH) enzymes (15). Transcription initiation of the genes coding for the acetone pathway (ctfA, ctfB, and adc) was observed 3 to 4 h before acetone could be detected in the supernatant and was associated in steady-state cultures with high levels of CoA transferase and acetoacetate decarboxylase. The transcription of the aad, ctfA, ctfB, and adc genes was recently shown to be regulated by a common repressor protein, SolR, its gene (solR) being located upstream of the aad gene (31). In alcohologenic cultures induced by the addition of methyl viologen, the genes involved in the butanol formation (bdhA, bdhB, and adhE) were, surprisingly, not transcribed, and the existence of another set of genes, not yet identified, involved in butanol formation has been suggested (12, 37). This supports previous reports of enzyme activities obtained in alcohologenic cultures, which showed that butanol production was related to the induction of an NADH-dependent BYDH and to a higher level of an NADH-dependent BDH (42).

During sequencing of the C. acetobutylicum genome, a gene, adhE2, with homology to adhE and potentially encoding a second AADH, was identified on the pSOL1 megaplasmid. We will demonstrate here that this gene is specifically expressed in alcohologenic cultures, that its expression in the DG1 mutant cured of the pSOL1 megaplasmid restores butanol production, and that AdhE2 is an NADH-dependent bifunctional AADH.


arrow
MATERIALS AND METHODS
 
Bacterial strains and plasmids. All bacterial strains and plasmids used or derived from this study are listed in Table 1.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids used in this study

Growth conditions and maintenance. Except for overexpression of the Strep-tag II-AdhE2 fusion protein, Escherichia coli strains were grown aerobically at 37°C in Luria-Bertani medium supplemented, when necessary, with ampicillin at a final concentration of 100 µg/ml or with erythromycin at a final concentration of 200 µg/ml. Both recombinant and wild-type strains were stored at -80°C in 20% (vol/vol) glycerol. For the Strep-tag II-AdhE2 overexpression, E. coli(pTSE) was grown anaerobically on 2YTG (16 g of Bacto Tryptone/liter, 10 g of yeast extract/liter, 4 g of NaCl/liter, 5 g of glucose/liter) supplemented with 3 mg of nickel chloride/liter, 60 mg of zinc chloride/liter, 200 mg of nitriloacetic acid/liter, and 80 µg of clarithromycin/ml at pH 7.

All C. acetobutylicum strains were grown anaerobically in a synthetic medium as previously described (42). For both maintenance of C. acetobutylicum DG1 recombinant strains and preculture of fermentors, the synthetic medium supplemented with 2 g of calcium carbonate/liter, 4 g of yeast extract/liter, a mixed solution of 3 mg of nickel II chloride/liter, 60 mg of zinc chloride/liter, 200 mg of nitriloacetic acid/liter, and 40 µg of clarithromycin/ml was used. C. acetobutylicum ATCC 824 was stored in spore form at -20°C while DG1 and all of its recombinant derivatives were stored at -80°C in 20% (vol/vol) glycerol.

Chemostat cultures. Continuous cultures for total RNA extraction were grown in phosphate-limited synthetic medium containing (per liter) 1 g of KH2PO4, 0.65 g of KCl, 0.2 g of MgSO4·7H2O, 0.02 g of FeSO4·7H2O, 1.5 g of NH4Cl, 8 mg of para-aminobenzoic acid, 0.04 mg of biotin, and 0.1 g of Struktol J633 antifoam, with either glucose (30 g) or glycerol (15 g) plus glucose (15 g) and 0.1 g of CoCl2·H2O when glycerol was present. H2SO4 (1 ml) was added before FeSO4·7H2O in order to acidify the medium and avoid Fe3+ oxidation. C. acetobutylicum ATCC 824 culture was grown in a 0.4-liter bioreactor stirred at 150 rpm with a temperature maintained at 35°C. The pH of the medium was automatically maintained at 6.5 or 4.4 by the addition of 6 N NH4OH. The dilution rate applied to the culture was 0.05 h-1. The anaerobic condition, culture media, and inoculation of the bioreactors were as previously described (42).

Fermentation experiments. Batch experiments with the recombinant strains C. acetobutylicum DG1(pIMP1) and DG1(pE5{alpha}) were performed in a 2-liter fermentor (Setric, Toulouse, France) with a culture volume of 1.3 liter (clostridium synthetic growth medium with a glucose concentration of 60 g/liter) (38, 39). The medium was supplemented with yeast extract, nickel, zinc, nitriloacetic acid, and clarithromycin as indicated in "Growth conditions and maintenance" above. After sterilization, the hot medium was sparged with nitrogen until it cooled down to room temperature and was maintained under nitrogen pressure until its inoculation. The reactor was inoculated with 130 ml of the preculture prepared as described in "Growth conditions and maintenance."

The pH of the culture was regulated at 6 by automatic addition of a 6 N NH4OH solution, the redox potential was continuously recorded, the temperature was maintained at 37°C, and the agitation rate was 300 rpm. Growth was monitored through measurements of optical density at 620 nm (OD620) with a Hitachi (Tokyo, Japan) spectrophotometer (U1100).

DNA isolation and manipulation. Total genomic DNA from C. acetobutylicum ATCC 824 was isolated as previously described (27). Plasmid DNA was extracted from E. coli with the QIAprep kit (Qiagen, Courtaboeuf, France). DNA restriction and cloning were performed according to standard procedures (36). Restriction enzymes and T4 DNA ligase were obtained from New England BioLabs (Beverly, Mass.) and GIBCO/BRL (Life Technologies, Cergy Pontoise, France), respectively, and used according to the manufacturer’s instructions. DNA fragments were purified from agarose gels with the QIAquick gel purification kit (Qiagen).

PCR amplifications were performed in a reaction mixture including 200 µM deoxynucleoside triphosphate, 1.0 µM primers, 1 to 10 ng of template DNA, 1.5 mM MgCl2, and 2 U of Taq polymerase in the 1x manufacturer buffer (Sigma-Aldrich chimie, Saint Quentin Fallavier, France). A total of 25 cycles were run in a DNA thermal cycler model 2400 (Perkin-Elmer Cetus, Norwalk, Conn.); each cycle consisted of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and elongation at 72°C for 1 min. Long PCR amplifications were performed with the Expand Long Template PCR system (Roche Molecular Biochemicals, Meylan, France) as described by the manufacturer. Oligonucleotide synthesis was performed by Isoprim (Toulouse, France).

Plasmids and genetic construction. Cloning of the adhE2 gene was performed by PCR amplification with the Expand Long Template PCR system on genomic DNA. A pair of primers was used which introduced the BamHI and SfoI restriction sites upstream and downstream of adhE2: pE1 (BamHI is underlined), 5'-ATGGATCCTTTTATAAAGGAGTGTATATAAATGAAAG-3'; and pE2 (SfoI is underlined), 5'-TTGGCGCCATAATGAAGCAAAGACTATTTTACATTC-3'. The amplified fragment of 2,650 kb was subcloned into the pGEM-T easy vector (Promega, Charbonnières, France) and then digested with BamHI and SfoI restriction enzymes. pSOS95 was also digested with BamHI and SfoI, and the 5-kb fragment obtained was ligated to the PCR fragment to yield the 7.62-kb plasmid pE5{alpha} (see Fig. 4). Prior to the transformation of the DG1 strain, the pE5{alpha} and pIMP1 plasmids were methylated in vivo in E. coli ER2275(pAN1) (26) and concentrated and desalted on a Microcon 100 microconcentrator (Amicon, Inc., Beverly, Mass.). Methylated and desalted plasmid DNA was used to transform C. acetobutylicum DG1 by electroporation as previously described (26).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4. Schematic representation of plasmid pE5{alpha} (7.6 kb). The 2.6-kb fragment containing adhE2 was amplified by PCR and cloned in the pSOS95 shuttle vector between the thl promoter (P) and the adc terminator (T).

A DNA fragment containing the promoter region of adhE2 was amplified by PCR from C. acetobutylicum ATCC 824 total genomic DNA. The upstream primer AD2P-D (5'-CTAATAATACGTAATACACCC-3') and the downstream primer AD2P-R (5'-TCTTTCTTTAGCTGCGGCTATGGC-3') on the complementary strand were used. The 467-bp amplified DNA fragment was directly cloned into the pGEM-T easy vector system to yield the pAD2P plasmid (Table 1).

The Strep-tag II (IBA GmbH, Göttingen, Germany) sequence was introduced upstream of the adhE2 gene on pE5{alpha} using primers which introduced the BamHI and PvuII sites upstream and downstream of the gene, respectively, 5'-CATGATCAAGGAGGTTAGTTAGAATGTGGTCACATCCTCAATTTGAAAAACTGGAAGTTCTGTTCCAGGGGCCCCTGGGATCCTTTTATAAAGGAGTGTATA-3' (bold letters indicate the tag-encoding sequence, optimized for clostridial codon usage) and 5'-CCCAGCTGGTACATCAGTAGCCATAATGAAGCAAAGACTATT-3'. The PCR product was subcloned to the pGEM-T easy vector. The 2.7-kb BclI/PvuII fragment of the resulting vector was ligated to the 5-kb BamHI/SfoI fragment of pSOS95, yielding pTSE (Table 1). The presence of the tag sequence in the resulting E. coli(pTSE) strain was verified by sequencing.

Northern blot analysis. Total RNA was isolated from continuous cultures of C. acetobutylicum ATCC 824 by using the protocol of the RNEasy kit (Qiagen) except for the lysis step that we adapted for C. acetobutylicum: 10 ml of culture was taken from the chemostat, transferred into a 15-ml Falcon tube, and immediately frozen in liquid nitrogen. The frozen culture was centrifuged (without previous thawing) at 3,000 x g for 30 min at 4°C, and the cell pellet was suspended in lysis buffer (10 mg of lysosyme/ml in TE buffer: 10 mM Tris-HCl, 1 mM EDTA [pH 8]) and incubated for 30 min at 4°C under moderate shaking.

Denaturing formaldehyde agarose gel electrophoresis of RNA was performed as previously described (36). The RNA was transferred to a positively charged nylon membrane (Hybond N+; Amersham Pharmacia Biotech, Orsay, France).

A 549-kb fragment of adhE and a 452-kb fragment of adhE2 were amplified by PCR using C. acetobutylicum ATCC 824 genomic DNA as a template. The primers used with adhE were adhE-D (upstream primer) (5'-AATGCAGCAATGGCAGCAATCGACGC-3') and adhE-R (downstream primer) (5'-CAATTATTACTGGGGTGTTACCCGG-3'), and the primers used with adhE2 were adhE2-D (upstream primer) (5'-TTCCCTAAATTAGGTACAAAGGCG-3') and adhE2-R (downstream primer) (5'-ATGCATTGCCCCAAGTTTATGAGCC-3').

The PCR fragments were labeled with [{alpha}-32P]dATP (specific activity, 3,000 Ci/mmol; Amersham Pharmacia Biotech) by using the Megaprime DNA labeling system (Amersham Pharmacia Biotech) and used as probes in hybridization.

Prehybridization (for 1 h) and overnight hybridization were performed at 68°C in a solution containing 1 mM EDTA, 7% sodium dodecyl sulfate (SDS), 0.5 M Na2HPO4 (pH 7.2). Washing steps were performed at room temperature twice in 2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and 0.1% SDS buffer for 15 min and twice in 0.1x SSC and 0.1% SDS buffer for 15 min.

Primer extension analysis. Labeling of the oligonucleotides used for the extension was performed with T4 polynucleotide kinase (New England BioLabs). A mix containing 1 µl of oligonucleotide (4 pmol/µl), 1 µl of 10x polynucleotide kinase buffer, 8 µl of [{gamma}-32P]dATP, and 0.5 µl of polynucleotide kinase was incubated for 1 h at 37°C and stored at -20°C. Primer extension analysis was performed with Superscript reverse transcriptase (GIBCO/BRL). Annealing was done with 1 pmol of labeled oligonucleotide and 3 µg of total RNA in a volume of 6 µl, and after 10 min at 70°C, the reaction mixture was cooled on ice. The reverse transcription reaction was started by the addition of 2 µl of 5x buffer, 1 µl of 0.1 M dithiothreitol, 0.5 µl of 10 mM dATP, 10 mM dCTP, 10 mM dGTP, 10 mM dTTP, and 0.5 µl of RTase Superscript. After 50 min at 42°C, the reverse transcriptase was inactivated at 70°C for 15 min, and after cooling on ice, 5 µl of stop buffer from the sequencing kit was added. To map the exact transcriptional start site, sequencing reactions were performed on the pAD2P plasmid including the upstream region of adhE2. The sequencing reaction was done with a Sequenase radiolabeled terminator cycle sequencing kit (Amersham Pharmacia Biotech). Sequencing and reverse transcription reactions were analyzed on a 12% polyacrylamide sequencing gel.

SDS-polyacrylamide gel electrophoresis (PAGE) analysis of AdhE2 expression. Cell extracts prepared from batch culture experiments were diluted in the sample buffer (36) at a final concentration of 400 µg/ml and boiled for 5 min at 100°C, and 15 µg of protein was loaded in an SDS-12% polyacrylamide gel. The gel was stained with Coomassie brilliant blue.

Purification of Strep-tag II-AdhE2. Anaerobic conditions were maintained throughout the entire purification procedure. Anaerobically grown E. coli(pTSE) (300 ml of a culture at an OD600 of 1) were recovered by centrifugation (3,000 x g for 15 min at 4°C) and resuspended in 3 ml of buffer A (100 mM Tris-HCl [pH 7.6], 5 mM dithiothreitol, 2.5% glycerol). The cell suspension was sonicated in an ultrasonic disintegrator (Vibracell 71434; Bioblock, Illkirch, France), at 0°C in four cycles of 30 s with 2-min intervals between each cycle. Cell debris were removed by three centrifugations at 13,000 x g for 5 min. Avidin (600 µg) was added to the resulting supernatant, and the sample was loaded onto a Strep-Tactin Sepharose 1-ml bed volume column (IBA GmbH) by gravity flow. The column was washed with 7 ml of buffer B (100 mM Tris-HCl [pH 8]) and eluted with 3 ml of buffer B containing 2.5 mM desthiobiotin. The presence of Strep-tag II-AdhE2 in the resulting fractions was assayed by immunoblotting after SDS-10% PAGE using Strep-Tactin horseradish peroxidase conjugate (IBA GmbH) at a 1:830 dilution. Prestained low-range SDS-PAGE standards (Bio-Rad, Hercules, Calif.) were used. Silver staining was achieved with the Silver Stain Plus kit (Bio-Rad).

Analysis. The concentration of substrate and fermentation products was measured by a high-pressure liquid chromatography pump (model 510; Waters Associates, Milford, Mass.) equipped with an automatic sampler (AS 100; Thermoseparation Products, San Jose, California), a refractometer (HP104A; Bischof, France), and a data acquisition system (Hewlett-Packard Chemstation, Les Ulis, France). The separation was obtained with an Aminex HPX-87H (Bio-Rad) column (300 by 7.8 mm). Elution was done at 25°C with 0.031 mM H2SO4 at a flow rate of 0.7 ml/min. Protein determination was performed according to the method of Bradford because this assay is not subject to interference by thiol reagents (5) with bovine serum albumin as a standard.

Enzyme assays. The cell extract preparations and BDH and BYDH assays were performed in the anaerobic workstation according to the method described elsewhere (42).

Database comparisons and sequence analysis. DNA and amino acid analyses were performed by using the PC-Gene program (Intelligenetics, Inc.). BLAST2 from the National Center for Biotechnology Information (1) network service was used to search databases for related amino acid sequences. Multiple-sequence alignments and percentages of identity between two amino acid sequences were calculated with AlignX from the Vector NTI software suite (InforMax, Inc., Bethesda, Md.). CLONE-MANAGER (SES, State Line, Pa.) was used for cloning steps and pE5{alpha} design.

Nucleotide sequence accession number. The sequence data of adhE2 were submitted to GenBank (4) and assigned accession number AF321779.


arrow
RESULTS
 
Sequence analysis of the adhE2 gene. The complete genome sequence of C. acetobutylicum ATCC 824 is now available online (32) (GenBank accession number NC001438). Sequence analysis of the pSOL1 megaplasmid revealed an open reading frame (ORF) of 2,577 bp (nucleotides [nt] 36298 to 33722) located about 47 kb away from adhE, the two genes being transcribed in a converging orientation. The deduced amino acid sequence of this ORF showed a high degree of identity with the previously described Aad/AdhE protein from C. acetobutylicum ATCC 824 (13, 29) and AdhE from E. coli (17). The adhE gene encodes a protein with both ADH and aldehyde dehydrogenase activities in these two bacteria. The pSOL1-borne ORF, called adhE2 for the second adhE-like gene in C. acetobutylicum, potentially encodes an 858-amino-acid (aa) protein with an estimated molecular mass of 94.4 kDa.

Analysis of the promoter region shows a putative ribosome-binding site (5'-AAGGAG-3') found 15 bp upstream of the adhE2 ATG start codon. Its sequence and location matched well those found for other clostridial genes (48) and particularly those of the adhE (aad) gene from C. acetobutylicum (12, 29).

Directly upstream of adhE2 is an ORF of 729 bp (on the complementary strand, nt 37500 to 36772) whose deduced amino acid sequence (242 aa) shows significant identity (35%) to the unknown conserved protein YhbE from Bacillus subtilis (22). A 45-bp inverted repeat sequence with a 9-bp loop is found 33 bp downstream of the TAA stop codon of this ORF. This sequence followed by a short T-rich sequence would be able to form a stable stem-loop structure with a calculated free energy of -88.7 kJ/mol and likely functions as a rho-independent transcriptional terminator (34). No ORF resembling the small ORF (108 aa) previously found (13) upstream of the adhE gene of C. acetobutylicum could be detected.

The adhE2 gene was terminated by two consecutive stop codons (TAA and TAG). A 62-bp sequence able to form a stable stem-loop structure, with a calculated free energy of -102 kJ/mol, was identified 10 bp downstream of the TAA adhE2 stop codon. This structure, consisting of a 50-bp imperfect palindromic sequence and a 12-bp sequence forming a loop, was followed by a short T-rich sequence.

The two transcriptional terminators flanking the adhE2 gene suggest that the gene is part of a monocistronic operon.

Protein sequence comparisons. The amino acid sequence deduced from adhE2 was compared with deduced amino acid sequences from several bifunctional aldehyde dehydrogenase and ADH genes (both procaryotic and eukaryotic) available from the EMBL and GenBank databases (Fig. 1) 66.1% identity was found with AdhE (Aad) from C. acetobutylicum ATCC 824, 57% identity was found with AdhE from E. coli K-12, 54.6% identity was found with VC2033 from Vibrio cholerae (18), 46.0 and 45.6% identities were found with AdhEs from the eukaryotic anaerobic protozoans Giardia lamblia (35) and Entamoeba histolytica (6, 47), respectively, 41.2% identity was found with the recently described AdhE from Lactococcus lactis (2), and 40.9% identity was found with AdhE from Salmonella enterica serovar Typhimurium (U68173) (Y. P. Dailly and D. P. Clark, unpublished data).




View larger version (221K):
[in this window]
[in a new window]
 
FIG. 1. Multiple alignments of AADH proteins. Alignment is shown in single letter code. The C. acetobutylicum (Ca) ATCC 824 AdhE2 sequence was aligned with the sequences of C. acetobutylicum AdhE, E. coli (Ec) AdhE, V. cholerae (Vc) VC2033, G. lamblia (G1) AdhE, E. histolytica (Eh) AdhE, L. lactis (L1) AdhE and S. enterica serovar Typhimurium (St) AdhE. Residues which are identical are on a solid background, whereas residues which are similar or identical in at least 50% of the proteins are on a dark shaded background. Putative sites (PROSITE) are boxed, and conserved search patterns for ADH type III (41) are matched by a black dot (•). NBS, nucleotide-binding site; IBS, iron-binding site.

Amino acid sequence analysis of protein domains showed that the domain lying from aa 49 to 395 was related to the aldehyde dehydrogenase family and that the domain from aa 455 to 850 was related to the iron-containing ADH family.

In the aldehyde dehydrogenase domain (N terminal) a conserved region corresponding to the catalytic center of aldehyde dehydrogenases (19) was found as well as a conserved 15-aa peptide (from residue 102) (Fig. 1) with three strictly conserved Pro residues (29). Two nucleotide-binding sites, GVGXG and GCGXXG (46), which are conserved in all AADH proteins (12) are also present in AdhE2 (from residues 209 and 418) (Fig. 1).

In the ADH domain, the protein alignment of AADH proteins showed a conserved GXGXXVXXXA sequence (from residue 598) (Fig. 1) previously described as highly conserved in ADH and AADH proteins (29) and potentially involved in NAD(H)-NADP(H) coenzyme binding. The AdhE2 protein from C. acetobutylicum showed a nonconserved Val residue (replaced by an Ala residue), but this conservative substitution should not lead to a structural change.

AdhE2 showed perfectly conserved search patterns for ADH type III as previously defined (44); these four search patterns are indicated in Fig. 1. Furthermore, PROSITE analysis (3) for the presence of sequence motifs revealed two conserved type III ADH iron-binding motifs (7) characterized as iron-containing ADH signature 1 and signature 2 (Fig. 1). Interestingly, the AdhE2 amino acid sequence showed a highly conserved iron-containing ADH signature 2.

Transcriptional analysis. The expression of the adhE2 gene was studied in chemostat cultures maintained in three different physiological conditions: solventogenic, alcohologenic, and acidogenic. C. acetobutylicum ATCC 824 was grown in phosphate-limited continuous cultures containing glucose as a substrate for solventogenic and acidogenic conditions or glucose plus glycerol for the alcohologenic condition [condition of high NAD(P)H availability]. The culture pH was regulated at 6.5 for the alcohologenic and acidogenic cultures and at 4.4 for the solventogenic culture. The fermentation product profiles of the three cultures were within the experimental error (±5%) margin of previously published data (14, 42).

Total RNA was extracted from these cultures and analyzed by Northern blotting (see Materials and Methods). Probes for both the adhE and adhE2 genes were prepared by PCR and radiolabeled. To avoid cross-hybridization, probes were chosen in regions of low homology between the adhE and adhE2 nucleotide sequences. The results of hybridization showed a specific expression of adhE2 in alcohologenic cultures, whereas adhE was specifically expressed in solventogenic cultures (Fig. 2). The specificity of the hybridization was confirmed by the size of the transcripts. The signal around 4 kb for adhE is in agreement with the size of the sol operon that besides adhE also contains ctfB and ctfA (13). adhE2 showed a signal of 2.6 kb in agreement with the monocistronic operon organization suggested by sequence analysis.



View larger version (106K):
[in this window]
[in a new window]
 
FIG. 2. Northern blot analysis of adhE and adhE2. Equal amounts of RNA (10 µg) isolated from solventogenic (S), alcohologenic (A), and acidogenic (Ac) continuous cultures of C. acetobutylicum ATCC 824 were used for Northern blot analysis with probes specific for adhE2 (left panel) and adhE (right panel). The exposure time for the adhE and adhE2 blots was 5 h. The sizes of selected marker bands (RNA ladder; Promega) are indicated in kilobases on the left side of the figure.

Primer extension. Total RNA extracted from the alcohologenic continuous culture was analyzed by primer extension to determine the exact starting point of transcription. The results are shown in Fig. 3. Two transcription start sites were detected. The major one (S1) was located 160 bases (nt 36460) upstream of the ATG start codon of adhE2 while the minor one (S2) was identified 215 bp (nt 36515) upstream of the start codon. The deduced -10 and -35 sequences of S2 matched well the consensus clostridial promoter sequence (48) (-10, 5'-TATAAT-3'; -35, 5'-TTGACA-3'). But as previously described for the adhE promoter region (13, 29), the -10 and -35 regions of the proximal S1 start site showed low homology to the consensus region for {varsigma}43 sigma factor of gram-positive bacteria. Two regions of dyad symmetry, one of 10 bp and one of 12 bp, were identified. They were localized respectively between positions -224 and -215 and positions -166 and -155 from the start codon. Each of these structures encompassed one transcriptional start point and might be involved in the transcriptional regulation of adhE2.



View larger version (67K):
[in this window]
[in a new window]
 
FIG. 3. Promoter region sequence (from nt 36645 to 36065 on the pSOL1 sequence) and transcription start sites of adhE2. On the right, reverse transcription was performed with total RNA extracted from a continuous culture of C. acetobutylicum ATCC 824 maintained in alcohologenic conditions. Two transcription start sites (S1 and S2) are observed (lane P). Sequence reaction products (lanes A, G, C, and T) were generated using the same primer as the one used for primer extension. The sequence is shown on the left, and transcription start points are indicated with asterisks. The putative ATG start codon is indicated with a bent arrow. The putative -10 and -35 regions are underlined and the putative ribosome-binding site is boxed in gray. The putative FNR site is boxed, and arrows indicate regions of dyad symmetry. The oligonucleotides used for the primer extension are indicated and underlined.

A sequence (5'-TTGtT-N4-ATCAA3') homologous to the consensus FNR binding sequence of E. coli (40) was observed 34 bp upstream from the start codon. This putative target site for transcriptional regulation was located downstream of the two transcriptional start sites.

Expression of AdhE2 in the DG1 mutant cured from pSOL1. The pSOS95 vector was previously constructed for the expression of any desirable gene in either E. coli or C. acetobutylicum (P. Soucaille and E. T. Papoutsakis, unpublished data). It allows cloning of PCR-amplified structural genes between the constitutive promoter from the thiolase gene (thl) and the rho-independent transcriptional terminator from the acetoacetate decarboxylase gene (adc) both isolated from C. acetobutylicum ATCC 824.

The adhE2 gene was PCR amplified and cloned downstream of the pSOS95 promoter. The resulting plasmid was called pE5{alpha} (Fig. 4).

The C. acetobutylicum DG1 strain, cured of the pSOL1 megaplasmid and consequently unable to produce solvent (8), was transformed with pE5{alpha} and control plasmid pIMP1. Figure 5 shows the fermentation profiles at pH 6 with DG1(pE5{alpha}) and DG1(pIMP1). Expression of adhE2 from the thiolase promoter restored butanol production in DG1(pE5{alpha}) with 5.5 g of butanol/liter produced at the expense of butyrate (10 g/liter). In comparison, DG1(pIMP1) produced 19 g of butyrate/liter and no butanol. Both strains yielded similar amounts of acetate, but the biomass production was higher in DG1(pE5{alpha}) than in DG1(pIMP1).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 5. Product formation and OD profiles for controlled (pH 6) batch fermentation of C. acetobutylicum DG1(pIMP1) (A) and DG1(pE5{alpha}) (B). The carbon and redox balances were, respectively, 100 and 96% for DG1(pIMP1) and 99 and 98% for DG1(pE5{alpha}).

Cell extracts were prepared from samples taken at the early exponential phase of growth of DG1(pE5{alpha}) and DG1(pIMP1). SDS-PAGE analysis shows that expression of AdhE2 in C. acetobutylicum DG1(pE5{alpha}) resulted in the appearance of an additional band at about 94 kDa (Fig. 6).



View larger version (74K):
[in this window]
[in a new window]
 
FIG. 6. SDS-PAGE protein analysis of fermentation samples. Acellular extracts from C. acetobutylicum cells taken at the early exponential phase during growth in batch culture at a controlled pH. Lane 1, low-range protein molecular mass markers; lane 2, DG1(pE5{alpha}); lane 3, DG1(pIMP1). The AdhE2 protein is indicated by an arrow.

BYDH and BDH activities. During the course of fermentation, cell samples were taken, and crude cell extracts were prepared and assayed for BYDH and BDH activities with both NADH and NADPH as cofactors.

When adhE2 was expressed, high NADH-dependent BYDH (0.3 U/mg) and BDH (0.12 U/mg) specific activities and low NADPH-dependent BYDH (0.01 U/mg) and BDH (0.02 U/mg) specific activities were obtained, whereas in the control strain, the only activity detected was a low NADPH-dependent BDH activity (0.02 U/mg).

To unambiguously characterize the activity of AdhE2, the protein was fused to the Strep-tag II, overexpressed in E. coli, and purified to homogeneity (Fig. 7). The purified Strep-tag II-AdhE2 protein exhibited NADH-dependent BYDH and BDH activities of 0.74 and 0.18 U/mg, respectively. Unlike AdhE, the enzymatic activity of AdhE2 did not apparently involve an unidentified electron carrier (12).



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 7. Purified Strep-tag II-AdhE2. (A) Silver staining. Lane 1, prestained low-range SDS-PAGE standard proteins; lane 2, purified fusion protein. (B) Immunobloting detection. Lane 1, purified fusion protein; lane 2, prestained low-range SDS-PAGE standard proteins.


arrow
DISCUSSION
 
C. acetobutylicum is known to produce butanol under two different physiological conditions called solventogenesis and alcohologenesis (15). adhE has been shown to be the gene responsible for the two final steps of butanol production in solventogenic cultures (12). On the other hand, the gene(s) responsible for butanol production in alcohologenic cultures remained unknown, although NADH-dependent BYDH and BDH activities were specifically detected under this condition (42). In this study, we characterized from molecular and biochemical points of view the adhE2 gene of C. acetobutylicum ATCC 824 and we demonstrated that it is responsible for butanol production in alcohologenic cultures. adhE2 is expressed specifically in alcohologenic cultures. Introduction of this gene in DG1 restores butanol production and the purified AdhE2 protein possesses NADH-dependent BYDH and BDH activities. This is the second AADH identified in C. acetobutylicum ATCC 824, and to our knowledge this is the first example of a bacterium with two AADHs. It is noteworthy that the two corresponding genes, adhE and adhE2, are carried by the pSOL1 megaplasmid of C. acetobutylicum ATCC 824. In the clostridia, genes encoding AdhE homologues were only detected in C. acetobutylicum ATCC 824 or DSM792 (13, 29) and NRRL B528 (41).

The aldehyde dehydrogenase domain (N terminal) of AdhE2 contains a conserved region identified as the catalytic center of aldehyde dehydrogenases (19). Two nucleotide-binding sites, GVGXG and GCGXXG (46), which were shown to be conserved in AADH proteins (12) and potentially involved in NADH binding, were also present in the aldehyde dehydrogenase domain of AdhE2. The ADH domain of AdhE2 does not contain the conserved NADH binding site of class III ADH (long-chain Zn-containing ADH enzymes) consisting of a GXGXXG or GXXGXXG consensus site localized at the N terminus of the protein. Such a pattern is also not found in the other AADH proteins, suggesting a different localization of the NADH binding site. The GXGXXVXXXA conserved sequence among AADHs could be implicated in coenzyme binding. It was previously suggested (11) that the different position of the NADH binding site in AADHs in contrast with ADHs could be due to the fusion of the N terminus with the acetaldehyde dehydrogenase domain. The ADH domain shows a highly conserved iron-binding site identified as iron-binding site 2 in type III ADHs. The three histidines of the iron-binding motif are present, suggesting the requirement of the Fe2+ cation as a cofactor for its catalytic activities as described for the E. coli AdhE (20). These three histidines are conserved in all AADHs and class III ADHs with the exception of AdhE from C. acetobutylicum (13).

Neither overexpression of the sol operon containing adhE (30) nor overexpression of adhE2 in the DG1 mutant restored butanol production comparable to that in the wild-type strain. There might be three explanations for this phenomenon. First the shift from acid to alcohol formation necessitates a redirection of the electron flow from hydrogen to alcohol production. In solventogenic culture it is not known how reduced ferredoxin is used to reduce NAD(P)+ (15), whereas in alcohologenic culture a ferredoxin NAD+ reductase is involved (42). It is possible that in both cases the genes involved in the reduction of the NAD(P)+ are carried by the pSOL1 megaplasmid, which could explain why alcohol production is lower when adhE and adhE2 are expressed in mutants cured of pSOL1. The second explanation for this phenomenon is that the lack of acetone formation enzymes cannot regenerate butyryl-CoA from butyrate and that this acid could not be reconsumed for butanol formation. The third explanation is a possible oversensitivity of DG1 to butanol. Several homologues of genes coding for efflux pump and/or multidrug resistance proteins are found on the pSOL1 megaplasmid and could be involved in butanol efflux (i.e., CAP0128, nt 138365 to 139810, a homologue to a multidrug resistance protein from B. subtilis [22], and CAP0131, nt 141612 to 143081, a homologue to a multidrug efflux transporter from Deinococcus radiodurans [45]). In Pseudomonas putida S12, an efflux pump encoded by srp was shown to be responsible for solvent resistance (21). Such systems were also found in Pseudomonas aeruginosa (24) and E. coli (44).

The adhE2 gene is only expressed under the condition of a high NADH/NAD+ ratio (alcohologenesis) that can be obtained by growth on glycerol or by the addition of redox dyes like methyl viologen (33) or neutral red (16). Expression of the adhE gene from E. coli was also proposed to be controlled by NADH/NAD+ (23). A sequence homologue to the FNR binding site of E. coli was observed in the adhE2 promoter region. A search for an FNR homologue using the available genomic sequence of C. acetobutylicum ATCC 824 allowed the identification of ORF CAC 1511 (nt 1654559 to 1655245) as a homologue of the B. subtilis FNR (10). Interestingly, one FNR binding site is also found in the adhE promoter region of E. coli, but its role is still unknown (25), since mutations in fnr have apparently no effect on adhE expression. The identification of the adhE2 transcriptional regulator(s) leading to the specific expression of this gene under low redox conditions (a high NADH/NAD+ ratio) is currently under investigation in our laboratory.


arrow
ACKNOWLEDGMENTS
 
We are grateful to R. V. Nair for advice and critical reading of the manuscript.

This work was supported by a grant from the INRA, A.P. microbiologie no. 079289. L.F. was supported by a predoctoral fellowship from the French Ministère de l’Education et de la Recherche Scientifique.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Genencor International, 925 Page Mill Rd., Palo Alto, CA 94304. Phone: (650) 846-7696. Fax: (650) 845-6506. E-mail: psoucaille{at}genencor.com. Back

{dagger} CRITT-Bioindustries, INSA, DGBA, 31077 Toulouse cedex 4, France. Back


arrow
REFERENCES
 
    1
  1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389–3402.[Abstract/Free Full Text]
  2. 2
  3. Arnau, J., F. Jorgensen, S. M. Madsen, A. Vrang, and H. Israelsen. 1998. Cloning of the Lactococcus lactis adhE gene, encoding a multifunctional alcohol dehydrogenase, by complementation of a fermentative mutant of Escherichia coli. J. Bacteriol. 180:3049–3055.[Abstract/Free Full Text]
  4. 3
  5. Bairoch, A. 1992. PROSITE: a dictionary of sites and patterns in proteins. Nucleic Acids Res. 20(Suppl.):2013–2018.
  6. 4
  7. Bilofsky, H. S., and C. Burks. 1988. The GenBank genetic sequence databank. Nucleic Acids Res. 16:1861–1863.[Abstract/Free Full Text]
  8. 5
  9. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248–254.[CrossRef][Medline]
  10. 6
  11. Bruchhaus, I., and E. Tannich. 1994. Purification and molecular characterization of the NAD(+)-dependent acetaldehyde/alcohol dehydrogenase from Entamoeba histolytica. Biochem. J. 303:743–748.
  12. 7
  13. Cabiscol, E., J. Aguilar, and J. Ros. 1994. Metal-catalyzed oxidation of Fe2+ dehydrogenases. Consensus target sequence between propanediol oxidoreductase of Escherichia coli and alcohol dehydrogenase II of Zymomonas mobilis. J Biol. Chem. 269:6592–6597[Abstract/Free Full Text]
  14. 8
  15. Cornillot, E., R. V. Nair, E. T. Papoutsakis, and P. Soucaille. 1997. The genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 reside on a large plasmid whose loss leads to degeneration of the strain. J. Bacteriol. 179:5442–5447.[Abstract/Free Full Text]
  16. 9
  17. Cornillot, E., and P. Soucaille. 1996. Solvent-forming genes in clostridia. Nature 380:489.
  18. 10
  19. Cruz Ramos, H., L. Boursier, I. Moszer, F. Kunst, A. Danchin, and P. Glaser. 1995. Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms. EMBO J. 14:5984–5994.[Medline]
  20. 11
  21. de Vries, G. E., N. Arfman, P. Terpstra, and L. Dijkhuizen. 1992. Cloning, expression, and sequence analysis of the Bacillus methanolicus C1 methanol dehydrogenase gene. J. Bacteriol. 174:5346–5353.[Abstract/Free Full Text]
  22. 12
  23. Dürre, P., R. J. Fischer, A. Kuhn, K. Lorenz, W. Schreiber, B. Sturzenhofecker, S. Ullmann, K. Winzer, and U. Sauer. 1995. Solventogenic enzymes of Clostridium acetobutylicum: catalytic properties, genetic organization, and transcriptional regulation. FEMS Microbiol. Rev. 17:251–262.[Medline]
  24. 13
  25. Fischer, R. J., J. Helms, and P. Dürre. 1993. Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J. Bacteriol. 175:6959–6969.[Abstract/Free Full Text]
  26. 14
  27. Girbal, L., and P. Soucaille. 1994. Regulation of Clostridium acetobutylicum metabolism as revealed by mixed-substrate steady-state continuous cultures: role of NADH/NAD+ ratio and ATP pool. J. Bacteriol. 176:6433–6438.[Abstract/Free Full Text]
  28. 15
  29. Girbal, L., C. Croux, I. Vasconcelos, and P. Soucaille. 1995. Regulation of metabolic shifts in Clostridium acetobutylicum ATCC824. FEMS Microbiol. Rev. 17:287–297.[CrossRef]
  30. 16
  31. Girbal, L., I. Vasconcelos, S. Saint-Amans, and P. Soucaille. 1995. How neutral red modified carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral pH. FEMS Microbiol. Rev. 16:151–162.
  32. 17
  33. Goodlove, P. E., P. R. Cunningham, J. Parker, and D. P. Clark. 1989. Cloning and sequence analysis of the fermentative alcohol-dehydrogenase-encoding gene of Escherichia coli. Gene 85:209–214.[CrossRef][Medline]
  34. 18
  35. Heidelberg, J. F., J. A. Eisen, W. C. Nelson, R. A. Clayton, M. L. Gwinn, R. J. Dodson, D. H. Haft, E. K. Hickey, J. D. Peterson, L. Umayam, S. R. Gill, K. E. Nelson, T. D. Read, H. Tettelin, D. Richardson, M. D. Ermolaeva, J. Vamathevan, S. Bass, H. Qin, I. Dragoi, P. Sellers, L. McDonald, T. Utterback, R. D. Fleishmann, W. C. Nierman, and O. White. 2000. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406:477–483.[CrossRef][Medline]
  36. 19
  37. Hempel, J., K. Harper, and R. Lindahl. 1989. Inducible (class 3) aldehyde dehydrogenase from rat hepatocellular carcinoma and 2,3,7,8-tetrachlorodibenzo-p-dioxin-treated liver: distant relationship to the class 1 and 2 enzymes from mammalian liver cytosol/mitochondria. Biochemistry 28:1160–1167.[CrossRef][Medline]
  38. 20
  39. Kessler, D., W. Herth, and J. Knappe. 1992. Ultrastructure and pyruvate formate-lyase radical quenching property of the multienzymic AdhE protein of Escherichia coli. J. Biol. Chem. 267:18073–18079.[Abstract/Free Full Text]
  40. 21
  41. Kieboom, J., J. J. Dennis, J. A. de Bont, and G. J. Zylstra. 1998. Identification and molecular characterization of an efflux pump involved in Pseudomonas putida S12 solvent tolerance. J. Biol. Chem. 273:85–91.[Abstract/Free Full Text]
  42. 22
  43. Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, and A. Danchin. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249–256.[CrossRef][Medline]
  44. 23
  45. Leonardo, M., R., P. R. Cunningham, and D. P. Clark. 1993. Anaerobic regulation of the adhE gene, encoding the fermentative alcohol dehydrogenase of Escherichia coli. J. Bacteriol. 175:870–878.[Abstract/Free Full Text]
  46. 24
  47. Li, X. Z., L. Zhang, and K. Poole. 1998. Role of the multidrug efflux systems of Pseudomonas aeruginosa in organic solvent tolerance. J. Bacteriol. 180:2987–2991.[Abstract/Free Full Text]
  48. 25
  49. Membrillo-Hernández, J., and E. C. C. Lin. 1999. Regulation of expression of the adhE gene, encoding ethanol oxidoreductase in Escherichia coli: transcription from a downstream promoter and regulation by Fnr and RpoS. J. Bacteriol. 181:7571–7579.[Abstract/Free Full Text]
  50. 26
  51. Mermelstein, L. D., and E. T Papoutsakis. 1993. In vivo methylation in Escherichia coli by the Bacillus subtilis phage {phi} 3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Appl. Environ. Microbiol. 59:1077–1081.[Abstract/Free Full Text]
  52. 27
  53. Mermelstein, L. D., N. E. Welker, G. N. Bennett, and E. T. Papoutsakis. 1992. Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824. Bio/Technology 10:190–195.[CrossRef][Medline]
  54. 28
  55. Nair, R. V. 1995. Ph.D. thesis. Northwestern University, Evanston, Ill.
  56. 29
  57. Nair, R. V., G. N. Bennett, and E. T. Papoutsakis. 1994. Molecular characterization of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC 824. J. Bacteriol. 176:871–885.[Abstract/Free Full Text]
  58. 30
  59. Nair, R. V., and E. T. Papoutsakis. 1994. Expression of plasmid-encoded aad in Clostridium acetobutylicum M5 restores vigorous butanol production. J. Bacteriol. 176:5843–5846.[Abstract/Free Full Text]
  60. 31
  61. Nair, R. V., E. M. Green, D. E. Watson, G. N. Bennett, and E. T. Papoutsakis. 1999. Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a putative transcriptional repressor. J. Bacteriol. 181:319–330.[Abstract/Free Full Text]
  62. 32
  63. Nolling, J., G. Breton, M. V. Omelchenko, K. S. Makarova, Q. Zeng, R. Gibson, H. M. Lee, J. Dubois, D. Qiu, J. Hitti, Y. I. Wolf, R. L. Tatusov, F. Sabathe, L. Doucette-Stamm, P. Soucaille, M. J. Daly, G. N. Bennett, E. V. Koonin, and D. R. Smith. 2001. Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J. Bacteriol. 183:4823–4838.[Abstract/Free Full Text]
  64. 33
  65. Peguin, S., and P. Soucaille. Modulation of carbon and electron flow in Clostridium acetobutylicum by iron limitation and methyl viologen addition. Appl. Environ. Microbiol. 61:403–405.
  66. 34
  67. Rosenberg, M., and D. Court. 1979. Regulatory sequences involved in the promotion and termination of RNA transcription. Annu. Rev. Genet. 13:319–353.[CrossRef][Medline]
  68. 35
  69. Rosenthal, B., Z. Mai, D. Caplivski, S. Ghosh, H. de la Vega, T. Graf, and J. Samuelson. 1997. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica. J. Bacteriol. 179:3736–3745.[Abstract/Free Full Text]
  70. 36
  71. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  72. 37
  73. Sauer, U., and P. Dürre. 1995. Differential induction of genes related to solvent formation during the shift from acidogenesis to solventogenesis in continuous culture of Clostridium acetobutylicum. FEMS Microbiol. Lett. 125:115–120.[CrossRef]
  74. 38
  75. Soni, B., P. Soucaille, and G. Goma. 1987. Continuous acetone-butanol fermentation: a global approach for the improvement in the solvent productivity in synthetic medium. Appl. Microbiol. Biotechnol. 25:317–321.
  76. 39
  77. Soni, B., P. Soucaille, and G. Goma. 1987. Continuous acetone-butanol fermentation: influence of vitamins on the metabolic activity of Clostridium acetobutylicum. Appl. Microbiol. Biotechnol. 27:1–5.
  78. 40
  79. Spiro, S., and J. R. Guest. 1990. FNR and its role in oxygen-regulated gene expression in Escherichia coli. FEMS Microbiol. Rev. 75:399–428.[CrossRef]
  80. 41
  81. Toth, J., A. A. Ismaiel, and J. S. Chen. 1999. The ald gene, encoding a coenzyme A-acylating aldehyde dehydrogenase, distinguishes Clostridium beijerinckii and two other solvent-producing clostridia from Clostridium acetobutylicum. Appl. Environ. Microbiol. 65:4973–4980.[Abstract/Free Full Text]
  82. 42
  83. Vasconcelos, I., L. Girbal, and P. Soucaille. 1994. Regulation of carbon and electron flow in Clostridium acetobutylicum grown in chemostat culture at neutral pH on mixtures of glucose and glycerol. J. Bacteriol. 176:1443–1450.[Abstract/Free Full Text]
  84. 43
  85. Walter, K. A., G. N. Bennett, and E. T. Papoutsakis. 1992. Molecular characterization of two Clostridium acetobutylicum ATCC 824 butanol dehydrogenase isozyme genes. J. Bacteriol. 174:7149–7158.[Abstract/Free Full Text]
  86. 44
  87. White, D. G., J. D. Goldman, B. Demple, and S. B. Levy. 1997. Role of the acrAB locus in organic solvent tolerance mediated by expression of marA, soxS, or robA in Escherichia coli. J. Bacteriol. 179:6122–6126.[Abstract/Free Full Text]
  88. 45
  89. White, O., J. A. Eisen, J. F. Heidelberg, E. K. Hickey, J. D. Peterson, R. J. Dodson, D. H. Haft, M. L. Gwinn, W. C. Nelson, D. L. Richardson, K. S. Moffat, H. Qin, L. Jiang, W. Pamphile, M. Crosby, M. Shen, J. J. Vamathevan, P. Lam, L. McDonald, T. Utterback, C. Zalewski, K. S. Makarova, L. Aravind, M. J. Daly, and C. M. Fraser. 1999. Genome sequence of the radioresistant bacterium Deinococcus radiodurans R1. Science 286:1571–1577.[Abstract/Free Full Text]
  90. 46
  91. Wierenga, R. K., P. Terpstra, and W. G. Hol. 1986. Prediction of the occurrence of the ADP-binding beta alpha beta-fold in proteins, using an amino acid sequence fingerprint. J. Mol. Biol. 187:101–107.[CrossRef][Medline]
  92. 47
  93. Yang, W., E. Li, T. Kairong, and S. L. Stanley, Jr. 1994. Entamoeba histolytica has an alcohol dehydrogenase homologous to the multifunctional adhE gene product of Escherichia coli. Mol. Biochem. Parasitol. 64:253–260.[CrossRef][Medline]
  94. 48
  95. Young, M., N. P. Minton, and W. L. Staudenbauer. 1989. Recent advances in the genetics of the clostridia. FEMS Microbiol. Rev. 5:301–325.[CrossRef][Medline]


Journal of Bacteriology, February 2002, p. 821-830, Vol. 184, No. 3
0021-9193/01/$04.00+0     DOI: 10.1128/JB.184.3.821-830.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Shi, Z., Blaschek, H. P. (2008). Transcriptional Analysis of Clostridium beijerinckii NCIMB 8052 and the Hyper-Butanol-Producing Mutant BA101 during the Shift from Acidogenesis to Solventogenesis. Appl. Environ. Microbiol. 74: 7709-7714 [Abstract] [Full Text]  
  • Perret, S., Casalot, L., Fierobe, H.-P., Tardif, C., Sabathe, F., Belaich, J.-P., Belaich, A. (2004). Production of Heterologous and Chimeric Scaffoldins by Clostridium acetobutylicum ATCC 824. J. Bacteriol. 186: 253-257 [Abstract] [Full Text]  
  • Tummala, S. B., Junne, S. G., Papoutsakis, E. T. (2003). Antisense RNA Downregulation of Coenzyme A Transferase Combined with Alcohol-Aldehyde Dehydrogenase Overexpression Leads to Predominantly Alcohologenic Clostridium acetobutylicum Fermentations. J. Bacteriol. 185: 3644-3653 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fontaine, L.
Right arrow Articles by Soucaille, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fontaine, L.
Right arrow Articles by Soucaille, P.