Previous Article | Next Article ![]()
Journal of Bacteriology, April 2002, p. 1832-1842, Vol. 184, No. 7
0021-9193/02/$04.00+0 DOI: 10.1128/JB.184.7.1832-1842.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
,
, Roy O. Morris, and Joe C. Polacco*
Department of Biochemistry, University of MissouriColumbia, Columbia, Missouri 65211
Received 26 September 2001/ Accepted 19 December 2001
|
|
|---|
|
|
|---|
Cytokinins can be produced by bacteria by at least two pathways. De novo synthesis involves the direct isopentenylation of AMP catalyzed by dimethylallyl transferase (DMAT), which was first characterized in Agrobacterium tumefaciens (17, 19, 27). The second pathway of bacterial cytokinin production involves turnover of modified tRNA and may also operate in higher plants. However, the contribution of tRNA turnover to the overall cytokinin pool in both bacteria and plants has been debated for a long time. The origin of cytokinins resulting from tRNA degradation involves a modified adenine immediately 3' to anticodons recognizing codons beginning with uridine (Trp, Phe, and Tyr codons and some Cys, Leu, and Ser codons) (33, 42). This adenine is isopentenylated by isopentenyl tRNA transferase, the product of the miaA gene. In some bacteria this modified adenine is subsequently methylthiolated and/or hydroxylated. It is hypothesized that upon turnover of tRNA the modified adenine residue is released as a free cytokinin.
In plants and apparently in bacteria as well, the isopentenyl side chain of the adenine residue is cis hydroxylated, and thus cis-zeatin riboside and/or methylthiolzeatin is released upon tRNA degradation (7, 31, 32). This isomer is nearly biologically inactive as a plant hormone, in contrast to de novo -synthesized trans-cytokinins (22). Because of the difference in stereoisomerism between the two paths of cytokinin biosynthesis, it has been assumed that tRNA turnover makes a minor contribution, at best, to the plant cytokinin pool. However, trans-hydroxylated zeatin has been found in the tRNAs and culture filtrates of Bradyrhizobium japonicum (40) and the rhizosphere bacterium Azotobacter vinlandii (1, 43). The trans isomer in the tRNA of Agrobacterium that was described by Chapman and Morris (6) was later shown by workers in the same laboratory to be the cis isomer (32). tRNA-derived trans-zeatin levels are much lower than the cytokinin levels produced de novo by pathogenic bacteria. However, B. japonicum and A. vinlandii are not associated with the gross morphological changes seen during pathogenesis (legume nodulation in symbiotic nitrogen fixation relationships is not associated with cytokinin production by rhizobia [26, 37, 39, 46]). Therefore, low-level production of cytokinins may not be an isolated phenomenon.
The possibility of widespread cytokinin production by plant commensal bacteria and the growth- and development-promoting activities of PPFMs described above and elsewhere (12, 21) led us to examine cytokinin production by phylloplane PPFMs. In this study, we characterized production of trans-zeatin by four leaf-associated PPFMs and by a type culture of M. extorquens. Furthermore, we demonstrated that this production is derived from the release of trans-zeatin during tRNA turnover. This is the first detailed characterization of cytokinin production by a phylloplane commensal bacterium, and it is the first time that bacterial secretion of trans-zeatin has been definitively linked to a tRNA source.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Bacterial strains and plasmids used in this study
|
E. coli transformation was performed either by electroporation or by heat shock as described previously (3). The electroporation device used was an Electroporator II (Invitrogen, Carlsbad, Calif.). Plasmids were transferred from E. coli DH5
into Methylobacterium by three-way mating as described by Chistoserdov et al. (8) by using mobilization helper plasmid pRK2013 in E. coli HB101. Bacterial cells were collected by filtration on 0.45-µm-pore-size nitrocellulose filters (Gelman Metricel; diameter, 25 mm; Fisher Scientific Co., St. Louis, Mo.), which were transferred onto nutrient agar plates and incubated for 24 h at 30°C. Cells were resuspended in 5 ml of AMS/methanol medium, and aliquots were plated on appropriate selective media.
To label cytokinins in vivo, 100-ml portions of AMS/methanol medium in silanized 250-ml flasks (six replicates) were each inoculated with 1 ml of a starter culture of the Arabidopsis leaf PPFM isolate. Three of the replicates were supplemented with 50 µCi of [2,8-3H]adenine (specific activity, 20 to 40 Ci/mmol; NEN Life Sciences, Boston, Mass.) at the time of inoculation. These three replicates were harvested during logarithmic growth (22 h), and the supernatants were clarified and used for cytokinin recovery. The remaining three isolates were supplemented with 50 µCi of [3H]adenine during logarithmic growth (22 h) and harvested in the stationary phase (44 h). Growth was monitored spectrophotometrically (optical density at 600 nm), and cell numbers were confirmed by plating in a pilot experiment to obtain a standard growth curve for the strain used.
tRNA isolation, hydrolysis, and dephosphorylation. The method used to isolate bacterial tRNA was modified from the method of Kelmers et al. (23). Cell pellets were first partially lysed with a French press at 1,200 lb/in2, and following phenol extraction, any remaining DNA was hydrolyzed by treatment with 200 U of DNase (Promega, Inc., Madison, Wis.) for 3 h at 37°C. The remaining nucleic acids were purified by ethanol precipitation, resuspended in low-salt buffer (250 mM NaCl, 10 mM MgCl2, 1 mM EDTA, 5 mM ß-mercaptoethanol, 20 mM Tris-Cl [pH 7.5]), and applied to DEAE-cellulose. Purified tRNA was eluted with high-salt buffer (650 mM NaCl, 10 mM MgCl2, 1 mM EDTA, 5 mM ß-mercaptoethanol, 20 mM Tris-Cl [pH 7.5]) and was quantified by determining A260. All subsequent steps were performed in polypropylene tubes to avoid loss of cytokinin. tRNA samples were hydrolyzed overnight in 0.3 N KOH at 37°C. The pH was adjusted to 9 with 6 N HCl, MgCl2 was added to a concentration of 20 mM, and the nucleotides were dephosphorylated with 20 U of calf intestinal phosphatase (Boehringer Mannheim, Hamburg, Germany; or Promega, Inc.) at 37°C. Due to the formation of magnesium phosphate precipitate, an additional 20 U of enzyme and 10 mM MgCl2 were added after 6 h, and incubation was continued overnight. The samples were then diluted 10-fold with immunoaffinity column buffer (40 mM ammonium acetate, pH 7.0) to obtain a volume of 10 ml, and cytokinins were isolated, fractionated, and identified as described below.
Immunoaffinity purification of cytokinins. Cytokinins in culture supernatants (850 ml) were first concentrated by binding to C18 silica (Bondesil; Varian Inc., Harbor City, Calif.) at pH 7.0 and then eluted with 15 to 20 ml of methanol. Eluates were dried in vacuo, resuspended in 400 µl of dimethyl sulfoxide, and diluted with 40 mM ammonium acetate (pH 7.0) to obtain 40-ml preparations. Samples were passed through DEAE-cellulose (DE-52; bed volume, 10 ml; Whatman) connected in tandem to immunoaffinity columns, each containing 0.5 to 1.0 ml of microcrystalline cellulose (Whatman) to which purified clone 16 (anti-trans-zeatin and anti-trans-ribosylzeatin) monoclonal antibody (44) had been conjugated (29). The columns were each equilibrated with 120 ml of immunoaffinity buffer and, after sample application, were washed with an additional 20 ml of this buffer passed through both columns and 10 ml passed through only the immunoaffinity column. Cytokinins were eluted from the immunoaffinity columns with 15 ml of methanol and dried in vacuo . Isopentenyladenine (iP) and isopentenyladenosine (iPA) not isolated by low-affinity binding to clone 16 monoclonal antibody were isolated similarly by using the clone 12 broad-range cytokinin monoclonal antibody described by Trione et al. (44). Similarly, cis-zeatin was isolated by using a monoclonal antibody for this isomer obtained from Gary Banowetz (USDA Agricultural Research Service, Oregon State University, Corvallis). Since this monoclonal antibody also binds the trans isomer at a 10-fold-lower affinity than it binds the cis isomer (data not shown), the trans isomers were first removed from supernatants and tRNA hydrolysates by passing the preparations over the clone 16 anti-trans-zeatin monoclonal antibody immunoaffinity material and then over the anti-cis-zeatin monoclonal antibody immunoaffinity material. To isolate any remaining iP or iPA, the flowthrough was passed over the broad-range clone 12 antibody.
For the 100-ml supernatant obtained from a [3H]adenine-fed culture, the C18 concentration step was omitted. Unlabeled adenine (1 µg) was added to the supernatant, which was passed directly over the linked DEAE-cellulose immunoaffinity columns. The efficiency of cytokinin recovery by this method was estimated by adding [3H]zeatin riboside trialcohol ([3H]ZRTA) to uninoculated control medium and measuring the recovery of label after high-performance liquid chromatography (HPLC) fractionation. tRNA hydrolysates were passed directly over immunoaffinity columns without concentration on DEAE precolumns.
HPLC fractionation and RIA of cytokinins. The immunoaffinity-purified cytokinins were fractionated by HPLC performed with a Beckman Ultrasphere octadecylsilica column (5 µm; 4.6 by 250 mm) equilibrated in triethylammonium acetate buffer (40 mM acetic acid adjusted to pH 3.4 with triethylamine [29]). They were eluted at a flow rate of 1.0 ml/min with a linear acetonitrile gradient (the initial gradient was either 5 to 15% or 10 to 15% for 15 min and was followed by a 15 to 35% gradient for 15 min and a 35 to 100% gradient for 1 min). Under these conditions, cytokinin standards (Sigma) eluted from the column in the following order: trans-zeatin, dihydrozeatin, cis-zeatin, trans-zeatin riboside, dihydrozeatin riboside, cis-zeatin riboside, kinetin, iP, and iPA. The minimum separation between these cytokinins was 0.5 min. [3H]ZRTA eluted between dihydrozeatin and cis-zeatin. The fraction volumes were 0.5 or 1.0 ml, depending on the chromatographic conditions. Fractions were dried to completion in vacuo after neutralization with 20 µl of triethylamine. Cytokinins in individual fractions were quantified by a radioimmunoassay (RIA) as described by MacDonald and Morris (29) by using the clone 16 anti-trans-zeatin riboside monoclonal antibody (final dilution, 1:10,000). As described above, this monoclonal antibody has negligible affinity for cis-zeatin (44) and low affinity for iP and iPA. HPLC fractions from [3H]ZRTA recovery and [3H]adenine precursor studies were not subjected to RIA but were counted directly by the liquid scintillation technique in 1.5 ml of Scintisafe 30 (Fisher Scientific Co.). Most analyses were performed in triplicate (separate cultures and analyses); the only exceptions were the barley leaf isolate analyses, which were performed in duplicate.
DNA manipulation. The plasmids used are listed in Table 1. Small-scale plasmid preparations were obtained as described by Li and Schweizer (25). Larger-scale preparations were obtained by using a modification of the polyethylene glycol precipitation method (9). Plasmids used for sequencing were prepared with a Gibco Concert Rapid Plasmid Miniprep (GibcoBRL, Inc., Rockville, Md.) used in accordance with the manufacturer's instructions.
To prepare PPFM genomic DNA, 100 ml of a stationary-phase culture was pelleted by centrifugation and resuspended in 1 ml of TE (1 mM EDTA, 10 mM Tris-Cl; pH 8.0); this was followed by addition of 750 µl of n-butanol (H2O saturated) and gentle mixing for 5 min. The cells were repelleted, washed in TE, and then resuspended in 1 ml of TE to which 80 µl of a 100-mg/ml lysozyme solution (Calbiochem, Inc., San Diego, Calif.) and 20 U of RNAseOne (Promega, Inc.) were added. After incubation at 37°C for 1 to 2 h, 120 µl of 20% (wt/vol) sodium dodecyl sulfate (SDS) and 100 µl of a 20-mg/ml proteinase K (Sigma) solution were added, and the preparation was incubated for another 30 to 60 min at 50°C. The preparation was extracted once with chloroform, ammonium acetate (pH 7.5) was added to a concentration of 100 mM, and the DNA was precipitated with isopropanol (0.67 volume). The resulting DNA was spooled out of the preparation, rinsed in 70% ethanol, resuspended in 200 µl of TE, extracted once with phenol-chloroform, and reprecipitated with ethanol (2 volumes) and 0.3 mM sodium acetate (pH 5.5). The yield was approximately 150 µg of PPFM DNA per 100 ml of culture. The DNA (1 µg/µl) was stored in TE at -20°C.
Restriction digestions were performed by following the instructions of the manufacturers (Promega, Inc.; Boehringer Mannheim; and New England Biochemical, Beverly, Mass.). Fragments were analyzed by horizontal agarose gel electrophoresis. Restriction fragments were recovered from agarose by using either a 3'-5' Glasselect gel recovery kit (5'-Eppendorf, Boulder, Colo.) or a GibcoBRL Concert Matrix gel extraction system. Ligation was performed by using either a rapid ligation kit (Boehringer Mannheim) or Promega 2x rapid ligation buffer with 10 U of T4 DNA ligase (Promega, Inc.). All ligation reaction mixtures were incubated in an ice-water mixture for 16 to 24 h.
Southern blotting was performed by alkaline transfer onto positively charged nylon membranes (Hybond-N [Amersham-Pharmacia, Inc., Piscataway, N.J.] or MSI MagnaCharge [Osmonics, Inc., Minnetonka, Minn.]). DNA was transferred without gel pretreatment in a transfer buffer containing 0.4 N NaOH for 4 to12 h. Each membrane was washed until it was neutralized in 2x SSC (1x SSC is 150 mM NaCl plus 15 mM sodium citrate), and the DNA was fixed by air drying at room temperature. Hybridization was performed at 65°C by using Sigma PerfectHybe hybridization solution according to the manufacturer's instructions. Two successive 65°C 1-h washes were done at high stringency (1x SSC, 0.1% SDS) and then at very high stringency (0.1x SSC, 0.1% SDS). All probes were labeled with [
-32P]dCTP (NEN Life Sciences) by the random prime method by using a Gibco RadPrime labeling kit according to the manufacturer's instructions.
Isolation of the M. extorquens miaA gene. For initial amplification of an internal fragment of the M. extorquens miaA gene, amino acid sequences encoded by the miaA genes of Agrobacterium tumefaciens and Rickettsia prowazekii, the two organisms most closely related to Methylobacterium with known miaA genes, were aligned (Fig. 1). Partially degenerate sense and antisense primers for four conserved regions of the DNAs were constructed. A total of four sense and four antisense primers were constructed. The codon biases used for construction were based on M. extorquens AM1 codon usage determined by analysis of five known M. extorquens AM1 genes, mxaB, mxaE, mxaF, mxaH, and pykA. All other primers used in this study were synthesized for known DNA sequences and are described below. Primers were synthesized by Gibco Life Sciences, Inc.
![]() View larger version (41K): [in a new window] |
FIG. 1. Amino acid alignment for isopentenyl tRNA transferase (MiaA) from A. tumefaciens (18) and R. prowazekii (2). Partially degenerate primers based on the amino acid sequences located above the dotted lines were constructed based on known codon usage in M. extorquens AM1.
|
To prepare an M. extorquens genomic library, total DNA was digested completely with PstI and cloned into pBluescript SK+ (Stratagene, Inc., La Jolla, Calif.). The library produced 3,000 CFU/ng of vector, 85% of which contained inserts, as indicated by the lack of blue pigment produced by hydrolysis of X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactoside). IPTG (isopropyl-1-thio-ß-D-galactoside) was added to induce lacZ activity (38). Library colony lifts were prepared on nylon filters as described by Sambrook et al. (38) and were probed as described above for Southern blotting. Approximately 13,000 independent clones were screened. Colonies that produced a hybridization signal with the miaA PCR fragment were checked for the expected insert size derived from a Southern blot against a complete PstI digest of M. extorquens total DNA.
Generation of a miaA knockout mutant of M. extorquens. Since the 745-bp miaA fragment originally amplified from M. extorquens was located 80 bp from the 3' end of the gene, a 600-bp internal fragment was generated by PCR by using primers with 5' EcoRI sites (sense primer sequence, GAATTCGTCTACGCCGACCT; antisense primer sequence, GAATTCGTCCCGTCGAGAT). The resulting truncated fragment was ligated into pGEMT-easy and then reexcised with EcoRI and cloned into the EcoRI site of the multiple cloning region of suicide plasmid pAYC61 to generate plasmid pRL2. pRL2 was mobilized into M. extorquens by three-way mating, and tetracycline-resistant exconjugates were isolated. Integration of the plasmid into the miaA gene by a single homologous crossover was confirmed by PCR analysis with primers complementary to the vector and the internal fragment and by sequence analysis of the PCR products. Mutants were maintained in the presence of tetracycline to select against insert excision. tRNA and supernatant samples from two independent mutant cultures were examined for the presence of cytokinins as described above.
DNA sequencing and analysis. DNA was sequenced at the University of Missouri DNA Core Facility by using ABI BigDye terminator chemistry and an ABI 377 automated sequencer (Applied Biosystems, Inc., Foster City, Calif.). Unresolved sequences were clarified by the dideoxy sequencing method with a Sequenase sequencing kit (U.S. Biochemical Corp., Cleveland, Ohio); 35S-labeled dATP (NEN Life Sciences, Inc.) was used for labeling, and the terminal deoxynucleotidyl transferase tailing method was used to extend prematurely truncated products (25). The sequence was resolved by electrophoresis in a 6% (wt/vol) urea-polyacrylamide gel as described by Sambrook et al. (38).
Soybean seed germination studies. The effect of disruption of cytokinin production in the miaA PPFMs on the ability of these organisms to increase germination of heat-treated soybean seeds was determined by using methods described by M. A. Holland (personal communication). Replicates (50 seeds each) were first heated at 45°C for 48 h, and then imbibition was allowed to occur in one of the following preparations for 5 h at room temperature with gentle shaking: fresh AMS medium, fresh AMS medium containing 15 µg of tetracycline per ml, M. extorquens liquid culture, miaA mutant liquid culture, M. extorquens spent medium, or miaA mutant spent medium. All cultures were grown to the stationary phase before they were used, and spent media were clarified by centrifugation before they were used. After imbibition, the seeds were drained and allowed to germinate for 5 days at room temperature in the dark on single layers of germination paper in covered glass petri dishes, after which the numbers of germinated seeds (seeds clearly producing radicles) were determined. At least two replicates were used for most treatments. The exceptions were the experiments performed with clarified spent medium; in these experiments single replicates consisting of 50 seeds each were used.
|
|
|---|
![]() View larger version (20K): [in a new window] |
FIG. 2. RIA analysis (A) and HPLC absorbance profile (B) of cytokinins isolated by the immunoaffinity procedure from spent media from cultures of the Arabidopsis PPFM isolate. The retention times of trans-zeatin (Z) and trans-zeatin riboside (ZR) standards are indicated by bars. Control media showed no activity in any fraction. The data were not corrected for recovery.
|
![]() View larger version (23K): [in a new window] |
FIG. 3. Cytokinins secreted into liquid cultures by a soil isolate of M. extorquens (A) and by plant leaf PPFM isolates obtained from maize (B), soybean (C), and barley (D). The retention times of trans-zeatin (Z) and trans-zeatin riboside (ZR) standards are indicated by bars. The retention times varied due to changes in HPLC gradient conditions resulting from a change in equipment. (B and C) Averages based on triplicate determinations; (A and D) averages based on duplicate determinations. The values were not corrected for recovery.
|
|
View this table: [in a new window] |
TABLE 2. Cytokinins recovered from supernatants of free-living PPFM cultures
|
![]() View larger version (13K): [in a new window] |
FIG. 4. Incorporation of tritiated adenine into trans-zeatin (Z), trans-zeatin riboside (ZR), and iPA by an Arabidopsis leaf PPFM isolate. The cross-hatched bars indicate the results when tritiated label was added at the time of inoculation and cultures were harvested during logarithmic growth (22 h). The solid bars indicate the results when label was added during logarithmic growth and cultures were harvested during stationary growth (44 h). The values are averages based on three replicate determinations.
|
Isolation of trans-zeatin from the tRNA of PPFMs. tRNA was isolated from the Arabidopsis PPFM isolate and from M. extorquens by a modification of the procedure outlined by Kelmers et al. (23), hydrolyzed and dephosphorylated (18), and then subjected to HPLC and RIA analysis as described above. Monoclonal antibodies to both stereoisomers of zeatin riboside were used in the analysis. Significant amounts of the trans isomer were detected by the RIA; approximately 6.2 ± 0.4 ng/mg of tRNA was isolated from M. extorquens (Fig. 5), and 17 ± 7 ng/mg of tRNA was recovered from Arabidopsis PPFM isolates (data not shown). These values are much lower than the 200 ng/mg reported for B. japonicum (40), but the recovery procedures differed; using our procedures, we recovered less than one-half of the previously reported levels of trans-zeatin riboside from B. japonicum tRNA (data not shown). No significant signal corresponding to the cis isomer was obtained, as shown by the lack of active fractions in an RIA for the cis isomer (Fig. 6). We also confirmed the presence of the trans isomer and the absence of the cis isomer for B. japonicum tRNA (data not shown).
![]() View larger version (13K): [in a new window] |
FIG. 5. RIA of trans-zeatin riboside (t-ZR) recovered from Arabidopsis PPFM tRNA. The values are averages based on two separate determinations. Twenty percent of the total tRNA hydrolysate from an 850-ml culture was used for analysis. The data were not corrected for losses. ZR, zeatin riboside.
|
![]() View larger version (9K): [in a new window] |
FIG. 6. RIA of the M. extorquens tRNA hydrolysate purified by anti-cis-zeatin immunoaffinity. The values are averages based on two separate determinations. Twenty percent of the total tRNA hydrolysate was used for analysis. The expected retention time of cis-zeatin (cZR) is indicated by a bar.
|
Isolation and disruption of the Methylobacterium miaA gene. We generated a probe for the M. extorquens miaA gene by performing PCR with partially degenerate primers (four sense primers and four antisense primers) for conserved amino acid sequences in known miaA genes (Fig. 1). When the primers were used in pairwise combinations, only one primer pair produced a product of the appropriate size. This 745-bp fragment was used to probe a genomic library in order to isolate a 3.3-kb fragment containing the complete miaA sequence (see Materials and Methods). We sequenced 2.2 kb of this fragment, including the miaA gene (GenBank accession number AAF452713). miaA is flanked by homologs of serB (encoding phosphoserine phosphatase) and mmsB (encoding 3-hydroxybutyrate dehydrogenase).
We disrupted miaA by a single homologous crossover with a 600-bp internal gene fragment in suicide plasmid pACY61 (8). Three of 15 exconjugates had homologous insertions of the suicide plasmid into the miaA gene (see Materials and Methods). Since the serB and mmsB flanking genes are both transcribed in the orientation opposite that of miaA, we presumed that the insertion had no polar effects. All miaA mutants grew normally compared with the progenitor on AMS/methanol medium under standard growth conditions (see Materials and Methods). The mutants did exhibit the temperature-sensitive growth characteristic of miaA mutants (34) of E. coli K-12; the miaA mutant PPFMs did not grow at 37°C, while wild-type M. extorquens grew slowly at this temperature. One of these mutants was chosen for further study.
The tRNA hydrolysate of the M. extorquens miaA mutant lacked both trans-zeatin riboside and iPA, as shown by the absence of the HPLC absorbance peaks with retention times corresponding to those of these cytokinins in the progenitor (wild type) (Fig. 7). There was also a corresponding absence of active fractions associated with these peaks in specific RIA (data not shown).
![]() View larger version (22K): [in a new window] |
FIG. 7. HPLC analysis showing the absence of trans-zeatin riboside (tZR) in tRNA of miaA mutants of M. extorquens. The position of trans-zeatin riboside isolated from wild-type M. extorquens tRNA is indicated in panel A, while a corresponding peak is not present for the mutant in panel B. Ev, electron potential.
|
![]() View larger version (26K): [in a new window] |
FIG. 8. HPLC analysis showing the absence of trans-zeatin (tZ) and trans-zeatin riboside (tZR) in the medium of an miaA mutant of M. extorquens. Peaks corresponding to trans isomers isolated from wild-type M. extorquens medium are indicated in panel A, while corresponding peaks are not present for the mutant in panel B. Ev, electron potential.
|
|
View this table: [in a new window] |
TABLE 3. Stimulation of germination of heat-treated soybean seeds by PPFMs, expressed as percent increases over values for control treatments with fresh AMS medium (wild type) or fresh AMS medium containing tetracycline (15 µg/ml) (mutant)
|
|
|
|---|
At first glance, the presence of the trans isomer of zeatin in spent medium was consistent with de novo cytokinin synthesis in PPFMs, despite the low levels recovered. All previous studies in which cytokinin biosynthesis was described indicated that tRNA-derived zeatin, both plant and bacterial, occurred solely as the cis isomer (7, 31, 32). However, in vitro assays for DMAT in M. extorquens and in a leaf PPFM isolate were consistently negative, and no signal was detected with anti-DMAT polyclonal antibodies in a total protein blot of either M. extorquens or a leaf isolate PPFM (from Arabidopsis) (unpublished data). Our inability to find evidence of DMAT activity is consistent with the results of the M. extorquens AM1 sequencing project (University of Washington, Seattle). No open reading frames with identity to ipt or tzs (the genes encoding isopentenyl transferase in Agrobacterium) have been identified yet, and an estimated 99% of the open reading frames have been examined by the project.
In the absence of de novo synthesis, the most logical alternative source of the secreted zeatin is tRNA. An examination of tRNA hydrolysates revealed the presence of zeatin and, surprisingly, the trans isomer instead of the cis isomer. This finding has only two previously described precedents. The trans isomer of zeatin was found in the tRNA of B. japonicum by Sturtevant and Taller (40), and the trans isomer of methylthioribosylzeatin was isolated from the tRNA of the rhizosphere bacterium Azotobacter vinelandii in 1985 (1). The evidence presented here for Methylobacterium is the first evidence that definitively links bacterial production of secreted trans-zeatin to a tRNA origin.
It should also be noted that no evidence for the presence of methylthiolated zeatin was found in the cytokinins isolated from Methylobacterium tRNA. Much of the work on modifications of the isopentenylated bases in tRNA has been performed with E. coli and Salmonella enterica serovar Typhimurium. E. coli does not hydroxylate the isopentenyl side chain of its tRNA. S. enterica serovar Typhimurium apparently requires that the adenine residue at position 37 first be methylthiolated on the purine ring by the miaB gene product (at position C-2) before hydroxylation of the isopentenyl side chain can occur (35). Only very small quantities of cis-zeatin riboside were found in Salmonella mutants lacking the ability to produce a methylthiolated adenine residue at position 37, suggesting that the cis-hydroxylase (miaE) requires methylthiolation to effectively recognize the tRNA substrate (36). No active peaks corresponding to the methythiolated derivative were obtained with PPFM tRNA, and thus far, no open reading frames with significant identity to any known miaE gene have been found in the M. extorquens AM1 genome.
The predominant form of zeatin secreted by PPFMs was the free base; the nucleoside was found irregularly and at low levels. B. japonicum, in contrast, secreted mainly the nucleoside (unpublished data). The opposite was the case for the nonhydroxylated counterparts; iPA was the only nonhydroxylated cytokinin isolated from Methylobacterium culture medium. No detectable iP was found. The reason for this remarkable difference is not known.
It is also difficult to determine if the levels of cytokinins produced by PPFMs are sufficient to have an effect in planta . Studies of cytokinin effects are often performed with cultured tissue and with cytokinin levels in the nanomolar to millimolar range. As cytokinin effects in the whole plant are in many cases the result of localized and transient changes in cytokinin levels, the possible effects of these low levels of production in the context of plant habitation by PPFMs are hard to project. The generation of a cytokinin-negative mutant should allow us to attempt to answer these questions.
The function of trans-zeatin in the tRNA of Methylobacterium in the absence of a relationship with plants is equally unclear. In Salmonella, hydroxylation-deficient mutants (miaE) are unable to utilize citric acid cycle intermediates as carbon sources (35, 36). Interestingly, a mutation in miaA is completely epistatic to this defect; miaA-miaE double mutants are able to utilize succinate, fumarate, and malate normally. E. coli, which naturally lacks a functional miaE gene but has a working miaA gene, is also able to utilize these intermediates, so the effect of hydroxylation of the isopentenyl side chain cannot be generalized among bacteria. It must be stressed that the detailed studies of the effects of the various modifications of the adenine residue at position 37 involved cis hydroxylations; so far, trans modifications have been found only in bacteria associated with plants either as nodule formers or as colonizers of the rhizhosphere or plant leaf surface. Considering the much higher activity of the trans isomer of zeatin than of the cis isomer of zeatin, it is attractive to speculate that there is a connection between this tRNA modification and a role in plant-microbe interactions.
Unfortunately, the precise nature of this connection was not illuminated in this study. Initial experiments performed by Holland and Polacco demonstrated that PPFMs can stimulate the germination of heat-treated soybean seeds, an effect that could be mimicked by exogenous application of benzyl adenine (21). A role for cytokinins in germination is not unprecedented. It has been shown that cytokinin levels in germinating seeds exhibit transient spikes that are timed closely with the initiation of germination (4, 24, 47). Since the miaA mutant of M. extorquens, in whose medium there was no detectable cytokinin, stimulated germination at a level indistinguishable from the level stimulated by the wild type, a role for cytokinins in this process is unlikely. There are other substances, however, that can mimic cytokinin effects in plants, and there are precedents for bacterial production of these substances. Nod factors, produced by members of the genera Rhizobium and Bradyrhizobium, can stimulate cortical cell division in a manner identical to the stimulation observed with cytokinins (10). It is possible that PPFMs, which are phylogenetically related to these bacteria, are able to produce substances similar to Nod factors. While Nod factor biosynthesis has not yet been demonstrated in M. extorquens, genes that are similar to the nodB, -C, -D, -J, and -T genes and to other genes have been identified in the M. extorquens AM1 genome. Crucially, NodA, which is required for Nod factor production, is conspicuously absent. However, another member of the genus, Methylobacterium nodulans, does have the nodA gene and can nodulate legumes belonging to the genus Croatalaria (41). It is also possible that stimulation of germination by PPFMs occurs by mechanisms completely unrelated to the mechanisms that stimulate cortical division during nodulation. Gibberellins also play a large role in the release of seeds from dormancy, and the possibility that PPFMs produce or stimulate this class of hormones has not been examined yet.
Understanding the nature of the exchange between the bacteria described here and their plant hosts and how the bacteria manage to live apparently undetected in close association with the plants may shed light on plant-microbe interactions in general. In particular, this system may serve as a model system for studying the effects of cytokinin production through tRNA turnover by a plant-associated bacterium that is not a known phytopathogen or symbiont. In addition to elucidating the possible roles of cytokinins in plant-microbe relationships, an examination of PPFM-produced cytokinins may shed some light on the importance of bacterially produced cytokinins for normal plant growth and development. The contribution of plant hormones produced by nonphytopathogenic bacteria to the growth and development of plants has never been fully examined.
This work was supported by a National Science Foundation graduate research fellowship (to R. Koenig).
Contribution 13,196 of the Missouri Agricultural Experiment Station Journal Series. ![]()
For a commentary on this article, see page 1818 in this issue. ![]()
Present address: Southern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, New Orleans, LA 70458. ![]()
|
|
|---|
2-isopentenyl)adenosine on cytokinin activity. Planta 145:239-243.[CrossRef]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»