This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crasta, K. C.
Right arrow Articles by Tan, H.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crasta, K. C.
Right arrow Articles by Tan, H.-M.

 Previous Article  |  Next Article 

Journal of Bacteriology, April 2002, p. 1932-1939, Vol. 184, No. 7
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.7.1932-1939.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Identification and Characterization of CAMP Cohemolysin as a Potential Virulence Factor of Riemerella anatipestifer

Karen C. Crasta,1 Kim-Lee Chua,1,2 Sumathi Subramaniam,1 Joachim Frey,3 Hilda Loh,4 and Hai-Meng Tan1,5*

Institute of Molecular Agrobiology, National University of Singapore, Singapore 117604, Departments of,1 Biochemistry ,2 Microbiology, National University of Singapore, Singapore 117597,5 Veterinary Laboratory Branch, Central Veterinary Laboratory, Singapore 548596, Singapore,4 Institute for Veterinary Bacteriology, University of Berne, CH-3012 Berne, Switzerland3

Received 3 October 2001/ Accepted 11 December 2001


arrow
ABSTRACT
 
Riemerella anatipestifer is responsible for exudative septicemia in ducks. The genetic determinant of the CAMP cohemolysin, cam, from a strain of R. anatipestifer was cloned and expressed in Escherichia coli. Chromosomal DNA from serotype 19 strain 30/90 was used to construct a gene library in pBluescript II SK(-) vector in E. coli XL-1-Blue strain. The clones containing recombinant plasmids were screened for the CAMP reaction with Staphylococcus aureus. Those that showed cohemolysis were chosen for further analysis by sequencing. One of these clones, JFRA8, was subcloned to identify the smallest possible DNA fragment containing the CAMP cohemolysin determinant, which was located on a 3,566-bp BamHI-BstXI fragment which specified a 1,026-bp open reading frame. Clones containing recombinant plasmids carrying cam obtained by PCR cloning into E. coli M15 strain secreted an active CAMP cohemolysin. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot analyses confirmed that the recombinant strain expressed a protein with a molecular mass of 37 kDa and that strains from serotypes 1, 2, 3, 5, 6, and 19 expressed the cohemolysin. The deduced amino acid sequence showed high homology to those of O-sialoglycoprotein endopeptidases. Hydrolysis of radioiodinated glycophorin A confirmed that Cam is a sialoglycoprotease.


arrow
INTRODUCTION
 
Riemerella anatipestifer is a gram-negative, nonmotile, non-spore-forming, rod-shaped bacterium (24) belonging to the Flavobacteriaceae family in rRNA superfamily V (27). It causes a contagious septicemic disease in domesticated ducklings, turkeys, and various other birds (5) and accounts for major economic losses in industrialized duck production due to weight loss, high mortality, and culling (23). The disease occurs as an acute or chronic septicemia characterized by fibrinous pericarditis, perihepatitis, airsacculitis, caseous salpingitis, and meningitis. In southeast Asia, R. anatipestifer infection has been a problem in the intensive production of meat ducks since 1982 (29).

Most work on R. anatipestifer has been centered on its serology. Currently, 21 serotypes have been identified by slide and tube agglutination tests with antisera (14, 19). Recently, repetitive-sequence-PCR-based fingerprints were used for subtyping R. anatipestifer isolates for epidemiological investigations (11). An OmpA protein was characterized for its possible use in serodetection of R. anatipestifer infection (28). Inactivated bacterins and live vaccines have successfully conferred protection against homologous strains or serotypes of R. anatipestifer but were unable to protect against heterologous serotype exposure (20, 22).

In contrast, there has been little work on the molecular basis of the pathogenesis of this organism, and so far no virulence factors have been established except for the identification of VapD, which shows homology to virulence-associated proteins of other bacteria (31). One of the goals of our laboratory is to identify and characterize virulence factors of R. anatipestifer. This study describes the CAMP cohemolysin. The CAMP effect describes the synergistic lysis of erythrocytes in the presence of diffusible substances, one of which is the CAMP cohemolysin, produced by microorganisms growing adjacent to each other on the surface of blood agar (6). Since the cohemolysin causes lysis of red blood cells, it is considered a potential virulence factor. In this study, R. anatipestifer strains of serotype 19 exhibited the CAMP phenomenon on blood agar.

To facilitate study of the role of CAMP in pathogenesis, which may eventually lead to the development of diagnostics and subunit vaccines, the CAMP cohemolysin gene, cam, of reference strain 30/90 of serotype 19 was cloned and expressed. The deduced amino acid sequence of Cam showed high homology to those of O-sialoglycoprotein endopeptidases. An assay was done to show that Cam is a sialoglycoprotease, leading to this first report of a cohemolysin being a protease.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and culture conditions. The Escherichia coli strains and plasmids used are listed in Table 1. Generally, E. coli strains were grown at 37°C in Luria-Bertani medium containing 100 µg of ampicillin ml-1 and 25 µg of kanamycin ml-1. The R. anatipestifer strains used for the CAMP test and Western blotting are listed in Table 2. CAMP-positive R. anatipestifer serotype 19 strain 30/90 served as the source of the cohemolysin determinant. All R. anatipestifer strains were grown on plates containing Trypticase soy agar and 5% sheep blood and incubated at 37°C in a candle jar for 24 to 48 h. Staphylococcus aureus was grown in brain heart infusion medium at 37°C.


View this table:
[in this window]
[in a new window]
 
TABLE 1. E. coli strains and plasmids


View this table:
[in this window]
[in a new window]
 
TABLE 2. List of R. anatipestifer strains used

CAMP test. This test was performed on Trypticase soy agar containing 5% sheep blood. The sphingomyelinase-producing S. aureus indicator strain was streaked vertically in a central position on the surface of the blood agar. The test strains were streaked perpendicular to the S. aureus streak. The plate was then incubated at 37oC for 18 to 24 h in a candle jar.

Preparation and manipulation of plasmid DNA. The general procedures for recombinant DNA technology (transformation, plasmid preparation, ligation, restriction enzyme digestion, and analytical gel electrophoresis) used for cloning, subcloning, and analysis of recombinant plasmids are described by Sambrook et al. (21).

Generation of the His tag fusion construct. Primers used for amplification of the cam determinant are CAMPB (with BamHI linker; GGCGGATCCATGAAACAATCTATTATC) and CAMPH (with HindIII linker; CGCAAGCTTTTACTTTACATTTAACTC. PCR was performed in a Hybaid Limited Touchdown thermal cycler by using a 50-µl reaction mixture (20 mM Tris-HCl [pH 8.8], 10 mM KCl, 2 mM MgSO4, 10 mM [NH4]2SO4, 200 µM [each] deoxynucleoside triphosphate, 100 pmol of each primer, 1 µg of plasmid DNA, and 1.25 U of Pfu polymerase mixture [Promega]). The PCR cycling parameters consisted of an initial denaturation at 95oC for 2 min; 30 cycles of 95oC for 1 min, 44oC for 1 min, and 72°C for 1 min; and a final extension step at 72oC for 5 min. The pQE30 His tag vector and the cam amplicon were digested with BamHI and HindIII, subjected to ligation, and transformed into E. coli M15 cells for overexpression. Both strands of the inserted fragment and vector cloning sites were sequenced to confirm the identity of the construct.

Purification of recombinant protein. The His tag fusion protein was induced with 0.1 mM IPTG at 37oC. Following induction, the cells were harvested and resuspended in a volume of ice-cold 10 mM Tris-Cl buffer, pH 7.5, that gave a concentration of 1 g wet weight of cells per ml of buffer. The resuspended cells were then subjected to sonication at 14 µm for 4 min (each cycle consisted of a 10-s burst followed by a 10-s interval). The fusion proteins were then purified from these cell extracts by using 50% Ni-nitrilotriacetic acid (NTA) slurry (Qiagen) according to manufacturer's instructions.

N-terminal sequencing. The purified Cam protein was separated by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-12% PAGE) and electroblotted onto a polyvinylidene difluoride (PVDF) membrane at 50 V for 1 h. The PVDF membrane was stained with Coomassie brilliant blue and destained, and the appropriate region carrying Cam was excised. This was then subjected to N-terminal amino acid analysis by the automated Edman procedure (Bioprocessing Technology Centre, National University of Singapore).

Production of antisera and immunological methods. Monospecific polyclonal antisera directed against the polyhistidine-tailed fusion protein were obtained by immunization of three New Zealand White rabbits with Freund's adjuvant (Sigma) emulsified with purified recombinant proteins. Each received initial intramuscular injections of 0.5 ml of Freund's complete adjuvant containing 0.5 mg of the recombinant protein in both their right and left hind thigh muscles. The rabbits received subsequent booster injections on days 14, 28, and 42 after primary immunization. Booster injections were prepared using Freund's incomplete adjuvant (Sigma) as the emulsifying agent and contained the same amount of recombinant protein as the primary immunization. Serum samples were collected before each injection and stored at -20oC for immunodetection of proteins from various R. anatipestifer strains. Purified recombinant proteins and whole-cell extracts were mixed with SDS sample buffer and boiled for 5 min, and subsequently immunoblot analysis was performed on 12% acrylamide gels. Membranes were probed with rabbit sera raised against the CAMP cohemolysin at 1:200 dilution and detected by using horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Pierce) at 1:20,000 dilution and the SuperSignal West Pico chemiluminescent substrate (Pierce).

Glycoprotease assay. Glycoprotease activity was monitored by the hydrolysis of human glycophorin A (GPA). An aliquot of the enzyme (0.2 mg) was incubated with 3.5 µg of 125I-GPA, prepared as described elsewhere (15, 16), in 50 mM HEPES (pH 7.4) in a total volume of 25 µl at 37°C for 3 h. Hydrolysis was terminated by the addition of sample buffer and boiling for 2 min. The substrate and the products were separated by SDS-PAGE on 12% gels, which were dried and autoradiographed to locate the radiolabeled bands. The enzyme activity of the glycoprotease at different pH values and in the presence of inhibitors was also tested. For the latter, Cam was preincubated with the inhibitor for 30 min at 37°C, pH 7.4, followed by the addition of soluble 125I-GPA. The mixture was further incubated for 1 h. Activity was calculated from the percent disappearance of GPA dimer bands on an autoradiogram, measured by using a densitometer.

Nucleotide sequence accession number. The GenBank accession number of the nucleotide sequence of the gene encoding the CAMP cohemolysin of R. anatipestifer serotype 19 strain 30/90, cam, is AF202727.


arrow
RESULTS
 
CAMP effect of R. anatipestifer strains. Out of the 35 strains listed in Table 2, only the three R. anatipestifer serotype 19 strains, 30/90, 53/91, and 59/91, showed clear zones or lysis of red blood cells on sheep blood agar with S. aureus after a 20-h incubation.

Cloning and sequence analysis of cam. Chromosomal DNA extracted from R. anatipestifer serotype 19 reference strain 30/90 was partially digested with Sau3A. These fragments were ligated into BamHI-digested pBluescript II SK(-) vector and subsequently transformed into E. coli XL1-Blue and selected on plates containing ampicillin, IPTG (isopropyl-ß-D-thiogalactopyranoside), and X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside). Transformants identified by blue/white selection were subjected to the CAMP test. Those that showed zones of clearing were CAMP positive and were subjected to sequencing. One clone containing hybrid plasmid pJFRA8, the vector of which contained a 6,906-bp insert, was chosen for further analysis. By using the National Center for Biotechnology Information (NCBI) ORF Finder (http://www.ncbi.nlm.nih.gov.), three putative protein-coding regions were found, and these were subjected to the NCBI BLASTX program (3) for determination of sequence homology.

To determine the location of the gene encoding the CAMP factor protein, the 6.9-kb R. anatipestifer insert in pJFRA8 was digested with BamHI and DraII to yield 2,308-bp fragment 1 and 4,600-bp fragment 3 (Fig. 1). Fragment 1 specified a 684-bp open reading frame (ORF) whose product has homology to a gamma glutamyl-transpeptidase precursor, while fragment 3 specified a 4,349-bp ORF whose product has homology to the reovirus attachment protein. These fragments were ligated to a DraII- and BamHI-digested pBluescript II SK(-) vector and transformed into XL1-Blue, yielding pHMT1 and pHMT3, respectively. Fragment 2 (3,566 bp) contained a 1,026-bp ORF whose product has homology to sialoglycoprotein endopeptidases. This was obtained by digestion with BamHI and BstXI, ligation to the pBluescript II SK(-) vector, and transformation into E. coli. Clones containing pHMT1, pHMT2, and pHMT3 carrying fragments 1, 2, and 3, respectively (Table 1), were subjected to the CAMP test. The gene responsible for cohemolysis was found to be located on fragment 2. PCR cloning of the 1,026-bp ORF was carried out using primers CAMB and CAMH to generate subclone HMT2A. The recombinant plasmid was sequenced to confirm the identity of the construct. CAMP activity was tested, and HMT2A showed a positive CAMP effect (Fig. 2). The gene was referred to as cam.



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1. Restriction enzyme map of recombinant plasmid pJFRA8 and the subclone derivatives. Only restriction sites relevant for cloning are given. Regions between arrowheads specify ORFs. Expression (+) and absence (-) of CAMP cohemolytic activity are indicated.



View larger version (110K):
[in this window]
[in a new window]
 
FIG. 2. CAMP cohemolysis of recombinant E. coli XL1-Blue containing pHMT2A. Vertical streak, S. aureus; horizontal streaks: 1 and 2, XL1-Blue strains harboring recombinant plasmid pHMT2; 3 and 4, XL1-Blue strains harboring recombinant plasmid pHMT2A; 5, XL1-Blue strain harboring recombinant plasmid pJFRA8 (positive control); 6, competent XL1-Blue (negative control); 7, R. anatipestifer serotype 19 30/90 strain; 8, XL1-Blue with pBluescript II SK(-) vector (negative control).

The deduced amino acid sequence of the 37-kDa Cam was 42% identical to that of O-sialoglycoprotein endopeptidase (Gcp) of Pasteurella haemolytica (accession no. A38108), 41% identical to that of Gcp of Pasteurella multocida (accession no. AAK03322), 41% identical to that of Gcp of Haemophilus influenzae (accession no. H64074), and 40% identical to that of Gcp of Haemophilus ducreyi (accession no. AAF32396) among others.

The sequence also showed a conserved region containing two conserved histidines, at amino acids 112 and 116, which, as for all the other metalloproteases, indicate the presence of potential zinc-binding sites (Fig 3). Analysis of the hydropathicity of the sequence by the TMpred program (http://www.ch.embnet.org) showed it to be predominantly hydrophilic, suggesting that Cam is a cytoplasmic or peripheral protein. An examination of the amino terminus showed no signal sequence, indicating that the mechanism of transport across the double membrane of bacteria for secretion was unconventional, similar to that of sialoglycoproteases found in other organisms (1, 30).



View larger version (94K):
[in this window]
[in a new window]
 
FIG. 3. Sequence alignment of the product of the cam gene of R. anatipestifer (RANAT) and sialoglycoprotein endopeptidases of H. influenzae (HAEIN), Haemophilus ducreyi (HAEDU), P. multocida (PASMU), and P. haemolytica (PASHA). Alignment was performed by the ClustalW program. Potential zinc-binding sites ({diamondsuit}) are indicated. Asterisks, identical or conserved residues; colons, conserved substitutions; single dots, semiconserved substitutions; dashes, gaps introduced to maximize alignment. Potential zinc-binding sites are shown in bold face.

Expression of cam in E. coli M15. The cam gene, obtained by PCR, was ligated to the pQE30 His tag vector, and the recombinant plasmid was transformed into E. coli M15 strain for high expression levels. The clone was CAMP positive. Expression of the fusion protein was induced by addition of 1 mM IPTG at mid-exponential growth, and cells were incubated for a further 4 h. A high level of expression of the recombinant His tag fusion protein with molecular mass of 37 kDa was observed upon induction and purification with Ni-NTA slurry (Fig 4). The Cam fusion protein was found in the soluble fraction. The N-terminal amino acid sequence analysis of Cam expressed in E. coli confirmed the assignment of the reading frame and also showed absence of a conventional signal sequence and of cleavage of amino acids from the N-terminal region.



View larger version (95K):
[in this window]
[in a new window]
 
FIG. 4. Overexpression and purification of His-Cam fusion protein. Cell lysates were processed by SDS-PAGE and stained with Coomassie blue. Purified His-Cam was obtained by affinity chromatography with Ni-NTA resin. Lanes: M, protein marker; 1, noninduced pQE30 vector; 2, induced pQE30 vector; 3, supernatant of noninduced sonicated cell lysates; 4, Supernatant of induced sonicated cell lysates; 5, purified His-Cam protein.

Amplification of the cam fragment from genomic DNA of R. anatipestifer strains. Primers CAMPB and CAMPH were used to amplify the genomic DNA from 35 different R. anatipestifer strains that were isolated from ducks with various manifestations of the disease. As shown in Fig. 5, PCR analysis showed the presence of the 1,026-bp amplification product in all of the R. anatipestifer serotype strains analyzed. The amplicons of strains showing the presence of the Cam protein and those showing the absence of the protein were sequenced and found to be identical.



View larger version (151K):
[in this window]
[in a new window]
 
FIG. 5. Detection of the cam gene from genomic DNA of serotypes of R. anatipestifer. Lanes: M, 1-kb marker; 1, E. coli HMT2A (positive control); 2, R. anatipestifer ATCC 11845; 3, serotype 1 (S1) 35/90; 4, S1 105/91; 5, S1 179/9; 6, S1 205/90; 7, S1 1795; 8, S2 17/91; 9, S2 2527; 10, S3 2554; 11, S4 2565; 12, S5 2550; 13, S6 389/82; 14, S7 27179; 15, S7 203/89; 16, S8 26220; 17, S9 1785; 18, S10 2/91; 19, S10 232/89; 20, S11 25055; 21, S11 76/91; 22, S11 84/91; 23, S13 134/90; 24, S13 25012; 25, S14 664/83; 26, S15 743/85; 27, S15 34/90; 28, S15 135/90; 29, S15 110/89; 30, S15 204/88; 31, S16 4801; 32, S17 977/83; 33, S18 540/86; 34, S19 30/90; 35, S19 53/91; 36, S19 59/91. Arrow, cam gene of 1,026 bp.

Immunodetection of Cam in R. anatipestifer stains. Immunoblot analysis of total-cell lysates of 35 R. anatipestifer strains revealed the presence of the 37-kDa protein in strains 35/90, 105/91, 179/9, and 1795 of serotype 1; strain 17/91 of serotype 2; strain 2554 of serotype 3; strain 2550 of serotype 5; strain 389/82 of serotype 6; and strains 30/90, 53/91, and 59/91 of serotype 19 (Fig. 6).



View larger version (110K):
[in this window]
[in a new window]
 
FIG. 6. Immunodetection of cohemolysin in total-cell lysates of R. anatipestifer strains. Bands correspond to the Cam protein at 37 kDa. Lanes: M, marker; C, purified Cam from pHMTC1 as a positive control; 1, R. anatipestifer ATCC 11845; 2, serotype 1 (S1) 35/90; 3, S1 105/91; 4, S1 179/9; 5, S1 205/90; 6, S1 1795; 7, S2 17/91; 8, S2 2527; 9, S3 2554; 10, S4 2565; 11, S5 2550; 12, S6 389/82; 13, S7 27179; 14, S7 203/89; 15, S8 26220; 16, S9 1785; 17, S10 2/91; 18, S10 232/89; 19, S11 25055; 20, S11 76/91; 21, S11 84/91; 22, S13 134/90; 23, S13 25012; 24, S14 664/83; 25, S15 743/85; 26, S15 34/90; 27, S15 135/90; 28, S15 110/89; 29, S15 204/88; 30, S16 4801; 31, S17 977/83; 32, S18 540/86; 33, S19 30/90; 34, S19 53/91; 35, S19 59/91.

Protease properties. The Cam protein was able to hydrolyze GPA (Fig. 7). The protease was stable over a pH range of 6.5 to 8.0 with a pH optimum of 7.5. The enzyme was inhibited by 1 mM EDTA, suggesting that it is a metalloprotease. This is further supported by the presence of the putative zinc-binding site in the protein structure predicted from the nucleotide sequence for cam. It was also inhibited by 5 mM citrate and 11 mM ascorbate. Phosphoramidon at 1 mM, a potent inhibitor of neutral metalloproteases such as thermolysin, did not have any effect on Cam. Lack of inhibition by phosphoramidon is consistent with the inability of the enzyme to hydrolyze thermolysin substate furoylacryloylglycylleucinamide. These results are similar to those with P. haemolytica glycoprotease (2).



View larger version (93K):
[in this window]
[in a new window]
 
FIG. 7. Autoradiograph of SDS-PAGE gel showing hydrolysis of 125I-GPA. Left lane, 1.75 µg of 125I-GPA; right lane, GPA incubated with 0.2 mg of Cam.


arrow
DISCUSSION
 
R. anatipestifer infection is probably the most economically important disease of farm ducks worldwide, but no virulence factors have been established so far except for the plasmid-carried vapD genes (31). Here, we report the identification of a CAMP cohemolysin as a potential virulence determinant in R. anatipestifer strains. CAMP factors that have been identified include the phospholipase C of Listeria monocytogenes (17), Apx toxins of Actinobacillus pleuropneumoniae (9), and lipases of S. aureus (8). CAMP factors have been shown to be virulence factors (7, 12, 25). Also, CAMP activity of A. pleuropneumoniae has been associated with its RTX toxins (9).

The cam gene was found to be common to all R. anatipestifer strains. However, only serotype 19 strains were observed to phenotypically exhibit cohemolytic activity with S. aureus on blood agar although Western blotting results revealed that strains from serotypes 1, 2, 3, 5, 6, and 19 expressed the Cam protein.

The CAMP effect involves at least two individual membrane-active components interacting sequentially with the erythrocyte membrane, which contains at least 45 mol% sphingomyelin (26). The first step involves a nonlytic hydrolysis of membrane sphingomyelin and phospholipids by sphingomyelinase or phospholipase (7). The "second-step agents," the CAMP cohemolysins, can then gain access to the membrane and induce further membrane destruction or cell lysis nonenzymatically (4, 7). Although the cohemolytic reactions are an in vitro phenomenon, they might be of relevance in vivo and might emerge from mixed infections producing two or more membrane-acting proteins or simply from the coexistence of different bacterial species in an appropriate location such as the upper respiratory tract. Field studies have shown that the bacterium rarely acts as a primary agent but rather that in most cases predisposing bacterial and viral infections are involved in causing disease (23). The natural environment of R. anatipestifer is the heart, brain, air sacs, bone marrow, lungs, and liver of ducklings, and the bacterium is thought to enter through the respiratory tract or skin punctures (23). The Cam protein shows high homology to O-sialoglycoprotein endopeptidases. As its name suggests, it is a neutral metalloprotease which has high specificity for O-sialoglycoproteins attached to serine or threonine residues, most of which are membrane proteins. Substrates include human GPA, CD34, CD43, CD44, and CD45; ligands for P- and L-selectins; tumor antigen epitectin; vascular adhesion protein VAP-1; platelet glycoprotein Ib; and cranin, a brain O-sialoglycoprotein (18). The best-characterized substrate is the transmembrane cell surface glycoprotein of human erythrocytes, GPA (18). Although it cannot be the physiological substrate for R. anatipestifer sialoglycoprotease, it was used to determine hydrolysis by Cam, as few glycoproteins from avian target cells are available for testing as potential in vivo substrates. Cam was able to hydrolyze GPA, demonstrating that it was a sialoglycoprotease. Similar membrane O-sialoglycoprotein substrates present in host cells, such as those present on the mucosal epithelia of the respiratory tracts of ducklings or on immune cell surfaces, may be the natural targets of this enzyme, thus contributing to its pathogenicity, as these are potential sites for an intrinsic cohemolytic reaction of R. anatipestifer with other organisms. The action of two or more factors on individual target structures could initiate events leading to structural and functional disorders and may contribute to the fibrinous exudates on the surfaces of infected organs and inflammatory exudates on lesions that are observed postmortem (23).

Variations of virulence as assessed by mortality and morbidity rates have been reported for the different serotypes and within a given serotype. Our results show that strains from serotypes 1, 2, 3, 5, 6, and 19 expressed the cohemolysin. Serotypes 1, 2, 3, 5, and 15 are most prevalent in severe outbreaks of septicaemia anserum exsudativa (19, 29). The presence of the cohemolysin could contribute to virulence, as it is produced by most of the prevalent serotypes, which may be better adapted at producing the cohemolysin during a natural infection under certain intracellular conditions and therefore able to damage the host and aid in the infection process, thus providing a function essential to pathogenesis. One possible consequence of hemolytic activity in vivo is the release of iron for use by the organism, as pathogenic bacteria require iron in the infection process (10).

The Cam protein of R. anatipestifer was found to possess properties similar to those of the sialoglycoprotease from P. haemolytica, which was considered a virulence factor (13). A Presponse vaccine has been designed based on the P. haemolytica recombinant sialoglycoprotease fusion protein (P. E. Shewen, A. Perets, C. W. Lee, and R. Y. C. Lo, Abstr. 3rd Int. Conf. Haemophilus, Actinobacillus, Pasteurella Organisms, abstr. P44, 1994). In addition, the CAMP factor of Streptococcus uberis (11a) has also been used in vaccine compositions. Thus, subunit vaccines of the CAMP cohemolysin of R. anatipestifer could be used for preventive or therapeutic measures against septicaemia anserum exsudativa of ducklings.

Work to further characterize the cohemolysin is under way. This should aid in the understanding of the potential role of Cam as a virulence determinant and the mechanisms of R. anatipestifer pathogenicity, which should help prevent disease.


arrow
ACKNOWLEDGMENTS
 
This work was supported by the RICURF grant from the National Science and Technology Board, Singapore, and is an extension of the Swiss Asia Foundation collaborative project between the Institute of Molecular Agrobiology and The Institute For Veterinary Bacteriology, University of Berne, Switzerland.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, National University of Singapore, 5 Science Dr. 2, Singapore 117597, Singapore. Phone: (65)-874 6407. Fax: (65)-776 6872. E-mail: mictanhm{at}nus.edu.sg. Back


arrow
REFERENCES
 
    1
  1. Abdullah, K. M., R. Y. C. Lo, and A. Mellors. 1991. Cloning, nucleotide sequence, and expression of the Pasteurella haemolytica A1 glycoprotease gene. J. Bacteriol. 173:5597-5603.[Abstract/Free Full Text]
  2. 2
  3. Abdullah, K. M., E. A. Udoh, P. E. Shewen, and A. Mellors. 1992. A neutral metalloprotease of Pasteurella haemolytica A1 specifically cleaves O-sialoglycoprotease. Infect. Immun. 60:56-62.[Abstract/Free Full Text]
  4. 3
  5. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  6. 4
  7. Bernheimer, A. W., R. Linder, and L. S. Avigad. 1979. Nature and mechanism of action of the CAMP protein of group B streptococci. Infect. Immun. 23:838-844.[Abstract/Free Full Text]
  8. 5
  9. Brogden, K. A. 1989. Pasteurella infection, p. 115-129. In C. Adlam and J. M. Rutter (ed.), Pasteurella and pasteurellosis. Academic Press, London, United Kingdom.
  10. 6
  11. Christie, R., N. E. Atkins, and E. Munch-Petersen. 1994. A note on lytic phenomenon shown by group B streptococci. Aust. J. Exp. Biol. Med. Sci. 22:197-199.
  12. 7
  13. Fehrenbach, F. J., D. Jurgens, J. Ruhlmann, B. Sterzik, and M. Ozel. 1988. Role of CAMP factor (protein B) for virulence, p. 351-357. In F. J. Fehrenbach, J. E. Alouf, P. Falmagne, W. Goebel, J. D. Jeljaszewicz-Jurgens, and R. Rappuoli (ed.), Bacterial protein toxins. Gustav Fisher Verlag, Stuttgart, Germany.
  14. 8
  15. Fehrenbach, F. J., and D. Jurgens. 1991. Cooperative membrane-active (lytic) processes, p. 187-213. In J. E. Alouf and J. H. Freer (ed.), Sourcebook of bacterial protein toxins. Academic Press Ltd, London, United Kingdom.
  16. 9
  17. Frey, J., R. Kuhn, and J. Nicolet. 1994. Association of the CAMP phenomenon in Actinobacillus pleuropneumoniae with the RTX toxins ApxI, Apx II and Apx III. FEMS Microbiol. Lett. 24:245-252.
  18. 10
  19. Hacker, J., and B. K. James. 2000. Pathogenicity islands and the evolution of microbes. Annu. Rev. Microbiol. 54:641-679.[CrossRef][Medline]
  20. 11
  21. Huang, B., S. Subramaniam, K.-L. Chua, J. Kwang, H. Loh, J. Frey, and H.-M. Tan. 1999. Molecular fingerprinting of Riemerella anatipestifer by repetitive sequence PCR. Vet. Microbiol. 67:213-219.[CrossRef][Medline]
  22. 11
  23. Jiang, M., A. A. Potter, and P. R. MacLachlan. January 1999. U.S. patent 5863543.
  24. 12
  25. Jurgens, D., B. Sterzik, and F. J. Fehrenbach. 1987. Unspecific binding of group B streptococcal cocytolysin (CAMP factor) to immunoglobulins and its possible role in pathogenicity. J. Exp. Med. 165:720-732.[Abstract/Free Full Text]
  26. 13
  27. Lee, C. W., P. E. Shewen, W. M. Cladman, and R. Y. C. Lo. 1994. Sialoglycoprotease pf Pasteurella haemolytica A1: detection of antisialoglycoprotease antibodies in sera of calves. Can. J. Vet. Res. 58:93-98.[Medline]
  28. 14
  29. Loh, H., T. P. Teo, and H. C. Tan. 1992. Serotypes of Pasteurella anatipestifer isolates from ducks in Singapore. Avian Pathol. 21:453-459.[CrossRef][Medline]
  30. 15
  31. Marchesi, V. T., and E. P. Andrews. 1971. Glycoproteins: isolation from cell membranes with lithium diiodosalicylate. Science 174:1247-1248.[Abstract/Free Full Text]
  32. 16
  33. Markwell, M. A. K. 1982. A new solid-state reagent to iodinate proteins. Anal. Biochem. 125:427-432.[CrossRef][Medline]
  34. 17
  35. McKellar, R. C. 1994. Identification of Listeria monocytogenes virulence factors involved in the CAMP reaction. Lett. Appl. Microbiol. 18:79-81.
  36. 18
  37. Mellors, A., and R. Y. C. Lo. 1995. O-Sialoglycoprotease from Pasteurella haemolytica. Methods Enzymol. 248:728-740.[Medline]
  38. 19
  39. Pathanasophan, P., T. Tanticharoenyos, and T. Sawada. 1994. Physiological characteristics, antimicrobial susceptibility and serotypes of Pasteurella anatipestifer isolated from ducks in Thailand. Vet. Microbiol. 39:179-185.[CrossRef][Medline]
  40. 20
  41. Pathanasophan, P., T. Sawada, T. Pramoolsinsap, and T. Tanticharoenyos. 1996. Immunogenicity of Riemerella anatipestifer broth culture bacterin and cell-free culture filtrate in ducks. Avian Pathol. 25:705-719.[CrossRef][Medline]
  42. 21
  43. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  44. 22
  45. Sandhu, T. S. 1991. Immunogenicity and safety of a live Pasteurella vaccine in White Pekin ducklings: laboratory and field trials. Avian Pathol. 20:423-432.[CrossRef][Medline]
  46. 23
  47. Sandhu, T. S., and R. B. Rimler. 1997. Riemerella anatipestifer infection, p. 161-166. In B. W. Calnek (ed.), Diseases of poultry, 10th ed. Iowa State University Press, Ames, Iowa.
  48. 24
  49. Segers, P., W. Mannheim, M. Vancanneyt, K. De Brandt, K. H. Hinz, K. Kersters, and P. Vandamme. 1993. Riemerella anatipestifer gen. nov., comb.nov., the causative agent of septicaemia anserum exsudativa, and its phylogenetic affiliation within the Flavobacterium-Cytophaga rRNA homology group. Int. J. Syst. Bacteriol. 43:768-776.[Abstract/Free Full Text]
  50. 25
  51. Skalka, B., and J. Smola. 1981. Lethal effect of CAMP-factor and UBERIS-factor—a new finding about diffusible exosubstances of S. agalactiae and S. uberis. Zentbl. Bakteriol. 249:190-194.
  52. 26
  53. Sterzik, B., and F. J. Fehrenbach. 1985. Reaction components influencing CAMP factor induced lysis. J. Gen. Microbiol. 131:817-820.[Abstract/Free Full Text]
  54. 27
  55. Subramaniam, S., K. L. Chua, H. M. Tan, H. Loh, P. Kuhnert, and J. Frey. 1997. Phylogenetic position of R. anatipestifer based on 16S rRNA gene sequences. Int. J. Syst. Bacteriol. 47:562-565.[Abstract/Free Full Text]
  56. 28
  57. Subramaniam, S., B. Huang, H. Loh, J. Kwang, H. M. Tan, K. L. Chua, and J. Frey. 2000. Characterization of a predominant immunogenic outer membrane protein of Riemerella anatipestifer. Clin. Diagn. Lab. Immunol. 7:168-174.[Abstract/Free Full Text]
  58. 29
  59. Teo, T. P., H. C. Tan, and H. Loh. 1992. Protective efficacy of a bivalent Pasteurella anatipestifer broth-grown bacterin in ducklings. Singap. J. Prim. Ind. 20:53-60.
  60. 30
  61. Watt, M.-A. V., A. Mellors, and R. Y. C. Lo. 1997. Comparison of the recombinant and authentic forms of the Pasteurella haemolytica A1 glycoprotease. FEMS Microbiol. Lett. 147:37-43.[CrossRef][Medline]
  62. 31
  63. Weng, S., W. Lin, Y. Chang, and C. Chang. 1999. Identification of a virulence-associated protein homolog gene and ISRa1 in a plasmid of Riemerella anatipestifer. FEMS Microbiol. Lett. 179:11-19.[CrossRef][Medline]


Journal of Bacteriology, April 2002, p. 1932-1939, Vol. 184, No. 7
0021-9193/02/$04.00+0     DOI: 10.1128/JB.184.7.1932-1939.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Danielli, A., Roncarati, D., Delany, I., Chiarini, V., Rappuoli, R., Scarlato, V. (2006). In Vivo Dissection of the Helicobacter pylori Fur Regulatory Circuit by Genome-Wide Location Analysis. J. Bacteriol. 188: 4654-4662 [Abstract] [Full Text]  
  • Litwin, C. M., Johnson, J. M. (2005). Identification, Cloning, and Expression of the CAMP-Like Factor Autotransporter Gene (cfa) of Bartonella henselae. Infect. Immun. 73: 4205-4213 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crasta, K. C.
Right arrow Articles by Tan, H.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crasta, K. C.
Right arrow Articles by Tan, H.-M.