Previous Article | Next Article ![]()
Journal of Bacteriology, August 2003, p. 4418-4423, Vol. 185, No. 15
0021-9193/03/$08.00+0 DOI: 10.1128/JB.185.15.4418-4423.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Laboratoire d'Ingénierie des Macromolécules,1 Laboratoire de Cristallographie Macromoléculaire, Institut de Biologie Structurale Jean-Pierre Ebel, (CEA, CNRS, UMR5075, UJF), 38027 Grenoble cedex 1, France2
Received 14 March 2003/ Accepted 5 April 2003
|
|
|---|
|
|
|---|
ß-Lactam action relies on the inhibition of a crucial step in the biosynthesis of the peptidoglycan, leading to cell lysis. The peptidoglycan is a strong netlike polymer responsible for maintaining the shape and size of the bacterial cell and for resisting the high intracellular osmotic pressure. Peptidoglycan consists of glycan chains of repeating ß-1,4-linked N-acetylglucosaminyl-N-acetylmuramyl units cross-linked through short peptide chains. The final steps of peptidoglycan biosynthesis occur extracellularly, associated with the plasma membrane, and are catalyzed by penicillin-binding proteins (PBPs) (6). In addition to harboring a short cytoplasmic region and a transmembrane helix, class A PBPs bear two enzymatic functions, namely, glycosyltransfer (GT) and transpeptidation (TP). The former is responsible for the elongation of the glycan strands, using as a substrate the disaccharide (N-acetylglucosaminyl-N-acetylmuramyl) pentapeptide anchored to the membrane by a 55-carbon undecaprenyl chain (lipid II), while the latter cross-links the peptide chains attached to the glycan strands. In addition to bifunctional PBPs, all bacterial species contain class B PBPs which harbor only the TP activity, as well as N- and C-terminal domains of unknown function (7). Penicillin and other ß-lactam antibiotics are specific inhibitors of the transpeptidase activity catalyzed by PBPs. ß-Lactams form a covalent complex with the active serine of the TP domain, preventing the cross-linking of stem peptides and weakening the peptidoglycan structure (9, 14).
PBPs have been validated as therapeutic targets through the efficiency of ß-lactams. It is then clear that the enzymatic GT domain, harbored by these same PBPs but insensitive to ß-lactams, represents a very promising therapeutic target. Deletion of class A PBPs genes in Escherichia coli, S. pneumoniae, and Bacillus subtilis showed that some combinations are lethal or induced dramatic morphological alterations, indicating that bifunctional PBPs have important roles in cell division and cell growth (2, 10, 16-18, 26). Furthermore, GT domains are located on the outer surface of the bacterial membrane and are consequently accessible to drug molecules. The unique competitive antibiotic directed against the GT activity is moenomycin, a molecule with a structure analogous to that of the lipid II substrate (12). Addition of moenomycin in E. coli cultures induced morphological modifications leading to cell lysis (23). In spite of this lethal effect, moenomycin is not used in human therapy due to poor absorption and long half-life (8).
Several points can be raised to understand why a new GT inhibitor is not yet available. Extensive screening of chemical libraries (of natural and synthesized molecules) did not succeed in the identification of lead molecules. Consequently, development of an inhibitor of GT activity requires the rational design of such molecules. This approach cannot be undertaken without the three-dimensional structure of a GT domain, complexed or not with ligands (lipid II and/or analogues and moenomycin and/or analogues). However, a major limitation is the limited availability of GT ligands (13). van Heijenoort and coworkers, as well as two industrial groups, have recently succeeded in purifying lipid II, allowing significant progress in the functional characterization of the GT activity of E. coli PBPs (19-22, 24). In addition, the isolation of the bifunctional proteins themselves, in soluble and stable form, poses a challenge which is undoubtedly linked to a membrane-recognizing region present in the GT region (5, 15, 25).
In this work, the polymerization of glycan chains by the extracellular region of S. pneumoniae PBP2a, namely, PBP2a* (the asterisk indicates the soluble form of the protein), is demonstrated for the first time. Dansylated lipid II was used as the substrate, and kinetic parameters were measured. We observed that the sequence between Lys 78 and Ser 156 is required for enzymatic activity, whereas it is dispensable for lipid II binding. In addition, we confirmed that this region of the protein is also involved in membrane interaction independently of the transmembrane anchor. The characterization of the catalytically active GT domain of S. pneumoniae PBP2a may contribute to the development of new inhibitors, which are urgently needed to renew the antibiotherapeutic arsenal.
|
|
|---|
Construction of the periplasmic form of pbp2aSGG from S. pneumoniae in pGEX-4T1 vector. The unencapsulated R6 strain of S. pneumoniae was anaerobically propagated in glucose-buffered broth (Diagnostics Pasteur) for 16 h at 30°C. Genomic DNA was extracted from 5 ml of culture with the High Pure PCR template preparation kit (Roche Molecular Biochemicals), following the manufacturer's instructions; 100 ng of genomic DNA was recovered in 200 µl of water. Genomic DNA from the R6 strain of S. pneumoniae was used as template (2 ng) to amplify the sequence of the pbp2aSGG gene (for which SGG represents the first three amino acids of the deleted protein [Fig. 1B]) by using Vent polymerase (New England Biolabs) with the upstream primer 5' CCCATATGGAGGAGAAACTTGTGCCGACCATC, which contains the NdeI site (in boldface), and the downstream primer 5' CCGCGGCCGCACCTCCTTCCATCAAAAACTTTTT, which contains the NotI site (in boldface). The PCR product was cloned into the pCR-Script vector (Stratagene) by following the manufacturer's instructions. After transformation into Epicurian Coli XL1-Blue supercompetent cells, clones containing the pbp2aSGG gene were selected as white colonies on IPTG X-Gal-ampicillin-containing agar plates. The pbp2aSGG gene was subcloned into a pGEX-4T1 vector (Amersham Biosciences). The resulting construct, pDG2aSGG, encodes a PBP2a variant, the so-called PBP2a*SGG, encompassing amino acids S156 to R678. PBP2a*, encoded by construct pJAH144 (5), and PBP2a*SGG are both fused to the glutathione S-transferase (GST) fused at the GT domain.
![]() View larger version (19K): [in a new window] |
FIG. 1. Schematic diagrams of S. pneumoniae PBP2a. (A) Topology of the native PBP2a protein. The solid and hatched boxes indicate the N-terminal cytoplasmic region and the membrane anchor, respectively. GT and TP domains are represented together with their conserved motifs; active site serine 410 is indicated by an asterisk. x represents any amino acid. The gray box and the arrows indicate the location of the identified GT and TP junction (5). (B) Schematic diagrams of the PBP2a-derived constructs. The peptide at the GST-GT junction of the PBP2a* construct includes sequences specific for thrombin, Tev protease, and factor Xa (italic characters) and N-terminal amino acids of GT (bold characters).
|
The purification of PBP2a* has been previously described (5). Briefly, the postsonication pellet was resuspended in buffer A containing 0.5% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS), and the suspension was submitted to rotary shaking. The supernatant containing the GST-PBP2a* fusion protein obtained from a 15-min centrifugation at 20,800 x g was loaded onto a 5-ml glutathione-Sepharose column (Amersham Biosciences) equilibrated in buffer A containing 0.5% CHAPS. The fusion protein was cleaved while bound to the column in the presence of 50 U of thrombin (Sigma) for 1 h at room temperature. The purification of the transpeptidase domain of PBP2a (TP2a) has been previously described (5).
Lipid II binding assay. Dansylated lipid II at a final concentration of 140 µM was incubated with PBP2a* (2 µM), PBP2a*SGG (2.8 µM), and TP2a (5.5 µM) for 15 min at room temperature before analysis by native polyacrylamide gel electrophoresis (PAGE); buffers corresponded to protein buffers described above. After migration, the fluorescence emitted by the dansyl group of lipid II was detected by illuminating the gel by UV light (Bio-Rad UV transilluminator): both free and bound lipid II forms could be detected. The gel was then stained by Coomassie blue to visualize the protein pattern.
Glycosyltransferase reaction (glycan chain polymerization). The reaction mix was composed of 40 mM piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES) (pH 6.1), 40 mM MgCl2, 0.16 mM KCl, 0.62 mM NH4Cl, 5 mM ATP, 0.4% CHAPS, and 20% dimethyl sulfoxide (DMSO). PBP2a* was used at a final concentration of 4 µM, and inhibitors (moenomycin and vancomycin) and lipid II were added last at various concentrations (see Results for details). The incubations were performed at 30°C for various periods of time. The reaction products were separated by thin-layer chromatography (TLC) on silica gels deposited on aluminum sheets (Fluka) in chloroform:methanol:water (20:12:3). Fluorescence detected under UV light was quantified with Molecular Analyst (Bio-Rad) software.
|
|
|---|
The pDG2aSGG construct allows the expression of PBP2a*SGG fused to the GST tag (Fig. 1), and it is expressed in E. coli cells as a soluble cytoplasmic protein. The GST fusion protein is purified on a glutathione-Sepharose column as an approximately 80-kDa species (Fig. 2, lane 2); the yield was approximately 10 mg of soluble protein per liter of E. coli culture. The fusion protein is cleaved by the Tev protease (Fig. 2, lane 3), and the resulting digestion products are reloaded onto a glutathione-Sepharose column in order to retain the GST contaminant. PBP2a*SGG present in the flowthrough has an apparent molecular mass of approximately 50 kDa, in good agreement with the calculated mass for PBP2a*SGG (57.2 kDa) (Fig. 2, lane 4). An ion-exchange chromatography on Resource Q completed the purification by eliminating minor contaminants (Fig. 2, lane 5). The homogeneity of purified PBP2a*SGG was verified by native PAGE analysis as shown on Fig. 3B, lane 3.
![]() View larger version (58K): [in a new window] |
FIG. 2. Purification of PBP2a*SGG. Proteins were separated by sodium dodecyl sulfate-12.5% PAGE and stained with Coomassie blue. Numbers at the left indicate sizes of standard molecular mass markers. Lanes: 1, molecular mass markers; 2, GST-PBP2a*SGG fusion following purification in a glutathione-Sepharose column; 3, fusion protein cleavage by Tev protease; 4, flowthrough from glutathione-Sepharose (10 µg of protein loaded on the gel); 5, elution from Resource Q column (30 µg of protein loaded on the gel).
|
![]() View larger version (32K): [in a new window] |
FIG. 3. Lipid II binding to PBP2a moieties. The binding was performed at room temperature for 15 min before loading onto native PAGE. Arrows indicate protein/lipid II complex. (A) Lanes: 1 and 3, PBP2a* (2 µM); 2 and 4, PBP2a* (2 µM) and lipid II (140 µM). The same gel was observed under UV light (lanes 1 and 2) before staining with Coomassie blue (lanes 3 and 4). (B) Lanes: 1 and 3, PBP2a*SGG (2.8 µM); 2 and 4, PBP2a*SGG (2.8 µM) and lipid II (140 µM). The same gel was observed under UV light (lanes 1 and 2) before staining with Coomassie blue (lanes 3 and 4). (C) Lanes: 1 and 3, TP2a (5.5 µM); 2 and 4, TP2a (5.5 µM) and lipid II (140 µM). The same gel was observed under UV light (lanes 1 and 2) before staining with Coomassie blue (lanes 3 and 4).
|
In order to verify the specificity of lipid II binding to the GT domain, the ligand binding test was performed on the TP domain isolated from PBP2a*. On a Coomassie blue-stained native gel, no TP protein shift is observed in the presence of lipid II (Fig. 3C, lane 4), and no modification was observed in the migration of fluorescent lipid II (Fig. 3C, lane 2), showing the absence of binding between the lipid II molecule and the PBP2a* TP domain. The modified migration of PBP2a* and absence of free lipid II (Fig. 3A) do not seem to result from the integration of the protein into the putative lipid II vesicles, since this is not observed for the two other proteins studied in similar conditions (Fig. 3B and C, PBP2a*SGG and TP2a, respectively). In conclusion, the GT domain of PBP2a* specifically binds to lipid II.
Glycosyltransferase activity of PBP2a*. The specificity of lipid II binding to PBP2a* prompted us to investigate the ability of this bifunctional PBP to polymerize glycan chains from the lipid II substrate. The enzymatic reaction was carried out as described in Materials and Methods. Substrate and polymerized products were detected following TLC under UV light as compounds harboring different Rfs, typically 0.28 to 0.38 and 0, respectively. The assay was carried out with lipid II (28 µM) and with proteins PBP2a* and PBP2a*SGG (4 µM); polymerized product was detected only with PBP2a* (data not shown). This result demonstrates that the sequence between Lys 78 and Ser 156 containing the first conserved motif (E131DxxFxxHxG) is important for the catalytic process.
Moenomycin is a competitive inhibitor of the GT activity due to its structural similarity to the substrate lipid II. Vancomycin is a glycopeptide antibiotic which binds to the D-alanyl-D-alanine moiety of the lipid II and the peptidoglycan precursors, inhibiting the two reactions catalyzed by PBPs. Both antibiotics were tested for their ability to inhibit the GT activity of PBP2a*. Moenomycin and vancomycin concentrations were adjusted to reach molar ratios of 0.1:1 and 1:1 in relation to lipid II (28 µM), respectively (Fig. 4). Fifty percent inhibition of the GT activity was reached when 2.8 µM moenomycin was added. No effect was detected with 2.8 µM vancomycin, while complete inhibition was observed with 28 µM vancomycin.
![]() View larger version (42K): [in a new window] |
FIG. 4. Inhibition of PBP2a* GT activity by moenomycin and vancomycin. Reaction mix composition and TLC conditions were as described in Materials and Methods. PBP2a* (4 µM), lipid II (28 µM), and the inhibitors moenomycin and vancomycin (2.8 and 28 µM) were used in the assay.
|
![]() View larger version (9K): [in a new window] |
FIG. 5. Kinetic analysis of PBP2a* GT activity. PBP2a* (4 µM) and lipid II concentrations ranging from 14 to 175 µM were used. The curve fit (as well as the associated errors) was generated by fitting data to the equation Vi/[E] = kcat · [lipid II]/Km + [lipid II] using Kaleidagraph.
|
|
|
|---|
Two distinct groups have performed the total synthesis of lipid II, a feat which will help overcome the lack of peptidoglycan synthesis substrate (13, 20, 24). In order to test the binding of lipid II onto PBP2a*, an electrophoretic assay which takes advantage of the fluorescence of dansylated lipid II was developed (3). A shift of the fluorescent band was observed in the presence of full-length PBP2a* but not in the presence of the isolated TP domain, leading to the conclusion that lipid II binds specifically to the GT domain of PBP2a*. Furthermore, PBP2a*SGG conserves the ability to bind to lipid II, although in a way different from that of PBP2a*. It might be that multiple lipid II binding sites are present in PBP2a*, some of which may have been removed in PBP2a*SGG.
To date, the polymerization of glycan chains by a bifunctional PBP had only been described for E. coli enzymes, among which PBP1b is the best characterized molecule from a kinetic point of view (19, 21). The description of the GT catalytic activity of S. pneumoniae PBP2a* reported here will expand upon the functional analysis of this important drug target. The variant PBP2a*SGG does not show GT activity, demonstrating that the sequence between Lys 78 and Ser 156 is important for the catalytic process. This result is in accordance with previous studies performed on E. coli PBP1b: mutation of Glu 233 of motif 1 led to a complete inhibition of the glycan chain elongation, suggesting an active role of the carboxyl group in the catalytic reaction (21). The kinetic parameters of the GT activity of PBP2a* were calculated from the Michaelis-Menten equation. The Km determined was 40.6 µM (± 15.5), which is 20-fold higher than the Km calculated for E. coli PBP1b (21) but still on the micromolar range. The kcat/Km efficiency of PBP2a* is much lower (approximately 7 orders of magnitude) than the E. coli PBP1b value (19, 21). The TLC method used in measuring the peptidoglycan synthesis by PBP2a* cannot be invoked for this discrepancy because similar E. coli PBP1b kcat/Km values were obtained by using either TLC (with radiolabeled lipid II) or a high-performance liquid chromatography-based assay (fluorescent substrate) (19, 21). The low kcat/Km value might be due to the lack of an important component in our in vitro assay. The screening of more reaction conditions will depend on the availability of a larger quantity of lipid II. Furthermore, the PBP2a* form (deleted from the cytoplasmic and transmembrane helix) used in this assay may not be optimal in terms of catalytic efficiency. Indeed, the E. coli PBP1b protein with the high kcat/Km value comprises its transmembrane anchor (21). Alternatively, we cannot exclude that the apparent low kcat/Km value of PBP2a* is due to the unavailability of most of the lipid II substrate, as it may be sequestered into vesicles.
Moenomycin is a well-known inhibitor of GT activity, and its antibiotic property has been well established (23). We and coworkers have previously shown moenomycin binding on the GT domain of PBP1a and PBP1b from S. pneumoniae (3, 4). In this work, we showed that glycan chain polymerization catalyzed by S. pneumoniae PBP2a* is inhibited by moenomycin. When this antibiotic was used at 2.8 µM, i.e., a moenomycin-to-lipid II molar ratio of 0.1:1, the quantity of polymerized material decreased by 50%, showing that the affinity of moenomycin for S. pneumoniae PBP2a* is in the micromolar range.
Vancomycin binds to the D-alanyl-D-alanine terminus of the peptidoglycan precursors (11). Consequently, the peptide cross bridge catalyzed by TP is competitively inhibited, and to a lesser extent, the GT reaction is inhibited through steric hindrance. The lipid II used in the enzymatic assay described in this work bears a dansyl tag on the L-lysine, preventing cross-linking by the TP activity. We observed inhibition of the GT reaction when vancomycin was added, although it was added in a larger quantity than moenomycin (not exceeding 10-fold larger, however). Our in vitro data support direct proof of the inhibition of glycosyltransferase activity by vancomycin.
In this work, the efficient polymerization of peptidoglycan glycan chains catalyzed by S. pneumoniae PBP2a* is described and characterized for the first time. In addition, a membrane-recognizing region, located between Lys 78 and Ser 156 and containing motif 1 of the GT domain, has also been identified. The functional GT domain of PBP2a* should be useful for developing screening procedures aimed at identifying antibiotics against S. pneumoniae.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»