Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Grogan, D. W. Search for Related Content PubMed PubMed Citation Articles by Grogan, D. W.

 Previous Article  |  Next Article 

Journal of Bacteriology, August 2003, p. 4657-4661, Vol. 185, No. 15
0021-9193/03/$08.00+0     DOI: 10.1128/JB.185.15.4657-4661.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Cytosine Methylation by the SuaI Restriction-Modification System: Implications for Genetic Fidelity in a Hyperthermophilic Archaeon

Dennis W. Grogan^*

New England Biolabs, Inc., Beverly, Massachusetts 01915

Received 24 February 2003/ Accepted 2 May 2003

Top Abstract Text References

 
5-Methylcytosine in chromosomal DNA represents a potential source of frequent spontaneous mutation for hyperthermophiles. To determine the relevance of this threat for the archaeon Sulfolobus acidocaldarius, the mode of GGCC methylation by its restriction-modification system, SuaI, was investigated. Distinct isoschizomers of the SuaI endonuclease were used to probe the methylation state of GGCC in native S. acidocaldarius DNA. In addition, the methylation sensitivity of the SuaI endonuclease was determined with synthetic oligonucleotide substrates and modified natural DNAs. The results show that the SuaI system uses N⁴ methylation to block cleavage of its recognition site, thereby avoiding the creation of G · T mismatches by spontaneous deamination at extremely high temperature.

Top Abstract Text References

 
Organisms ranging from bacteria to humans enzymatically methylate some C residues in duplex DNA to form the minor base 5-methylcytosine (5mC). Although not abundant, this modified base contributes a large proportion of the spontaneous C-to-T mutations observed in various genetic systems (3, 4). Diverse mechanisms for the mutagenicity of 5mC have been proposed previously (24, 26), but in Escherichia coli, two appear to be the most relevant: (i) an increased rate of spontaneous hydrolytic deamination, promoted by the methyl group on C-5 of the pyrimidine ring (5, 18, 25, 28), and (ii) relatively inefficient correction of the resulting G · T base pair in DNA (18). The mutational load caused by even low levels of 5mC in a prokaryotic genome apparently decreases evolutionary fitness, as argued by the following observations: (i) the gene responsible for forming 5mC at CC(A/T)GG in E. coli (dcm) is part of an operon encoding a corresponding sequence-specific G · T repair enzyme (vsr) (11), (ii) other DNA methyl transferases that form 5mC in bacteria are linked to genes resembling vsr (16), and (iii) vsr does not suppress all the mutagenesis caused by dcm expression (4, 18).

Cytosine DNA methyl transferases have been identified in a number of thermophilic archaea by genomic sequence analysis (7) or biochemical characterization of restriction-modification (R-M) systems (20, 21). This is significant, because the temperature dependence of cytosine deamination argues that the deleterious genetic effects of 5mC should be especially severe for extreme thermophiles (12, 17). In agreement with the DNA repair rationale inferred for mesophilic bacteria, G · T-specific repair enzymes have also been identified in two of these organisms (12, 27). In the third organism, however (Sulfolobus acidocaldarius), no G · T-specific DNA cleavage has been demonstrated in cell extracts, even though cleavage was evident at a G · U base pair under the assay conditions (D. Grogan, unpublished results).

The question of whether S. acidocaldarius has a G · T-specific glycosylase or endonuclease, though unresolved, draws attention to three apparently disparate properties of this archaeal species: (i) functioning of a GGCC-specific R-M system, designated SuaI (21), which implies the methylation of multiple cytosines throughout the chromosome; (ii) optimal growth at about 80°C (8), which implies a relatively high rate of spontaneous deamination of 5mC; and (iii) a low rate of spontaneous mutation, characterized by especially low frequencies of base pair substitutions (10, 13). One possible reconciliation of these three properties is based on the observation that the two target genes used for the mutation rate measurements (pyrE and pyrF) lack SuaI recognition sites (10). This fact raises the possibility that SuaI may generate 5mC at its recognition sites, which occur elsewhere in the S. acidocaldarius genome, and promote high rates of C-to-T transition at these sites. An alternative explanation is based on the observation that a number of R-M systems methylate the exocyclic N of cytosine to yield N⁴mC (14). This modified base occurs in the DNAs of both mesophiles and thermophiles (6) and thus does not seem to correlate strongly with high growth temperature. It does, however, provide a way to protect against restriction without the genetic disadvantages of 5mC, since (i) N⁴ methylation chemically stabilizes cytosine against spontaneous deamination (2, 5) and (ii) the deamination product, uracil, is readily excised from DNA by uracil DNA glycosylases, which are widely distributed among hyperthermophilic archaea (15, 22, 23). In order to resolve whether SuaI recognition sites represent potential mutational hot spots in the S. acidocaldarius genome not detected by previous assays, I investigated which of these two modes of C methylation is used by the SuaI system.

Sources of enzymes. Cells of wild-type S. acidocaldarius strain DG185 were grown, harvested, and stored frozen as previously described (19). Extracts were prepared by adding the following to a thawed cell suspension: K₂HPO₄ (50 mM), KCl (0.5 M), MgSO₄ (5 mM), and sodium N-lauryl sarcosine (0.4%). After 5 min of gentle mixing at room temperature, the mixture was centrifuged for 30 min at 13,000 x g and 4°C. The clear supernatant was removed and dialyzed overnight against 40 mM Tris-HCl (pH 7.5)-50 mM KCl; aliquots were stored frozen (-20°C) until use. For assays using oligonucleotide substrates, SuaI activity was partially purified from cell extracts by chromatography over phosphocellulose (Whatman P11), under conditions similar to those of Prangishvili et al. (21). Two active fractions of 2.5 ml each were pooled and concentrated to 0.5 ml. An equal volume of glycerol was then added, and the preparation was stored at -20°C. Endonuclease EsaBC4I, partially purified from an overproducing E. coli strain, was generously provided by R. D. Morgan. All other enzymes were those commercially available from New England Biolabs (NEB). Endonucleases SuaI and EsaBC4I were assayed in 1x NEB buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl₂) at 70°C. Other enzymes were assayed under conditions specified by NEB.

DNA substrates. Genomic DNA of S. acidocaldarius was purified by phenol extraction and banding in a CsCl-ethidium bromide density gradient as previously described (9). Genomic DNA of E. coli was purified by batch chromatography (DNEasy; QIAGEN). Plasmid (pUC19) and bacteriophage DNAs were from NEB. For some experiments, these DNAs were methylated at GGCC sites by incubating 20 µg of DNA for 1 h at 37°C with 30 U of HaeIII methylase and 4 nmol of S-adenosylmethionine in a total volume of 50 µl of HaeIII methylase buffer (50 mM NaCl, 50 mM Tris-HCl [pH 8.5], 10 mM dithiothreitol). Complete methylation was confirmed by incubating 0.5 µg of the resulting DNA for 1 h at 37°C with 10 U of HaeIII endonuclease. Agarose gel electrophoresis revealed no detectable digestion products.

Oligonucleotides containing a fluorescein label at the 3' end were synthesized by the NEB organic synthesis division by phosphoramidite coupling. The basic nucleotide sequences were 5'[AAAAACACCGGTGCGGCCGCAGACGAACGTCAAAAA]3' (upper strand) and 5'[TTTTTGACGTTCGTCTGCGGCCGCACCGGTGTTTTT]3' (lower strand). Methylated cytosine residues (C-5 or N⁴) were incorporated into the first or second C of GGCC (italicized) during synthesis. Each single-stranded oligonucleotide was dissolved in 10 mM Tris-HCl, pH 8.3, to a concentration of 10 µM and annealed to an equimolar amount of its complement.

Cleavage assays. Genomic (640 ng), plasmid (160 ng), or bacteriophage (160 ng) DNA was incubated for 1 h with 1 µl of endonuclease diluted in diluent buffer A (50 mM KCl, 10 mM Tris-HCl [pH 7.4], 0.1 mM EDTA, 1 mM dithiothreitol, 200 µg of bovine serum albumin per ml, 50% [vol/vol] glycerol) in a total volume of 10 µl of NEB buffer 2. Extent of cleavage was determined by agarose gel electrophoresis in 1x Tris-borate-EDTA buffer containing ethidium bromide. Fluorescently labeled double-stranded oligonucleotide (0.5 pmol) was similarly incubated with endonuclease but electrophoresed through Tris-borate-EDTA-buffered polyacrylamide gels. DNAsin both agarose and acrylamide gels were visualized with a 302-nm-wavelength transilluminator, and digital images were recorded with a charge-coupled-device camera (Alpha Innotec, Inc.)

Enzyme probes of GGCC methylation. Isoschizomers can differ with respect to their ability to cleave methylation variants of their common recognition site, providing a means to determine the methylation state of that site in natural DNAs. As differential levels of sensitivity to the position of 5mC had been observed for the GGCC-specific endonucleases HaeIII and EsaBC4I (http://rebase.neb.com), I tested these two enzymes for the effects of N⁴ methylation, using synthetic DNA substrates (see above). Results of incubating unmethylated and four symmetrically methylated forms of GGCC are shown in Fig. 1. R.HaeIII (HaeIII restriction endonuclease) (Fig. 1A) was blocked by either form of methylation of the inner Cs, whereas R.EsaBC4I (Fig. 1B) was blocked only by N⁴mC at this position. The combination of these two enzymes could therefore distinguish GG5mCC (cleaved only by R.EsaBC4I), GGN⁴mCC (cleaved by neither enzyme), and GGCC that was either unmethylated or methylated only on the outer C residues (cleaved by both enzymes).

View larger version (71K): [in this window] [in a new window]

FIG. 1. Discrimination of GGCC methylation by isoschizomers of SuaI. Fluorescent oligonucleotide duplexes were incubated with excess endonuclease and resolved on polyacrylamide gels as described in the text. Lanes: un, unmethylated site; 5i, methyl group on carbon 5 of the inner C residue; 5o, methyl on carbon 5 of the outer C; 4i, methyl group on nitrogen 4 of the inner C; 4o, methyl group on nitrogen 4 of the outer C. (A) Fifty units of HaeIII; (B) 50 U of EsaBC4I.

These differences in methylation sensitivity were then used to evaluate SuaI recognition sites in S. acidocaldarius genomic DNA. Neither R.HaeIII nor R.EsaBC4I cut S. acidocaldarius DNA, whereas R.HindP1I and R.BstUI, which recognize similar tetranucleotides, cut frequently (Fig. 2). This result was obtained when purified genomic DNA was first digested to completion with R.HindIII (data not shown). The activities of R.HaeIII and R.EsaBC4I under these conditions was confirmed with bacteriophage DNA (Fig. 2) and E. coli chromosomal DNA (data not shown).

View larger version (48K): [in this window] [in a new window]

FIG. 2. Specific resistance of S. acidocaldarius DNA to GGCC-targeted endonucleases. S. acidocaldarius DNA was treated with 10 U of the indicated endonucleases and electrophoresed in an agarose gel. Abbreviations (recognition sequence): M, molecular size markers (numbers at left are numbers of base pairs [in thousands]); Hin (GCGC), HinPII; Hae (GGCC), HaeIII; con, control (no enzyme); BC4 (GGCC), EsaBC4I; Bst (CGCG), BstUI. Incubations with BstUI were at 60°C; all other incubations were as described in the text.

Methylation sensitivity of R.SuaI. The observed resistance of S. acidocaldarius DNA to both R.HaeIII and R.EsaBC4I implied N⁴ methylation at the inner C residues of GGCC sites in S. acidocaldarius DNA. One possible consequence of this methylation is that the corresponding endonuclease, R.SuaI, may cleave other symmetrically methylated forms of GGCC with reasonable efficiency, as was observed for R.EsaBC4I (http://rebase.neb.com). This situation was confirmed with synthetic substrates and various amounts of partially purified R.SuaI. Only N⁴ methylation on the inner C residue blocked cleavage by excess R.SuaI (Fig. 3A). This result is distinct from that obtained with R.HaeIII under the same conditions (Fig. 3B) and is consistent only with N⁴ methylation of S. acidocaldarius DNA in vivo. To confirm the methylation sensitivity of SuaI, high-molecular-weight chromosomal DNA was purified from an E. coli strain expressing the EsaBC4I R-M system (R. D. Morgan, unpublished data). This DNA was readily cleaved by R.HindIII, but treatment with crude S. acidocaldarius extract in several different restriction buffers produced no detectable endonuclease cleavage (Fig. 3C). This result indicated that SuaI is the only R-M system detected in S. acidocaldarius and that N⁴ methylation of the inner C in the recognition site is necessary and sufficient to protect against it.

View larger version (58K): [in this window] [in a new window]

FIG. 3. Methylation sensitivity of SuaI. Fluorescent oligonucleotides were digested with the indicated amounts of partially purified SuaI or commercially available HaeIII. (A) SuaI; (B) HaeIII. Lane abbreviations and other conditions were as described for Fig. 1. (C) Three micrograms of EsaBC4I-modified DNA of E. coli was incubated for 2 h at 70°C with 15 µl of S. acidocaldarius extract (equivalent to about 100 U of SuaI); other the conditions were as described in the legend to Fig. 2. Lane designations indicate NEB buffers 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2), 3 (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2), 4 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate), or SalI (150 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2) (b2, b3, b4, and bS, respectively). All buffers were at pH 7.9 and included 1 mM dithiothreitol. The controls were incubated without S. acidocaldarius extract (con) or preincubated for 1 h at 37°C with 30 U of HindIII (+Hin). Lane M, molecular size markers.

The relative efficiency with which R.SuaI cleaves GG5mCC was quantified more precisely using plasmid and phage DNA substrates. Unmodified and M.HaeIII (HaeIII methylase)-modified DNAs were each incubated with various dilutions of enzyme, and the equivalence of activities was identified as the generation of similar incomplete-digestion patterns; the results of one of these comparisons is shown in Fig. 4. Three independent experiments (two using pUC19 and one using bacteriophage ) determined the number of 1:2 dilutions of enzyme that gave a partial digest of unmodified DNA equivalent to that observed with M.HaeIII-modified DNA. The average value for SuaI, 3.16 (standard deviation, 0.25), represents 11% residual activity on M.HaeIII-methylated DNA. A similar value was obtained for EsaBC4I, whereas no cleavage of the modified DNAs by excess R.HaeIII could be detected, corresponding to <0.08% of control activity.

View larger version (147K): [in this window] [in a new window]

FIG. 4. Relative efficiency on GG5mCC. Unmodified and M.HaeIII-modified pUC19 DNAs were treated with the indicated amounts (in microliters) of SuaI (cell extract). Methylated DNA is indicated by "m"; arrowheads identify equivalent degrees of partial endonuclease digestion.

Conclusions. S. acidocaldarius is the only hyperthermophilic archaeon in which the rate and spectrum of spontaneous mutation has been accurately analyzed in vivo (10, 13), making it a significant model of genetic fidelity at extremely high temperatures. The following results presented here demonstrate that SuaI uses N⁴ methylation of the inner C to protect its recognition sequence (GGCC) from restriction: (i) highly purified S. acidocaldarius genomic DNA was resistant to R.SuaI, R.HaeIII, and R.EsaBC4I but not to endonucleases specific for similar sequences occurring at similar frequencies; (ii) the only symmetrically methylated synthetic substrate that resisted cleavage by R.HaeIII and R.EsaBC4I was GGN⁴mCC; and (iii) N⁴ methylation of the inner C was necessary and sufficient to protect an oligonucleotide duplex or E. coli DNA against S. acidocaldarius extract. It should also be noted that polyclonal antibody specific for DNA containing N⁴mC binds to genomic DNA of S. acidocaldarius but not to control DNA (T. Bhatia and D. Grogan, unpublished results), which provides independent support for this conclusion.

Use of the "genetically benign" N⁴ cytosine methylation effectively discounts the SuaI system as a significant source of spontaneous mutation in S. acidocaldarius. This conclusion is further supported by observations that SuaI recognition sites are very rare in the S. acidocaldarius genome: only 84 occurrences of GGCC were found in 2.14 Mbp of genomic sequence, for example (L. Chen, K. Brügger, and R. Garrett, personal communication). This frequency corresponds to about 0.004 mol% of N⁴mC, which explains why standard high-performance liquid chromatography analysis failed to detect modified nucleotides in hydrolysates of S. acidocaldarius DNA (9). Similar underrepresentation of GGCC is not evident in the Sulfolobus tokodaii or Sulfolobus solfataricus genomes (http://rebase.neb.com), suggesting that certain oligonucleotides in the genomes of various Sulfolobus lineages have been subjected to rather different selective forces. Investigating this question will be greatly aided by the imminent completion of the S. acidocaldarius genomic sequence.

Finally, it should be noted that these results have practical implications for developing additional genetic capabilities in S. acidocaldarius. The SuaI recognition site (GGCC) is abundant in conventional vectors (22 occurrences in pUC19, for example), and transformation protocols for S. acidocaldarius have accordingly used methylation of constructs by M.HaeIII as a means to avoid SuaI restriction (1). In the present study, however, I found SuaI to cleave M.HaeIII-modified DNA with reasonable efficiency and to be present at high levels in crude cell extracts (about 5,000 U per mg of protein). Thus, pretreatment with M.HaeIII is not expected to provide much protection for vector sequences introduced into S. acidocaldarius cells.

 
I thank E. Raleigh and J. Bitinaite for expert advice, encouragement, and the use of facilities; R. Morgan for E. coli strains and preparations of EsaBC4I endonuclease; and L. Chen, K. Brügger, and R. Garrett for communicating unpublished results.

This work was supported by Donald Comb (NEB) and the University of Cincinnati.

 
* Present address: Department of Biological Sciences, University of Cincinnati, Cincinnati, Ohio 45221-0006. Phone: (513) 556-9748. Fax: (513) 556-5299. E-mail: grogandw{at}email.uc.edu.

Top Abstract Text References

 

1
1. Aravalli, R. N., and R. A. Garrett. 1997. Shuttle vectors for hyperthermophilic archaea. Extremophiles 1:183-191.[CrossRef][Medline]
2
2. Cohen, R. M., and R. Wolfenden. 1971. The equilibrium of hydrolytic deamination of cytidine and N⁴-methylcytidine. J. Biol. Chem. 246:7566-7568.[Abstract/Free Full Text]
3
3. Cooper, D. N., and H. Youssoufian. 1988. The CpG dinucleotide and human disease. Hum. Genet. 78:151-155.[CrossRef][Medline]
4
4. Coulondre, C., J. H. Miller, P. J. Farabaugh, and W. Gilbert. 1978. Molecular basis of substitution hot spots in Escherichia coli. Nature 274:775-780.[CrossRef][Medline]
5
5. Ehrlich, M., K. F. Norris, R. Y. Wang, K. C. Kuo, and C. W. Gehrke. 1986. DNA cytosine methylation and heat-induced deamination. Biosci. Rep. 6:387-393.[CrossRef][Medline]
6
6. Ehrlich, M., G. G. Wilson, K. C. Kuo, and C. W. Gehrke. 1987. N⁴-Methylcytosine as a minor base in bacterial DNA. J. Bacteriol. 169:939-943.[Abstract/Free Full Text]
7
7. Fitz-Gibbon, S. T., H. Ladner, U. J. Kim, K. O. Stetter, M. I. Simon, and J. H. Miller. 2002. Genome sequence of the hyperthermophilic crenarchaeon Pyrobaculum aerophilum. Proc. Natl. Acad. Sci. USA 99:984-989.[Abstract/Free Full Text]
8
8. Grogan, D. W. 1989. Phenotypic characterization of the archaebacterial genus Sulfolobus: comparison of five wild-type strains. J. Bacteriol. 171:6710-6719.[Abstract/Free Full Text]
9
9. Grogan, D., P. Palm, and W. Zillig. 1990. Isolate B12, which harbours a virus-like element, represents a new species of the archaebacterial genus Sulfolobus, Sulfolobus shibatae, sp. nov. Arch. Microbiol. 154:594-599.[Medline]
10
10. Grogan, D. W., G. T. Carver, and J. W. Drake. 2001. Genetic fidelity under harsh conditions: analysis of spontaneous mutation in the thermoacidophilic archaeon. Sulfolobus acidocaldarius. Proc. Natl. Acad. Sci. USA 98:7928-7933.[Abstract/Free Full Text]
11
11. Hennecke, F., H. Kolmar, K. Brundl, and H.-J. Fritz. 1991. The vsr gene product of E. coli K-12 is a strand- and sequence-specific DNA mismatch endonuclease. Nature 353:776-778.[CrossRef][Medline]
12
12. Horst, J. P., and H. J. Fritz. 1996. Counteracting the mutagenic effect of hydrolytic deamination of DNA 5-methylcytosine residues at high temperature: DNA mismatch N-glycosylase Mig.Mth of the thermophilic archaeon Methanobacterium thermoautotrophicum THF. EMBO J. 15:5459-5469.[Medline]
13
13. Jacobs, K. L., and D. W. Grogan. 1997. Rates of spontaneous mutation in an archaeon from geothermal environments. J. Bacteriol. 179:3298-3303.[Abstract/Free Full Text]
14
14. Janulaitis, A., S. Klimasauskas, M. Petrusyte, and V. Butkus. 1983. Cytosine modification in DNA by BcnI methylase yields N⁴-methylcytosine. FEBS Lett. 161:131-134.[CrossRef][Medline]
15
15. Koulis, A., D. A. Cowan, L. H. Pearl, and R. Savva. 1996. Uracil-DNA glycosylase activities in hyperthermophilic micro-organisms. FEMS Microbiol. Lett. 143:267-271.[CrossRef][Medline]
16
16. Kulakauskas, S., J. M. Barsomian, A. Lubys, R. J. Roberts, and G. G. Wilson. 1994. Organization and sequence of the HpaII restriction-modification system and adjacent genes. Gene 142:9-15.[CrossRef][Medline]
17
17. Lindahl, T., and T. Nyberg. 1974. Heat-induced deamination of cytosine residues in deoxyribonucleic acid. Biochemistry 13:3405-3410.[CrossRef][Medline]
18
18. Lutsenko, E., and A. S. Bhagwat. 1999. Principle causes of hot spots for cytosine to thymine mutations at sites of cytosine methylation in growing cells: a model, its experimental support, and applications. Mutat. Res. 437:11-20.[CrossRef][Medline]
19
19. Maiorano, J. N., and D. W. Grogan. 1999. Extremely thermostable orotidine-5'-monophosphate decarboxylase from the archaeon Sulfolobus acidocaldarius. FEMS Microbiol. Lett. 174:81-87.[CrossRef]
20
20. Nölling, J., and W. M. de Vos. 1992. Characterization of the archaeal, plasmid-encoded type II restriction-modification system MthT1 from Methanobacterium thermoformicicum THF: homology to the bacterial NgoPII system from N. gonorrhoeae. J. Bacteriol. 174:5719-5726.[Abstract/Free Full Text]
21
21. Prangishvili, D. A., R. P. Vashakidze, M. G. Chelidze, and I. Y. Gabriadze. 1985. A restriction endonuclease SuaI from the thermoacidophilic archaebacterium Sulfolobus acidocaldarius. FEBS Lett. 192:57-60.[CrossRef][Medline]
22
22. Sandigursky, M., and W. A. Franklin. 2000. Uracil-DNA glycosylase in the extreme thermophile Archaeoglobus fulgidus. J. Biol. Chem. 275:19146-19149.[Abstract/Free Full Text]
23
23. Sartori, A. A., P. Schar, S. Fitz-Gibbon, J. H. Miller, and J. Jiricny. 2001. Biochemical characterization of uracil processing activities in the hyperthermophilic archaeon Pyrobaculum aerophilum. J. Biol. Chem. 276:29979-29986.[Abstract/Free Full Text]
24
24. Shen, J. C., W. M. Rideout III, and P. A. Jones. 1992. High frequency mutagenesis by a DNA methyltransferase. Cell 71:1073-1080.[CrossRef][Medline]
25
25. Shen, J. C., W. M. Rideout III, and P. A. Jones. 1994. The rate of hydrolytic deamination of 5-methyl cytosine in double-stranded DNA. Nucleic Acids Res. 22:972-976.[Abstract/Free Full Text]
26
26. Yang, A. S., J. C. Shen, J. M. Zingg, S. Mi, and P. A. Jones. 1995. HhaI and HpaI DNA methyltransferases bind DNA mismatches, methylate uracil and block DNA repair. Nucleic Acids Res. 23:1380-1387.[Abstract/Free Full Text]
27
27. Yang, H., S. Fitz-Gibbon, E. M. Marcotte, J. H. Tai, E. C. Hyman, and J. H. Miller. 2000. Characterization of a thermostable DNA glycosylase specific for U/G and T/G mismatches from the hyperthermophilic archaeon Pyrobaculum aerophilum. J. Bacteriol. 182:1272-1279.[Abstract/Free Full Text]
28
28. Zhang, X., and C. K. Mathews. 1994. Effect of DNA cytosine methylation upon deamination-induced mutagenesis in a natural target sequence in duplex DNA. J. Biol. Chem. 269:7066-7069.[Abstract/Free Full Text]

---

Journal of Bacteriology, August 2003, p. 4657-4661, Vol. 185, No. 15
0021-9193/03/$08.00+0     DOI: 10.1128/JB.185.15.4657-4661.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Berkner, S., Grogan, D., Albers, S.-V., Lipps, G. (2007). Small multicopy, non-integrative shuttle vectors based on the plasmid pRN1 for Sulfolobus acidocaldarius and Sulfolobus solfataricus, model organisms of the (cren-)archaea. Nucleic Acids Res 0: gkm449v1-12 [Abstract] [Full Text]  
• Chen, L., Brugger, K., Skovgaard, M., Redder, P., She, Q., Torarinsson, E., Greve, B., Awayez, M., Zibat, A., Klenk, H.-P., Garrett, R. A. (2005). The Genome of Sulfolobus acidocaldarius, a Model Organism of the Crenarchaeota. J. Bacteriol. 187: 4992-4999 [Abstract] [Full Text]  
• Xiang, X., Chen, L., Huang, X., Luo, Y., She, Q., Huang, L. (2005). Sulfolobus tengchongensis Spindle-Shaped Virus STSV1: Virus-Host Interactions and Genomic Features. J. Virol. 79: 8677-8686 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Grogan, D. W. Search for Related Content PubMed PubMed Citation Articles by Grogan, D. W.