Previous Article | Next Article ![]()
Journal of Bacteriology, September 2003, p. 5148-5157, Vol. 185, No. 17
0021-9193/03/$08.00+0 DOI: 10.1128/JB.185.17.5148-5157.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Department of Microbiology and Immunology, Stritch School of Medicine, Loyola University Chicago, Maywood, Illinois 60153,1 School of Biosciences, University of Birmingham, Birmingham B15 2TT, United Kingdom2
Received 12 February 2003/ Accepted 16 June 2003
|
|
|---|
subunit of RNA polymerase holoenzyme (
-CTD), which is known to participate in class I interactions: activating region 1 of CRP and the 287, 265, and 261 determinants of the
-CTD. Other surface-exposed residues in the
-CTD contributed to acs transcription, suggesting that the
-CTD may interact with at least one protein other than CRP. |
|
|---|
subunit of RNA polymerase (
-CTD). Two additional
-CTD determinants contribute to class I activation: the 261 determinant, proposed to interact with the
subunit of RNAP, and the 265 determinant, known to interact with DNA, especially A+T-rich sequences, most notably the UP element.
Class I interactions appear to recruit RNAP to promoter DNA by increasing the binding constant for closed-complex formation. At class II promoters, a CRP dimer binds to DNA at a site centered near position -41.5. When bound at this position, CRP uses AR1 of the upstream subunit of CRP to contact the 287 determinant of the
-CTD and a second surface (AR2) to contact the 162 to 165 determinant of the N-terminal domain of
. The
-CTD 265 determinant also contributes by interacting with DNA. Class II interactions appear to increase closed-complex formation and the rate of isomerization to the open complex. A variation of CRP-dependent activation, designated class III, utilizes two or more CRP dimers or a combination of CRP and other activators to achieve maximal transcription activation (reviewed in references 5 and 10).
Acetyl-coenzyme A synthetase (Acs; acetate:coenzyme A ligase [AMP forming]; EC 6.2.1.1) irreversibly catalyzes the conversion of acetate to acetyl-coenzyme A through an enzyme-bound acetyladenylate intermediate (2). This activity permits cells to use acetate, a two-carbon compound, as a source of both energy (via the tricarboxylic acid cycle) and biosynthetic subunits (via the glyoxylate shunt) (3). Escherichia coli cells require this high-affinity acetate-scavenging enzyme (3, 15) to compete successfully during periods of carbon starvation (A. J. Wolfe, unpublished data). Thus, the induction of Acs represents a survival response for cells entering a nutrient-poor environment.
Previously, we reported that cells control Acs activity primarily at the level of transcription initiation, inducing transcription during exponential phase, achieving maximal transcription during the transition to stationary phase, and partially repressing that transcription following entry into stationary phase. Transcription occurs from two
70-dependent promoters: the distal promoter acsP1 (P1) and the proximal promoter acsP2 (P2) (Fig. 1) (4, 13, 14). Transcription depends upon CRP, the anaerobically triggered transcription activator FNR, the glyoxylate shunt repressor IclR and its activator FadR, and several enzymes involved in acetate metabolism. While multiple factors influence transcription, CRP appears to function directly as the critical transcription factor (4, 13).
![]() View larger version (27K): [in a new window] |
FIG. 1. Organization of the acs promoter region. (A) The sequence of the acs promoter region from positions -290 to +10 relative to the acsP2 transcription start site (+1). The acsP1, acsP2, and pnrfA -10 elements are underlined, and the predicted start points of transcription for acsP1, acsP2, and pnrfA are designated in bold lowercase letters, with the direction of transcription indicated by a horizontal arrow. Inverted arrows specify the location of DNA sites for CRP binding (CRP I and CRP II), while underlining shows the extent of protection afforded by CRP in DNase I footprint experiments. Triangles indicate hypersensitive sites within the relevant strand. The cleavage sites produced by potassium permanganate footprint analysis are in bold and underlined. (B) Schematic of the region, showing the locations of the +1 sites associated with each promoter, each binding site, and the extent of the pacs444 fragment used for DNase I footprint experiments (Fig. 4).
|
-CTD. On the basis of these observations, we propose that P2 is a synergistic class III promoter that consists of tandem DNA sites for CRP, each located at a class I position. To our knowledge, this represents the first report of a native promoter with this particular architecture (23). Intriguingly, several
-CTD residues not within the 287, 265, and 261 determinants also affected acs transcription, suggesting that the
-CTD may interact with at least one factor other than CRP. |
|
|---|
Bacterial strains, plasmids, and bacteriophage. All strains used in this study were derivatives of E. coli K-12 and are listed in Table 1.
|
View this table: [in a new window] |
TABLE 1. Strains, promoters, plasmids, and phages used in this study
|
To construct the ß-galactosidase fusion plasmids pCB33 and its mutant derivatives, 444-bp fragments were PCR amplified from pCB26 and its mutant derivatives with primers 2927 and 2926. These PCR products were subcloned into pGEM-T and verified by sequencing. Promoter fragments were excised from the resultant plasmids with EcoRI and BamHI restriction enzymes and subcloned into pRS415. To construct strains that carry single-copy acs::lacZ fusions, ß-galactosidase fusion plasmids were converted to hybrid
phage, as described (22). pSR derivatives were generated by PCR amplification from pCB26 with 2926 and 2927HindIII (AAGCTTCTTGTCATAGGGGCTTC). This PCR product was digested with EcoR1 and HindIII and subcloned into pSR. The
crp::Km allele was transferred from strain CB369 by generalized transduction with P1kc (21).
PCRs. All PCRs were performed in a 50-µl reaction volume. The reactions contained 1x PCR buffer (Promega), 3 mm MgCl2, 20 nM each primer, 0.2 mM deoxynucleoside triphosphate mix, and 1 U of Taq polymerase. Reactions were subjected to one cycle of 95°C for 5 min and then 30 cycles 95°C for denaturing, 68°C for annealing, and 72°C for extension. Site-directed mutations were generated either by megaprimer PCR or the Gene Editor site-directed mutagenesis kit (Promega), following the protocol provided. Megaprimers were produced by standard PCRs with the 5' primer 2926 (GGATCCGTTGGGTCTGCGATGTTG) and a 3' mutagenic primer (either ttgcgtCatctgtcgccca, ttgcgAgatctgtcgcca, ttgcCtgatctgtcgcca, or ttgcgtgatctAgtcgccca). Megaprimers were gel purified and quantified by spectrophotometry. A second PCR was carried out with the megaprimer and the 3' primer 2927 (GAATTCCTTGTCATAGGGGCTTC). The resultant PCR products were subcloned into pGEM-t, and the successful incorporation of mutations was verified by sequencing.
Medium and growth conditions. For strain constructions, cells were grown in Luria broth (LB; 1% [wt/vol] tryptone, 0.5% [wt/vol] yeast extract, and 0.5% [wt/vol] sodium chloride). For ß-galactosidase assays, cells were grown at 37°C in tryptone broth (TB; 1% [wt/vol] tryptone and 0.5% [wt/vol] sodium chloride). The medium was supplemented with antibiotics or 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-Gal), as needed.
Promoter activity assays. ß-Galactosidase activity was determined quantitatively with the Y-PER ß-galactosidase assay kit (Pierce Biochemical). The values expressed are the mean and standard error of the mean of three independent measurements. Each experiment was repeated two to five times.
Protein purification. CRP was purified as described previously (13).
DNase I and potassium permanganate footprint experiments.
All footprint experiments were performed on
-32P-end-labeled AatII-HindIII fragments containing the acs-nrfA intergenic region, as described previously (19). For DNase I footprinting experiments, each reaction (20 µl) contained a final concentration of 4 nM template DNA. The buffer composition was 20 mM HEPES (pH 8.0), 5 mM MgCl2, 50 mM potassium glutamate, 1 mM dithiothreitol, 500 µg of bovine serum albumin per ml, and 25 µg of herring sperm DNA per ml. When CRP was present in the reactions, 0.2 mM cAMP also was included. For potassium permanganate footprint experiments, herring sperm DNA was omitted and E. coli RNA polymerase (Epicentre Technologies) was used at a final concentration of 50 nM. All samples were analyzed by denaturing gel electrophoresis. Gels were calibrated with Maxam-Gilbert G+A sequencing reactions of the labeled fragment and quantified with a Typhoon 8600 variable-mode imager and ImageQuant software (Molecular Dynamics).
In vitro transcription assays.
In vitro transcription reactions (20 µl) were performed in a buffer containing 100 mM KCl, 40 mM Tris-acetate (pH 7.9), 10 mM MgCl2, 1 mM dithiothreitol, 100 µg of bovine serum albumin per ml, 200 µM ATP, 200 µM CTP, 200 µM GTP, 10 µM UTP, and 2 µCi of [
-32 P]UTP (Perkin Elmer). When CRP was present in the reactions, 0.2 mM cAMP was also included. CsCl-ethidium bromide gradient-purified supercoiled template DNA (pSRacs444) was added at a final concentration of 10 nM. Reactions were initiated by the addition of RNA polymerase (Epicentre Technologies) to a final concentration 50 nM and incubated at 30°C for 10 min. Samples were analyzed by denaturing gel electrophoresis and quantified with a Typhoon 8600 variable-mode imager and ImageQuant software (Molecular Dynamics).
|
|
|---|
CB12, Table 1) that encompasses sequences from position -379 to position +65 of acs (Fig. 1B). We then constructed a set of lysogens in a wild-type strain (AJW678, Table 1), with each lysogen carrying a single copy of either
CB12 (AJW1941) or one of the mutant derivatives (Table 1). We grew the resultant lysogens in tryptone broth (TB), harvested cells at several intervals throughout growth, and determined the ß-galactosidase activity. The C16G/A11C allele resulted in a complete loss of activity, while the A214G/A215G allele exhibited no loss of activity (Fig. 2B). To generate a restriction site, the C16G/A11C allele combines a mutation (A11C) at a highly conserved position within the -10 element with a mutation (C16G) outside the -10 element. To determine whether the C16G mutation exerts an effect on transcription, we constructed a second mutant allele (C16G/T10C) that included a mutation (T10C) at a less conserved position within the -10 element and was thus predicted to cause less severe consequences to promoter activity. The C16G/T10C allele behaved like its wild-type parent (data not shown), supporting the conclusion that the T11C mutation was responsible for the decrease in transcription. A 3' deletion from the middle of the -10 element resulted in activity similar to that exhibited by the C16G/A11C allele, whereas a 5' deletion that removed the P1 -10 region exhibited transcription comparable to that of the wild type (data not shown). Taken together, these results support the hypothesis that P2 functions as the major acs promoter, at least under the conditions tested.
![]() View larger version (23K): [in a new window] |
FIG. 2. Evidence that P2 is the major acs promoter. (A) Schematic of the acs promoter region, showing the mutant alleles. The sequences of the P1 and P2 -10 elements are underlined. The italic letters above the sequences indicate site-directed mutations. (B) Optical density at 590 nm (OD590, dashed lines) and ß-galactosidase activity (solid lines) of acs::lacZ transcriptional fusions, either wild type (WT) or mutant for P1 (A214G/A215G) or P2 (C16G/A11C). Wild-type strain AJW678 was lysogenized with a hybrid that carried either the wild-type acs::lacZ fusion ( CB12) or one of its mutant derivatives ( CB13 or CB16). The resultant lysogens were grown in TB, samples were harvested during a growth curve, the ß-galactosidase activity was determined, and the activity was expressed as a Miller units. Each value represents the mean ± standard error of the mean (SEM) of at least three independent measurements.
|
![]() View larger version (47K): [in a new window] |
FIG. 3. CRP binds specifically to two sites within the acs regulatory region. (A) End-labeled pacs444 AatII-HindIII fragment (carrying acs promoter sequences from positions -379 to +65) was incubated with increasing concentrations of CRP protein and subjected to DNase I footprint analysis. The concentration of CRP in each reaction was as follows: lane 1, no protein; lane 2, 30 nM; lane 3, 125 nM; lane 4, 250 nM; lane 5, 500 nM. The gel was calibrated with Maxam-Gilbert G+A sequencing reactions of the labeled fragment (GA). The locations of CRP I and CRP II are shown by boxes, and hypersensitive sites are indicated by stars. The region encompassing the CRP II signature is designated by the thick bar to the right of the figure. (B) A graphic representation of the CRP II region as quantified with ImageQuant (version 5.2) software (Molecular Dynamics). The hypersensitive sites are indicated by stars.
|
![]() View larger version (32K): [in a new window] |
FIG. 4. CRP activates transcription in vitro by focusing RNAP to P2. (A) CRP is required for transcription of P2 in vitro. In vitro multiround transcription assays of the P2 promoter carried by plasmid pSRacs444. Reactions contained purified RNA polymerase and increasing concentrations of purified CRP. The concentration of CRP was as follows: lane 1, no protein; lane 2, 25 nM; lane 3, 50 nM; lane 4, 100 nM; lane 5, 300 nM. Transcription initiates from P2 and terminates at a strong transcriptional terminator within the vector backbone (pSR), producing a single 139-nucleotide (nt) transcript. The 105-nucleotide RNA I transcript, encoded by pSR, served as an internal transcriptional control. Arrows indicate the P2 and RNA I transcripts. (B) Potassium permanganate footprint analysis of complexes formed at the acs promoter region. The figure shows the cleavage products produced when the end-labeled pacs444 AatII-HindIII fragment was incubated with purified RNA polymerase and purified CRP and then subjected to potassium permanganate footprint analysis. All reactions contained 50 nM RNAP polymerase and the following CRP concentration: lane 2, no protein; lane 3, 25 nM; lane 4, 100 nM. The gel was calibrated with Maxam-Gilbert G+A sequencing reactions of the labeled fragment (GA). The location of the P2 promoter is shown.
|
Both CRP I and CRP II contribute to acs transcription in vivo.
To assess the regulatory role of each DNA site for CRP (CRP I and CRP II), we generated mutations predicted, on the basis of analogous mutations in the site for CRP within the lac promoter that reduce affinity to as much as 1/70th that of the wild-type site (6), to reduce the ability of CRP to bind. We incorporated each mutation into an acs::lacZ fusion (
CB12, Table 1) that encompasses the entire acs regulatory region, as described above (Fig. 1B). We then constructed a set of lysogens in a strain wild type for crp (AJW678, Table 1), with each lysogen carrying a single copy of either
CB12 (AJW1941) or one of the mutant derivatives (Table 1).
For the proximal, higher-affinity site CRP I, we generated substitutions in the upstream half-site (G75C, T76A, and G77C) or inserted 1 bp into the spacer (+1A) (Fig. 5A). Electrophoretic mobility shift assays showed that each mutation significantly diminished the ability of CRP to bind (data not shown). Compared to the wild-type fusion (
CB12), all four mutant fusions yielded significantly lower activity (Fig. 5B). Substitution at the critical G75 position or insertion into the spacer yielded
6-fold-lower activity, only slightly higher than the activity exhibited by a
CB12 lysogen of a strain deleted for crp (13). This result suggests the existence of low-level basal CRP-independent activity and clearly supports the hypothesis that optimal CRP-dependent activation requires CRP I.
![]() View larger version (24K): [in a new window] |
FIG. 5. acs transcription requires CRP I, while optimal transcription also involves CRP II. (A) Schematic of the acs promoter region showing the sequences of CRP I and CRP II. The italic letters and numbers above the sequences indicate site-directed mutations. (B) ß-Galactosidase activity of acs::lacZ transcriptional fusions, either wild type or mutant for CRP I (G75C, T76A, G77C, +1A) or CRP II (G126C). Wild-type strain AJW678 was lysogenized with a hybrid that carried either the wild-type acs::lacZ fusion ( CB12) or one of its mutant derivatives ( CB15, CB20, CB21, CB21a, or CB36). The resultant strains were grown in TB, samples were harvested during the transition from exponential growth to stationary phase, the ß-galactosidase activity was determined, and the activity was expressed as a percentage of the wild-type value. Each value represents the mean ± SEM of at least three independent measurements. Fold changes in relation to the wild type are noted below the histogram. (C) ß-Galactosidase activity of acs::lacZ transcriptional fusions, either wild type ( CB12), mutant (G75C) for CRP I ( CB20), or mutant (G126C) for CRP II ( CB26) carried by cells with crp deleted (strains AJU2163, AJW2181, or AJW2182, respectively) and transformed. The resultant transformants were grown in TB, samples were harvested during the transition from exponential growth to stationary phase, the ß-galactosidase activity was determined, and the activity was expressed as a percentage of the wild-type value. Each value represents the mean ± SEM of at least three independent measurements.
|
CB12), this mutant fusion yielded 1.7-fold lower activity (Fig. 5B). This moderate decrease in transcription, together with the fact that -10 element and CRP I substitutions resulted in significant decreases in transcription, suggests that CRP bound to CRP II functions as a coactivator of the CRP bound at CRP I.
To confirm that the G126C mutation in CRP II does not exert a CRP-independent effect upon transcription, we generated
crp cells carrying fusions to the wild-type, G75C mutant, and G126C mutant promoters. In the absence of CRP, the G126C mutant promoter yielded activity almost identical to that of its wild-type parent and the G75C mutant (Fig. 5C). This lack of a difference in promoter activities supports the notion that the loss of activity due to G126C is CRP dependent. Complementation with wild-type CRP yielded activities similar to that observed in the wild-type background. Strains carrying the wild-type fusion regained wild-type levels of transcription, those carrying the G75C mutant fusion gained no additional activity, and the G126C mutant fusion regained 50 to 60% of wild-type activity. These results further support the importance of CRP binding to CRP I and the contribution of CRP binding to CRP II.
CRP-dependent activation requires activating region I.
Given the location of CRP I (-69.5) and CRP II (-122.5), we predicted that CRP activates acs transcription by class I interactions. To test this prediction, we constructed a strain deleted for crp and lysogenized with
CB12 (AJW2163). We transformed this strain with plasmids that express wild-type CRP or its mutant variants. The variant CRP H159L possesses a defective AR1 and therefore activates class I and class II promoters poorly. The variant CRP K101E possesses a defective AR2 and thus activates class II promoters poorly. The double mutant CRP H159L/K52N is defective in AR1 and possesses AR3, a nonnative activation region that compensates for the lack of AR1 in class II interactions but not in class I interactions (reviewed in reference 5). Figure 6 shows that the AR1 substitution (regardless of AR3 status) resulted in an 8- to 10-fold reduction in ß-galactosidase activity, while the AR2 substitution exerted no significant effect. These results support the hypothesis that CRP activates acs transcription by means of class I interactions and not via class II interactions.
![]() View larger version (55K): [in a new window] |
FIG. 6. CRP-dependent activation requires activating region I. ß-Galactosidase activity of a CB12 lysogen deleted for crp (strain AJW2163) and transformed with plasmids expressing either wild-type CRP, CRP H159L, CRP K101E, or CRP H159L/K52N was determined. The resultant transformants were grown in TB, samples were harvested at the transition from exponential to stationary phase, and the ß-galactosidase activity was determined and expressed in Miller units. Each value represents the mean ± SEM of at least three independent measurements. Changes in relation to the wild type are noted below the histogram.
|
-CTD residues influence transcription.
Class I interactions also require specific, surface-exposed
-CTD determinants (reviewed in reference 5). To identify
-CTD residues involved in acs transcription, we used a collection of
-subunit mutants containing single alanine substitutions at each nonalanine position in the
-CTD (residues 255 to 329). With this collection of mutants, we transformed the
CB12 lysogen AJW1941. We expressed the ß-galactosidase activity of each transformant as a percentage of wild-type activity and considered those altered by at least 25% significant. By these criteria, we identified 22 residues whose substitution resulted in decreased activity (D259, E261, N268, C269, I275, Y277, I278, D280, L281, Q283, T285, V287, E288, P293, N294, L295, G296, K297, K298, S299, V306, and R317) and five residues whose substitution resulted in increased activity (L260, L262, R265, T301, and I303) (Fig. 7). These results suggest that multiple, distinct regions of the
-CTD contribute to acs transcription (Table 2).
![]() View larger version (66K): [in a new window] |
FIG. 7. Effect of single alanine substitutions within -CTD. The relative ß-galactosidase activity of a CB12 lysogen wild type for crp (AJW1941) and transformed with a set of plasmids expressing a library of alanine-substituted variants of the -CTD of RNAP (residues 255 to 329) was determined. Residues 267, 272, 274, 308, 324, and 327 are naturally alanines. The resultant transformants were grown in TB, samples were harvested during the transition from exponential growth to stationary phase, and the ß-galactosidase activity was determined. Activities are expressed as a percentage of that of the transformant containing a plasmid expressing wild-type . Each value represents the mean ± SEM of at least two independent measurements. All alanine substitutions that significantly altered expression of the acs::lacZ fusion are marked with an asterisk above the bar. Horizontally striped bars, the 261 determinant; open bars, the 265 determinant; diagonally striped bars, the 287 determinant; cross-hatched bars, residues outside a known determinant.
|
|
View this table: [in a new window] |
TABLE 2. -CTD substitutions that affect acs transcription
|
|
|
|---|
CRP I and CRP II both reside in classic class I positions (5). Therefore, we hypothesized that class III CRP-dependent activation of acs might consist of simple class I interactions between RNAP and each of two CRP dimers (11, 16, 23), and the evidence supported this conclusion. In vivo, acs transcription required AR1, a surface patch of CRP residues that contacts its
-CTD counterpart, the 287 determinant. Notably, activation did not involve AR2 or AR3, surfaces important for activation of class II promoters (5). While our experiments clearly demonstrated a requirement for AR1, they did not show unequivocally that both dimers require a functional activating region. Using an alanine scanning library of the
-CTD, we showed that acs transcription involves residues within the 287 and 265 determinants. Importantly, activation also involved residues within or adjacent to the 261 determinant, a surface patch known to be important for activation of class I but not class II promoters (Table 2) (20).
Four of the alanine substitutions that significantly increased acs promoter activity (L260A, L262A, R265A, and T301A) reside in or around previously defined determinants (Table 2). R265, the surface-exposed eponymous residue of the 265 determinant, interacts directly with UP elements (1). T301, a surface-exposed residue, resides immediately adjacent to this determinant. In contrast, residues L260 and L262, located adjacent to the 261 determinant, are generally buried, suggesting that they alter the structure of the
-CTD.
Relative to the extensively characterized CRP-dependent class I promoters lacP2 and CC(61.5), we observed some differences in the identity and involvement of residues within determinants. For example, the R265A substitution diminishes transcription from lacP2 and CC(61.5) but enhanced transcription from acs (20). This and other differences probably result from architectural differences between promoters. At acs, however, they may also reflect the involvement of proteins other than CRP and RNAP.
Intriguingly, several substitutions that either significantly decreased (C269A, I275A, Y277A, I278A, D280A, L281A, Q283A, and V306A) or significantly increased (I303A) acs promoter activity did not correspond to
-CTD surfaces known to be involved in class I activation (Table 2). This observation suggests that the
-CTD plays a more complex role at acs than it does at simple class I promoters, possibly making additional interactions with proteins other than CRP. Candidate proteins include the nucleoid proteins FIS (factor for inversion stimulation) and IHF (integration host factor), both of which participate directly in the regulation of acs transcription (D. F. Browning, C. M. Beatty, S. J. W. Busby, and A. J. Wolfe, unpublished data).
-CTD alanine scan and David Keating and Karen Visick for critical reading of the manuscript. This work was supported by grants MCB-9982762 from the National Science Foundation and LU#11200 from the Loyola University Chicago Potts Foundation (A.J.W.) and by WT066685 from the Wellcome Trust (S.J.W.B.).
|
|
|---|
38 for overlapping promoters and ability to support CRP activation. Nucleic Acids Res. 23:819-826.
subunit important for transcription at class I cyclic AMP Receptor protein-dependent promoters. J. Bacteriol. 184:2273-2280.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»