Previous Article | Next Article ![]()
Journal of Bacteriology, September 2003, p. 5310-5313, Vol. 185, No. 17
0021-9193/03/$08.00+0 DOI: 10.1128/JB.185.17.5310-5313.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Department of Life Sciences and Chemistry, Roskilde University, DK-4000 Roskilde,1 Novo Nordisk IT A/S, DK-2880 Bagsværd, Denmark2
Received 13 January 2003/ Accepted 12 June 2003
|
|
|---|
|
|
|---|
The nrdAB operon is transcribed from two promoters (7), and transcription is activated by Fis (4) and IciA (12) and probably also by DnaA, because mutations in the two DnaA binding sites in the promoter region reduce expression (4). The operon is cell cycle regulated (21), and expression is stimulated by inhibition of the nrdAB-encoded nucleotide reductase by hydroxyurea (9, 10) as well as by inactivation of the genes encoding thioredoxin and glutaredoxin (18). Like nrdAB, the nrdHIEF operon is induced by hydroxyurea (13) and in strains lacking thioredoxin and glutaredoxin (17). In addition, nrdHIEF is induced by oxidative stress (17). Very little is known about regulation of expression of the nrdDG operon except that the level of enzyme activity is increased under anaerobic growth conditions (9). Here we have constructed single-copy transcriptional lacZ fusions of the three nrd operons and investigated their expression as a function of aeration and in strains carrying mutations in the two main transcriptional regulators for aerobic/anaerobic shifts, FNR and ArcA. FNR activates transcription of a number of genes coding for enzymes required under anaerobic growth conditions and represses transcription of some genes for aerobic functions (11, 20). Under anaerobic conditions, ArcA, the response regulator of the two-component ArcA-ArcB system, represses many genes for aerobic functions and activates transcription of some other genes (11).
Construction of transcriptional lacZ fusions to the nrd promoters.
The promoter regions of the three nrd operons (Fig. 1) were amplified by PCR and cloned in front of the lacZ gene of the promoter cloning vector pTAC3953 (6). The fusions were subsequently integrated into the
attachment site as described previously (2) and transferred to strain LJ24 by P1 transduction to obtain the strains BOS7 to BOS9 illustrated in Table 1, and these strains were used to construct isogenic derivatives carrying the fnr1 and arcA1 mutations.
![]() View larger version (21K): [in a new window] |
FIG. 1. Structure of nrd-lacZ fusions. (A) The promoter regions of the nrdAB, nrdDG, and nrdHIEF operons were amplified from chromosomal DNA of strain LJ24 with the primers Nrd5 and Nrd6 (AAGACGGCGTATTTAATCGC and CGAGATACTGATAATCCGGC, respectively), NrdD-F and NrdD-B (TTATGTCGACCACTGGCAACAAGGAATGCAC and TAAGATCTTTCCGCTGCTTTAGCTGCAC, respectively), and NrdE-1 and NrdE-2 (TTCTGTCGACGGATCATATGTTTAACCGACC and AGGTTAGATCTGAAGATACGGCGCGATG, respectively). The nrdA fragment was digested with TaqI and cloned into the promoter cloning vector pTAC3953 (6) digested with BstB1, while the nrdD and nrdH promoter fragments were digested with SalI and BglII and inserted into pTAC3953 digested with the same enzymes. The lacZ fusions from the three plasmids were subsequently transferred into the attachment site as described in reference 2 to obtain strains BOS7, BOS8, and BOS9. The correct promoter lacZ fusion in these strains was verified by sequencing. Restriction sites used in the construction are indicated above the bars showing the relevant segments of the plasmids. Light gray arrows show the position and direction of genes. Gray rectangles represent DnaA boxes with up to one mismatch to the consensus sequence TTATNCACA, while a white rectangle represents the Fis binding site (4), and black rectangles represent FNR binding sites. Black triangles represent promoters. The positions of the promoters for nrdA and nrdH are according to references 23 and 13, respectively, whereas the position of the nrdD promoter is according to our data from Fig. 4. (B) Sequence of the nrdD promoter region. The -35 and -10 regions of the promoter sequence are indicated with lines below the sequence, and the transcript start site, determined from Fig. 4, is indicated by an asterisk below the sequence. The FNR binding sites are boxed. Bases fitting the consensus sequence ANANTTGATNNANATCAAT (20) are indicated in boldface, and those not fitting are in lowercase.
|
|
View this table: [in a new window] |
TABLE 1. E. coli K-12 strains used in this study
|
|
View this table: [in a new window] |
TABLE 2. Oxygen and growth-phase regulation of transcription of the nrd operons
|
![]() View larger version (24K): [in a new window] |
FIG. 2. pndrD'-lacZ expression under aerobic (A) and anaerobic (B) growth conditions. Strains BOS8 (fnr+) and BOS14 (fnr1) were grown with good aeration at 37°C in AB minimal medium (8) supplemented with 1% Casamino Acids (Difco), 0.2% glucose, and 1 µg of thiamine per ml. At the time corresponding to t = 0 min, part of the cultures were shifted to anaerobic growth conditions obtained as previously described (6), while the other part of the cultures remained under aerobic conditions. Samples were taken for determination of cell mass and ß-galactosidase activity as described previously (6). Solid symbols indicate BOS8 (fnr+), and open symbols indicate BOS14 (fnr1). Squares indicate OD450, and triangles indicate ß-galactosidase specific activity (units per milliliter x OD450).
|
![]() View larger version (13K): [in a new window] |
FIG. 3. Differential plot of pndrD'-lacZ expression during a shift to anaerobiosis. The strains BOS8 (fnr+) and BOS14 (fnr1) were grown as described in the legend to Fig. 2 and shifted to anaerobic growth conditions at the OD indicated by the arrow. Solid circles represent BOS8 (fnr+), and open symbols represent BOS14 (fnr1).
|
Localization of the nrdD promoter. Analysis of the sequence between the treC and nrdD genes revealed two good homologies to FNR binding sites (20) located upstream of two putative -10 promoter sequences (Fig. 1B). To determine which of these is actually the promoter, we mapped the transcript start site by primer extension using the nrdDG2 primer, complementary to sequences 160 residues downstream of FNR site 1. We detected only one transcript start site in RNA from anaerobically grown wild-type cells, while no specific primer extension products were detected with RNA from the fnr mutant (Fig. 4). The same result was obtained with a primer located closer to the promoter (data not shown). Thus the nrdDG operon is transcribed from a single promoter that has two FNR sites: one centered at position -65 relative to the transcript start site and the second located on top of the -35 sequence of the promoter. It is therefore very likely that transcription from the nrdD promoter is stimulated directly by FNR upon its activation by a shift to anaerobiosis.
![]() View larger version (62K): [in a new window] |
FIG. 4. Primer extension analysis of the nrdD transcript start site. The wild-type (wt) strain BOS8 (fnr+) and mutant strain BOS14 (fnr1) were grown under anaerobic conditions as described in the legend to Fig. 2, and RNA was prepared with the MasterPure RNA purification kit from EPICENTRE. Primer extension analysis (16) was carried out with 5 µg of RNA and the 33P end-labeled primer nrdDG2 (GGTTATCCACAGAAATTGGGAAAGG). The primer extension products were analyzed by electrophoresis on an 8% acrylamide gel containing 8 M urea, alongside sequencing reactions performed with the same end-labeled primer and the nrdD promoter PCR fragment as a template.
|
Conclusions. Expression from the nrdD promoter exhibits FNR-dependent and ArcA-independent induction by anaerobiosis and by oxygen limitation in the stationary phase. The promoter is most probably directly activated by binding of FNR to the two FNR binding sites found in positions similar to those found for other FNR-regulated promoters. Expression of the nrdA promoter is independent of oxygen availability and growth phase, except for prolonged growth under anaerobic conditions or entry into the stationary phase during anaerobic growth, where expression is reduced in the wild type but increased in the fnr mutant, probably in response to the sum of activity of the nucleotide reductases.
This work was supported by a grant from the Danish Natural Science Research Council.
|
|
|---|
attachment site of Escherichia coli. Gene 107:11-17.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»