Department of Biochemistry and Microbiology, University of Victoria, Victoria, British Columbia V8W 3P6,1 Department of Microbiology and Infectious Diseases, University of Calgary, Calgary, Alberta T2N 4N1, Canada2
Received 26 February 2003/ Accepted 25 June 2003
| ABSTRACT |
|---|
|
|
|---|
agfA (AgfA recipient) and
agfB (AgfA donor) cells harboring mutations in LPS (galE::Tn10) and/or cellulose (
bcsA) synthesis. Intercellular complementation could be detected between
agfA and
agfB strains only when both possessed the galE mutation. LPS O polysaccharide appears to be an impenetrable barrier to AgfA assembly between cells but not within individual cells. The presence of cellulose did not restrict Tafi formation between cells. Transmission electron microscopy of w+ S. enterica serovar Enteritidis 3b cells revealed diffuse Tafi networks without discernible fine structure. In the absence of cellulose, however, individual Tafi fibers were clearly visible, appeared to be occasionally branched, and showed the generally distinctive appearance described for Escherichia coli K-12 curli. A third extracellular matrix component closely associated with cellulose and Tafi was detected on Western blots by using immune serum raised to whole, purified Tafi aggregates. Cellulose was required to tightly link this material to cells. Antigenically similar material was also detected in S. enterica serovar Typhimurium and one diarrheagenic E. coli isolate. Preliminary analysis indicated that this material represented an anionic, extracellular polysaccharide that was distinct from colanic acid. Therefore, Tafi in their native state appear to exist as a complex with cellulose and at least one other component. | INTRODUCTION |
|---|
|
|
|---|
AgfA and AgfB are interesting sequence homologues that are likely the result of several gene duplications; they are nearly identical in size and share many structural features. Despite their similarities, they have very different biochemical properties (46). Both proteins are required for fimbrial polymerization, with AgfA substantially predominating in the fimbriae. AgfEFG proteins participate in fiber formation and somehow ensure the fidelity of assembly. Deletion of agfE or agfF leads to the production of fimbriae with altered biochemical properties (9), whereas deletion of agfG disrupts fimbrial formation altogether (28). AgfD is a positive transcriptional regulator of the agf operon (19) and is required for Tafi biosynthesis (36).
There is growing interest in the relationship between Tafi (or curli) production in Salmonella (or E. coli) and the formation of biofilms (4, 24, 32, 39). Tafi (curli) production by many S. enterica and E. coli strains is tightly regulated by growth conditions, normally occurring at temperatures below 30°C (17, 37). In Salmonella enterica serovar Enteritidis 3b, Tafi are produced under less stringent conditions at both 28 and 37°C (12). These differences in regulation are likely due to differences in the agfD promoter sequence (37, 44). Recently, AgfD was shown to regulate production of another extracellular substance, cellulose (36, 48). Tafi and cellulose form a highly resistant extracellular matrix which may be important for ensuring bacterial survival in harsh environments (39). Capsular polysaccharides, such as colanic acid (CA), have also been implicated in the formation of Tafi- and curli-associated biofilms (33). These substances appear to be important for maintenance of space between cells and development of complex three-dimensional architectures (14).
Assembly of Tafi or curli fibers has been proposed to occur extracellularly, perhaps in the midst of other components. The current assembly hypothesis allows for fimbrial growth by addition of subunits principally to the distal end of the growing fibers (20). This is unique among fimbriae and has been termed the extracellular nucleation-precipitation pathway (40). The hypothesis is based upon the intercellular complementation of an E. coli MC4100 csgA mutant grown in close proximity to a csgB mutant (CsgA donor) on solid medium (20). Complementation yielded cells which possessed assembled curli and as a result were able to bind the dye CR. However, these experiments could not be reproduced in S. enterica serovar Enteritidis 3b with precisely defined agfA and agfB mutant strains (46). For this study we devised an intercellular complementation strategy applicable to enteric strains more native than E. coli MC4100.
S. enterica serovar Enteritidis 3b possesses smooth lipopolysaccharide (LPS) O polysaccharide and produces cellulose in concert with Tafi (48). In contrast, E. coli MC4100 produces neither LPS O polysaccharide (27) nor cellulose (48). To allow for these differences, S. enterica serovar Enteritidis 3b
agfA and
agfB strains were rendered LPS O-polysaccharide deficient by introducing a galE::Tn10 mutation and cellulose deficient by deleting bcsA, coding for cellulose synthase (34). Intercellular complementation between strains did not readily occur and did so only when the donor and acceptor were LPS O-polysaccharide deficient. Thus, LPS O polysaccharide substantially interferes with Tafi formation between cells under normal conditions, indicating that Tafi assembly does not normally occur intercellularly. Additional experiments with
bcsA strains revealed that Tafi in their native state exist as a complex with cellulose and at least one other extracellular polysaccharide (EPS).
| MATERIALS AND METHODS |
|---|
|
|
|---|
wcaJ mutant, S. enterica serovar Typhimurium SL7207 (22), and E. coli Vietnam I/1 (13) were routinely grown in T broth (12) at 28 or 37°C for 24 or 48 h, with shaking at 200 rpm, or on T agar (T) or T agar plus CR (100 µg/ml) indicator plates (TCR agar) as previously described (11).
Generation of
bcsA and
wcaJ strains.
An in-frame deletion removing 1,998 bp in bcsA (encoding amino acids 165 to 828 in BcsA) was generated as previously described (48) with some modifications. Primer YHJ05 was modified to contain an EcoRI site instead of a BamHI site, and a new YHJ07 primer (CCACTGCAGATTCGCGCCGCCTTCAGTAA [a PstI site is underlined]) was generated since S. enterica serovar Typhimurium bcsA contains a unique EcoRI site corresponding to amino acids 828 to 829; primers YHJ06 and YHJ08 were used as described previously (48). An in-frame deletion removing amino 1,206 bp in wcaJ (encoding amino acids 34 to 436 in WaaJ) was generated similarly by using PCR primers wcaJ01 (GGTGAATTCAAAAACCGGGCACGC [an EcoRI site is underlined]), wcaJ02 (GAACTGCAGCCCGCCAAACA [a PstI site is underlined]), wcaJ03 (GACCTGCAGTAAATCCGCGA [a PstI site is underlined]), and wcaJ04 (GTAAAGCTTGGTCAGCTCCA [a HindIII site is underlined]). For each construct, the two PCR fragments generated were directionally cloned into EcoRI-HindIII-cut pTZ18R (Amersham Biosciences) and subcloned into pHSG415 (21). The
bcsA or
wcaJ mutation was introduced into the chromosomes of S. enterica serovar Enteritidis strains according to procedures described previously (47) with modifications: Apr plasmid-cointegrate colonies were selected after growth for 18 h at 42°C, and Aps
bcsA mutants were selected after two or three 18-h passages at 28°C. Mutants were identified by PCR screening with primers bcsAko1 (CGGCCCGTTACCTCATTCAG), bcsAko2 (TTCAGCACCGCTTTCGACGC), bcsAwt1 (CAGAAACGAGCGTGTCGGCA), wcaJko1 (CGCTGCTGAATCAGTAACGT), wcaJko2 (TTAGCGCCGCTGATCGTTTT), and wcaJwt1 (GCGACGCCAGCACGATATCT), based on the S. enterica serovar Typhimurium DNA sequences (GenBank accession numbers AJ315770 and AF285085).
Generation of galE::Tn10 mutants of S. enterica serovar Enteritidis 3b
agfA and
agfB strains.
Phage stocks prepared after growth of transducing phage P22 int3 HT 12/4 on S. enterica serovar Typhimurium LT2-TN1117 were used to infect S. enterica serovar Enteritidis 3b,
agfA, and
agfB cells at multiplicities of infection ranging from 0.01 to 5. Transductants were selected on Luria-Bertani plates containing tetracycline (16 µg/ml) and were rendered phage free by passage on Green plates (8). Potential galE::Tn10 transductants were screened with indicator plates specific for galactose fermentation (23). galE phenotypes were confirmed by the absence of LPS O polysaccharide (O antigen) after growth on nutrient agar without galactose (23). galE::Tn10 mutants grown on T agar (see Fig. 1 to 3) were severely depleted in O antigen as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and LPS-silver staining, but trace amounts (<10% of wild-type [w+] levels) were detected.
|
|
bcsA galE::Tn10.
Fimbriae were isolated and purified from plate-grown cells as previously described (12). SDS-PAGE sample buffer-insoluble material which did not enter the stacking gel was recovered, washed three times in distilled water (dH2O), and lyophilized. This material was resuspended in dH2O and treated with 90% formic acid before SDS-PAGE and Western blotting.
Intercellular complementation.
S. enterica serovar Enteritidis 3b and the
agfA,
agfB, and related mutants were grown overnight at 28°C in T broth; cultures were normalized to an optical density at 600 nm (OD600) of 1, and sterile swabs were used to streak different
agfA and
agfB combinations immediately adjacent to each other on TCR agar. Any differences in colony color due to variable CR binding were recorded after growth for 24 or 48 h at 37°C. For coplating experiments, 500-µl portions (OD600 of 0.5) of two different
agfA and
agfB cultures were combined, and a 100-µl aliquot was plated onto TCR agar. For each control strain, 100 µl of the original cell suspension at an OD600 of 1 was plated directly. Following growth for 24 h at 37°C, cells were scraped off the agar and resuspended in 1 ml of 10 mM Tris (pH 7.2). For SDS-PAGE and immunoblotting, cell samples at an OD600 of 4 were aliquoted, buffer was removed, and cells were treated as described below. For the CR binding assay (45), cells were normalized to an OD600 of 10 per ml and left to equilibrate for 1 h at room temperature (RT). After removal of cells by centrifugation, the amount of CR released into the buffer was determined by measuring the absorbance at 480 nm.
SDS-PAGE and Western blot analyses.
Cell pellets from 4 OD600 units of cells were resuspended in 100 µl of SDS-PAGE sample buffer (26) and boiled for 10 min, and cellular debris was pelleted by centrifugation (15,600 x g, 5 min). These samples were washed with 500 µl of dH2O, resuspended in 250 µl of 90% formic acid, frozen, and lyophilized. For analysis of proteins secreted into the agar, cells were removed and plugs of
8 mm in diameter were taken (9), resuspended in 500 µl of dH2O or 98% formic acid, frozen, and lyophilized. Samples were resuspended in SDS-PAGE sample buffer before separation by SDS-PAGE (26). Proteins and other materials were electrophoretically transferred to nitrocellulose in a glycine (192 mM)-Tris (25 mM, pH 8.3)-methanol (20%) solution by using a Mini-Protean II apparatus (Bio-Rad Laboratories). Proteins and associated material were detected by using immune serum raised to purified whole Tafi followed by goat anti-rabbit immunoglobulin G-alkaline phosphatase secondary antibody (Cedarlane Laboratories Ltd.) and nitroblue tetrazolium and BCIP (5-bromo-4-chloro-3-indolylphosphate) substrates (12).
Electron microscopy. S. enterica serovar Enteritidis 3b strains grown on T agar were resuspended in 10 mM Tris (pH 8) and deposited on 0.5% Formvar-coated nickel grids. The immunogold labeling procedure was as follows: 40 min at RT in 1% bovine serum albumin-0.15% NaCl-10 mM Tris (pH 8), 45 min at RT with AgfA-specific monoclonal antibody ascites 3A-12 diluted 1:1,000 in 0.1% bovine serum albumin-Tris-NaCl (diluent), and 30 min at RT with goat anti-mouse immunoglobulin G-10-nm-diameter gold (Cedarlane Laboratories Inc.) diluted 1:20 in diluent. Washes between steps were performed with Tris-NaCl. For negative staining only, cells were deposited on 0.5% Formvar-coated copper grids, rinsed in dH2O, and stained with 1 to 2% uranyl acetate (pH 7). All samples were visualized with a Hitachi H7600 transmission electron microscope under HC-zoom mode at 100 kV.
| RESULTS |
|---|
|
|
|---|
bcsA and galE mutants.
Strains with
bcsA and/or galE::Tn10 mutations were generated from S. enterica serovar Enteritidis 3b or the
agfA or
agfB mutant. The phenotypes of these strains were compared after growth on TCR agar (Table 1). All agfBA+ strains exhibited an aggregative colony morphology and high CR binding, whereas all
agfA or
agfB strains were nonaggregative, with a much lower CR binding (Table 1). Introduction of the bcsA deletion caused a color change in all strains and a slight drop in CR binding in
agfA or
agfB strains (Table 1). These phenotypes matched those recently reported for similar
bcsA strains of S. enterica serovar Typhimurium (48). Introduction of the galE mutation resulted in different effects. In agfBA+ strains a drop in aggregative morphology was observed, but minimal changes in CR binding were measured (Table 1). In
agfA or
agfB strains, a color change was observed, and a small increase in CR binding was measured (Table 1). These results confirm that AgfA, AgfB, and subsequent Tafi fibers represent the major CR binding component produced by S. enterica serovar Enteritidis 3b (11), while cellulose and LPS O polysaccharide and have relatively minor effects.
|
agfB and
agfA strains.
To effect intercellular formation of Tafi between cells, S. enterica serovar Enteritidis
agfA and
agfB mutant strains depleted of LPS O polysaccharide (O antigen) or devoid of cellulose were grown closely side by side on TCR agar at 28 or 37°C for 24 or 48 h. No regions of CR binding or other changes in colony color were apparent for any the
agfA colonies grown beside
agfB colonies, indicating that Tafi were not being formed between cells. Cross-streaking the different strains together, as recently demonstrated in E. coli (9), also did not enable complementation. No colony-associated color changes were seen, indicating that Tafi were not being formed between the cells (data not shown).
To enhance complementation, liquid cultures of each of the four S. enterica serovar Enteritidis
agfB (AgfA donor) and
agfA (AgfA recipient) strains (Table 1) were mixed and grown together on TCR agar. After 24 h of growth, cells from the 16 different combinations were harvested and the relative CR binding was measured (Fig. 1, upper panels). Significant increases in CR binding were observed for the four combinations in which both donor and recipient strains carried the galE::Tn10 mutation (Fig. 1B and D, last two bars). No significant differences in CR binding were measured in the remaining groups, in which at least one strain was galE+ (Fig. 1A and C and Fig. 1B and D, first two bars).
Different levels of CR binding were correlated with cell-associated AgfA detected in the various donor-recipient combinations (Fig. 1, lower panels). Larger amounts of cell-associated AgfA were detected in combinations in which both donor and recipient strains contained galE::Tn10 (Fig. 1B and D, last two lanes). This was in contrast to the other 12 combinations, in which only a trace AgfA band was detectable for the majority of combinations (Fig. 1A and C and Fig. 1B and D, first two lanes). There was some experimental variability, and the levels of cell-associated AgfA did not always correlate with CR binding values (Fig. 1C, compare second and fourth lanes). However, the overall trend indicated that more cell-associated AgfA correlated with increased CR binding. This follows previous findings that increased AgfA polymerization or fimbrial formation correlates with increased levels of CR binding (6, 7, 15, 45).
Characterization of S. enterica serovar Enteritidis 3b
agfA and
agfB strains and detection of Tafi-associated material.
S. enterica serovar Enteritidis 3b
agfA and
agfB strains (Table 1) were analyzed for the presence of AgfA on Western blots to see if differences existed between the different strains. As expected, AgfA was not detected in any
agfA strains (Fig. 2A). Cell pellet samples from
agfB and
agfB
bcsA strains were also devoid of AgfA (Fig. 2B, lanes w+ and bcsA). Unexpectedly, residual cell-associated AgfA was detected in
agfB strains carrying the galE::Tn10 mutation (Fig. 2, lanes galE and galE bcsA),. This also correlated with an increase in CR binding in these strains (Table 1).
|
agfB mutants, cell-free agar plug samples were also analyzed. AgfA was detected in samples corresponding to each of the four S. enterica serovar Enteritidis 3b
agfB strains (Fig. 2B, right panel). Similar amounts of AgfA were detected without formic acid-induced depolymerization, indicating that the AgfA monomers were in an unpolymerized soluble form (data not shown). More AgfA was detected for galE::Tn10 strains (Fig. 2, lanes galE and galE bcsA), but the difference between strains was small. Thus, removal of cellulose or O antigen did not have a large effect on secretion of AgfA in the
agfB strains.
High-molecular-weight (high-MW) immunoreactive material was detected in two of the four
agfA and
agfB cell pellet samples (Fig. 2, lanes w+ and galE). In contrast, the high-MW material was not detected in cell pellet samples from
bcsA strains (Fig. 2, lanes bcsA and galE bcsA). This indicated that the material was associated with the presence of cellulose. However, pure cellulose was not immunoreactive with Tafi-specific immune serum (data not shown). Therefore, the high-MW material was distinct from AgfA, AgfB, and cellulose.
Immunological characterization of S. enterica serovar Enteritidis 3b agfBA+ strains. To investigate Tafi production by agfBA+ S. enterica serovar Enteritidis 3b strains (Table 1), cell pellet samples were analyzed for levels of AgfA (Fig. 3). Overall, the levels of AgfA detected in each strain were very similar (Fig. 3, left panel), which correlates with high levels of CR binding for each strain (Table 1). Thus, depleting O polysaccharide or removing cellulose had little or no effect on overall Tafi production within individual cells.
Like for the
agfB or
agfA strains, high-MW immunoreactive material was detected in cell pellets from bcsA+ strains (Fig. 3, lanes w+ and galE). Again, this immunoreactive material was not found in cell pellets from
bcsA strains (Fig. 3, lanes bcsA and galE bcsA). The high-MW material appeared to be tightly cell associated only when cellulose was produced.
To test whether Tafi could be separated from this high-MW material, we purified fimbrial material from S. enterica serovar Enteritidis 3b
bcsA galE::Tn10 by the procedure outlined by Collinson et al. (12). Western blot analysis of these purified Tafi showed that only AgfA and its associated dimer were detected (Fig. 3, lanes galE bcsA) and not the high-MW immunoreactive material; however, it could be seen along with AgfA in Tafi purified from S. enterica serovar Enteritidis 3b (Fig. 3, lanes w+). Therefore, Tafi could be separated from this high-MW material in S. enterica serovar Enteritidis 3b, but only when cellulose was not produced,.
Electron microscopy of S. enterica serovar Enteritidis 3b and Tafi with or without cellulose.
The appearances of Tafi produced by S. enterica serovar Enteritidis 3b bcsA+ and
bcsA strains were compared by using electron microscopy (Fig. 4). Immunogold labeling of S. enterica serovar Enteritidis 3b cells with an AgfA-specific monoclonal antibody most often showed Tafi as a diffuse fimbrial mat extending from the cell surface (Fig. 4A). Some cells were devoid of labeled fimbrial material, while the majority were intermediate in Tafi production (data not shown). In dramatic contrast, Tafi produced by S. enterica serovar Enteritidis 3b
bcsA were visualized as distinct, curling fibers with precise antibody labeling (Fig. 4B). In general, less fimbrial material was labeled on these cells.
|
bcsA were easily resolved into distinct individual fibers (Fig. 4D), although some fibers appeared to be occasionally branched. These observations indicated that S. enterica serovar Enteritidis 3b Tafi are closely associated with cellulose at the cell surface. Detection of Tafi-associated material in S. enterica serovar Typhimurium and E. coli strains. S. enterica serovar Enteritidis 3b, S. enterica serovar Typhimurium SL7207, and E. coli Vietnam I/1 were tested for production of Tafi and high-MW material after growth at 28 or 37°C (Fig. 5). AgfA (CsgA) was detected in cell pellets from each strain grown at 28°C but was detected only in S. enterica serovar Enteritidis 3b and E. coli Vietnam I/1 at 37°C (Fig. 5A). CsgA produced by E. coli Vietnam I/1 (Fig. 5A) migrated more slowly than AgfA, as reported previously (13).
|
The high-MW material associated with cellulose and Tafi is a polysaccharide but not CA.
CA is an anionic EPS that has been detected in association with curli (Tafi) in E. coli (14, 33). Purified CA (25) has a high-MW smearing migration pattern on SDS-PAGE, and its composition is relatively conserved between S. enterica serovar Enteritidis, S. enterica serovar Typhimurium, and E. coli (16, 18). To investigate whether the high-MW material detected by Tafi-specific immune serum represented CA, an isogenic S. enterica serovar Enteritidis 3b CA mutant strain (
wcaJ mutant) was generated. The wcaJ gene encodes the initiating undecaprenylphosphate glucose phosphotransferase (41) that is required for CA production in E. coli (1).
Immunoreactive high-MW material was detected on Western blots of cell pellet samples from both the 3b parent and
wcaJ strains (Fig. 6, lanes 5 and 7), indicating that the material did not represent CA. Furthermore, no differences in colony morphology were observed between the
wcaJ strain and S. enterica serovar Enteritidis 3b after growth at 28 or 37°C on TCR agar (data not shown). The high-MW material was resistant to digestion with proteinase K (Fig. 6, lanes 6 and 8) and did not stain with GelCode blue (Fig. 6, lanes 1 to 4), indicating that it was not proteinaceous. Small amounts of purified material tested positive for the presence of uronic acids (data not shown). These data, together with the migration pattern on SDS-PAGE, suggest that the high-MW material represents an uncharacterized anionic polysaccharide that is distinct from CA. This material may be a common component of the Tafi-cellulose extracellular matrix.
|
| DISCUSSION |
|---|
|
|
|---|
agfA (AgfA recipient) and
agfB (AgfA donor) strains of S. enterica serovar Enteritidis 3b were repeatedly unsuccessful. Increases in CR binding occurred only when
agfA and
agfB strains were grown together and only when both donor and recipient cells carried a galE::Tn10 mutation interfering with LPS O-polysaccharide biosynthesis. Previously we observed that neither AgfA nor AgfB was freely diffusible in S. enterica serovar Enteritidis 3b (46), unlike CsgA and CsgB in E. coli MC4100 (20). In E. coli MC4100, CsgA subunits secreted by
csgB colonies readily polymerize onto the cell surface of adjacent cells in
csgA colonies, resulting in an increase in CR binding (20). Consistent with our findings, E. coli MC4100 is a K-12 derivative and does not produce LPS O polysaccharide (27).
It is apparent, then, that an intact LPS integument physically precludes access of exogenous AgfA monomers to the nucleating activity of AgfB at the recipient outer membrane surface. When galE+
agfA recipient cells were used, AgfA subunits secreted from adjacent
agfB cells were unable to polymerize into intact fimbriae. All
agfB donor strains were able to secrete extracellular AgfA, although AgfA subunits were somewhat restricted from diffusing away from the
agfB cell surface when galE+
agfB donor cells were used, presumably due to the LPS barrier effect, but this barrier appears to be less restrictive toward AgfA exit than toward AgfA entrance. Introduction of the galE mutation did not affect fimbrial formation or subsequent CR binding in wild-type agfBA+ cells. In addition, all agfBA+ strains had aggregation characteristics similar to those of the S. enterica serovar Enteritidis 3b parent. These findings seem to question the role of the fimbrial assembly pathway with respect to the significance of intercellular participation in fimbrial assembly with w+ cells, colonies, and biofilms. This is particularly evident with w+ S. enterica serovar Enteritidis 3b, where there is normally no escape of soluble AgfA monomers to adjacent cells and no assembly into intact fimbriae even when AgfA escape is forced via an AgfB deficiency, unless, of course, access is permitted through a disruption in the LPS integument. Thus, the nucleation-precipitation pathway (20) for assembly of these fimbriae would a priori be restricted to operating principally at the immediate cell surface for each w+ cell. The data here seem to confirm AgfB-mediated assembly of AgfA monomers at the cell surface. However, this raises the intriguing question as to how Tafi or curli then undergo entropically driven assembly at the distal fimbrial ends, as envisioned in the original model, considerably distant from the LPS integument in the apparent absence of extracellular soluble AgfA monomers.
Interestingly, the presence of cellulose did not interfere with intercellular Tafi formation. This was surprising, since cellulose is produced at the cell surface (34) and forms part of an extracellular matrix with Tafi (39, 48). Although Tafi and cellulose are coregulated under most conditions (39, 48), this could reflect differences in temporal production.
The appearance of Tafi, viewed by electron microscopy, changed drastically when cellulose was not produced. In S. enterica serovar Enteritidis 3b (bcsA+), Tafi fibers appeared as a tangled amorphous matrix, as reported previously (12, 36). The ultrastructure of the fibers was not discernible at higher magnifications. In comparison, individual Tafi fibers formed by S. enterica serovar Enteritidis 3b
bcsA were easily resolved and had a distinctive curling appearance. At higher magnifications, the ultrastructure was more distinguishable and what appeared to be branch points were observed. These observations help explain other differences between S. enterica serovar Enteritidis 3b and E. coli MC4100. While S. enterica serovar Enteritidis Tafi fibers were unresolved and sometimes linear in appearance (12, 45), E. coli curli fibers appeared to be clearly defined with a curling appearance (9, 20). It can be safely assumed that these differences were due to the presence and absence of cellulose, respectively. It was recently demonstrated that S. enterica serovar Enteritidis 3b produces cellulose, while E. coli MC4100 does not (48). These observations indicate that cellulose forms a very tight association with Tafi in S. enterica serovar Enteritidis 3b.
We have detected another component as part of the extracellular matrix formed by Tafi and cellulose in S. enterica serovar Enteritidis 3b. This component migrates as a high-MW smear on SDS-PAGE and is recognized by immune serum raised to purified Tafi. In all prior analyses, it was assumed that the immunoreactive high-MW material represented different levels of Tafi depolymerization. In this study, by comparing cellulose-deficient and -sufficient S. enterica serovar Enteritidis strains on Western blots, it was apparent that this high-MW material was quite distinct from AgfA, AgfB, and cellulose. However, cellulose was required to tightly link this material to cells. As confirmation of this, purification of Tafi without this material was successful in a
bcsA strain. Preliminary analysis showed that the high-MW material is not proteinaceous and is slightly anionic. The material does not appear to be CA, since it is still produced in an S. enterica serovar Enteritidis
wcaJ mutant strain.
Cross-reactive high-MW material was also detected in S. enterica serovar Enteritidis, S. enterica serovar Typhimurium, and E. coli. The high-MW material was detected in S. enterica serovar Typhimurium SL7207 under conditions in which Tafi and presumably cellulose were not produced. This indicates that production of the unknown material is not regulated by AgfD. However, extracellular polysaccharide production is often induced in the presence of excess carbon when nitrogen or phosphates are limiting (43), conditions in which agfD transcription is also up-regulated (17). We hypothesize that the high-MW material represents an uncharacterized EPS that is sometimes produced in association with Tafi and cellulose. Structural characterization to test this hypothesis is in progress.
We have examined the extracellular components associated with Tafi in order to understand the native state of Tafi (curli) found on Salmonella and E. coli cell surfaces. The genes coding for Tafi (curli) and cellulose are highly conserved between Salmonella spp. and E. coli and have been detected in most strains tested so far (5, 15, 34, 41, 42). Production of these components is more limited, to between 60 and 70% of strains tested (13, 15, 18, 30, 34, 39). Production of Tafi (curli) and cellulose has not been directly linked to virulence. Highly invasive E. coli strains do not appear to produce curli (30, 38), and csg genes coding for E. coli curli are almost universally disrupted in closely related Shigella spp. (38). This suggests there is a selection pressure against Tafi (curli) production during host invasion, especially since the majority of Tafi (curli)-expressing strains produce fimbriae only at temperatures of below 30°C (15, 30, 37). Cellulose-deficient mutants of S. enterica serovar Enteritidis showed no difference in virulence in both the BALB/c mouse and 1-day-old chick infection models (39). Again, there is evidence of selective pressure against cellulose production in highly invasive strains (34).
Tafi and curli do not exist alone as protein fibers under normal conditions. In association with cellulose, they are thought to form an important cellular coating associated with biofilm formation and cell-cell attachment (4, 33, 36, 39), which may be analogous to the aggregative physiological state, the Rugose phenotype (2). Production of a more complex matrix consisting of Tafi, cellulose, and EPS would seem to be particularly advantageous for environmental persistence of Salmonella spp. and may even aid in survival in the mammalian gut. Cellulose and EPS have been shown to protect cells against acid and heat (29) and chlorine treatment (39) and presumably would prevent desiccation of cells, aid in nutrient trapping, and contribute to buffering (29, 43). Thus, the evidence presented here suggests that Tafi are an integral component of a stable and protective, complex protein-polysaccharide matrix.
| ACKNOWLEDGMENTS |
|---|
Funding for this work was provided by grants to W. W. Kay from the National Sciences and Engineering Research Council and the Canadian Bacterial Diseases Network.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||