Previous Article | Next Article 
Journal of Bacteriology, November 2003, p. 6723-6727, Vol. 185, No. 22
0021-9193/03/$08.00+0 DOI: 10.1128/JB.185.22.6723-6727.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
aadA Confers Streptomycin Resistance in Borrelia burgdorferi
Kristi L. Frank,1,
Sharyl F. Bundle,1,
Michele E. Kresge,1,
Christian H. Eggers,2 and D. Scott Samuels1*
Division of Biological Sciences, The University of Montana, Missoula, Montana 59812,1
Center for Microbial Pathogenesis, University of Connecticut Health Center, Farmington, Connecticut 060302
Received 6 June 2003/
Accepted 26 August 2003

ABSTRACT
To enhance genetic manipulation of the Lyme disease spirochete
Borrelia burgdorferi, we assayed the
aadA gene for the ability
to confer resistance to the antibiotics spectinomycin and streptomycin.
Using the previously described pBSV2 as a backbone, a shuttle
vector, termed pKFSS1, which carries the
aadA open reading frame
fused to the
B.
burgdorferi flgB promoter was constructed. The
hybrid
flgB promoter-
aadA cassette confers resistance to spectinomycin
and streptomycin in both
B.
burgdorferi and
Escherichia coli.
pKFSS1 has a replication origin derived from the 9-kb circular
plasmid and can be comaintained in
B.
burgdorferi with extant
shuttle vector pCE320, which has a replication origin derived
from a 32-kb circular plasmid, or pBSV2, despite the fact that
pKFSS1 and pBSV2 have the same replication origin. Our results
demonstrate the availability of a new selectable marker and
shuttle vector for genetically dissecting
B.
burgdorferi at
the molecular level.

TEXT
Borrelia burgdorferi is the etiologic agent of Lyme disease,
the most common arthropod-borne disease in the United States
(
22,
34). The progressive development of a system to genetically
manipulate
B.
burgdorferi has provided many of the requisite
tools to analyze molecular mechanisms in this pathogenic spirochete
(
4,
9,
10,
26,
29,
31,
33,
35).
Four antibiotic resistance markers have been used for molecular genetic analyses of B. burgdorferi (4, 12, 29, 31). The first marker developed, a mutant gyrB allele that confers coumermycin A1 resistance (26, 29, 30), has been used for targeted gene disruption in B. burgdorferi (5, 11, 17, 38-40). However, caveats regarding the coumermycin A1 resistance marker include the tendency of the gyrB gene to recombine at the chromosomal locus, which necessitates extensive screening of transformants (26), and pleiotropic effects that are likely caused by perturbed levels of DNA supercoiling (1, 2) (D. S. Samuels, C. R. Kuchel, and M. E. Kresge, unpublished data). In response to the need for an exogenous selectable marker, Bono et al. fused the open reading frame of aphI, a kanamycin resistance gene from Tn903, to either the B. burgdorferi flaB or flgB promoters, thereby developing kanamycin resistance cassettes that function in B. burgdorferi (4). These hybrid resistance markers have been used to disrupt genes (7, 12, 18, 20, 23), complement a gene (16, 25), demonstrate transduction by bacteriophage
BB1 (10), and construct Escherichia coli-B. burgdorferi shuttle vectors (9, 35, 36). A third selectable marker, the ermC gene conferring erythromycin resistance, was originally introduced into B. burgdorferi on a broad-host-range plasmid from gram-positive bacteria (31). It has been used to disrupt genes (15, 16, 18) and to conduct complementation studies in B. burgdorferi (32). A gentamicin resistance marker was constructed by fusing the aacC1 open reading frame to the flgB promoter and used to disrupt genes (12, 36). Other antibiotic resistance markers have been identified recently but not yet used to genetically manipulate B. burgdorferi (33).
With the new tools available to study B. burgdorferi at the molecular level, genetic manipulation is poised to become powerful and convenient. Currently, the genetic system needs to be augmented by developing additional selectable markers for complementation studies, multiple gene disruptions, and dual-plasmid experiments. Therefore, we investigated whether the aadA gene, which encodes an aminoglycoside-3''-adenylyltransferase that confers resistance to spectinomycin and streptomycin (19, 24), can function in B. burgdorferi.
Shuttle vector construction and transformation.
We constructed a hybrid antibiotic resistance marker by fusing the aadA open reading frame to the strong constitutive flgB promoter (13) on the backbone of the extant E. coli-B. burgdorferi shuttle vector pBSV2 (35). The aadA gene from R100, a broad-host-range plasmid originally isolated from Shigella flexneri (21, 37), was generously provided by Joachim Frey (Institute for Veterinary Bacteriology, University of Berne, Berne, Switzerland) on plasmid pHP45
(24). Primers aadA F+NdeI (CATATGAGGGAAGCGGTGATC) and aadA R+AatII (GACGTCATTATTTGCCGACTACC), which introduced restriction sites for enzymes NdeI and AatII, respectively, were used to amplify the aadA gene by PCR, essentially as described previously (17, 29). The 802-bp aadA PCR product was then cloned into plasmid pCR2.1-TOPO (Invitrogen) to create pTAaadA1. pBSV2, generously provided by Philip Stewart (Rocky Mountain Laboratories, Hamilton, Mont.), and pTAaadA1 were each digested with AatII and NdeI. The digestion removes the kanamycin resistance open reading frame and part of the zeocin resistance gene from pBSV2. The appropriate restriction fragments were resolved by agarose gel electrophoresis and purified with a QIAEX II gel extraction kit (QIAGEN). pKFSS1 (Fig. 1) was constructed by ligating the open reading frame of aadA (from pTAaadA1) to the flgB promoter (flgBp) carried on the 5.3-kb backbone of AatII- and NdeI-digested pBSV2 (35).
B.
burgdorferi sensu stricto strain B31-A, a high-passage avirulent
clone of strain B31 (
4), was routinely cultivated in modified
Barbour-Stoenner-Kelly (BSK-H) complete medium (Sigma) at 34°C
with a

5% CO
2 atmosphere.
B.
burgdorferi was electroporated
with 1 to 10 µg of plasmid DNA and plated in semisolid
medium as previously described (
27), although 10
x medium 199
was fully or partially substituted for 10
x CMRL-1066 in some
experiments. Transformants were selected in either 160 to 400
µg of kanamycin ml
-1, 1.5 µg of spectinomycin ml
-1,
or 20 to 80 µg of streptomycin ml
-1. A mock electrotransformation
(no DNA) served as a control.
Selection of transformants.
B. burgdorferi was transformed with either pBSV2, which carries the flgBp::aphI kanamycin resistance cassette, or pKFSS1, which carries the flgBp::aadA spectinomycin and streptomycin resistance cassette. Cells were plated in medium containing kanamycin, spectinomycin, or streptomycin to assess whether these antibiotics can be used to select for B. burgdorferi transformants (Table 1). Transformation of B. burgdorferi with pKFSS1 yielded colonies on medium containing either streptomycin or spectinomycin, but not kanamycin. Electroporation with no DNA, pBSV2, or pKFSS1 yielded high numbers of colonies when plated on medium containing spectinomycin, but only cells transformed with pKFSS1 produced colonies on plates containing streptomycin.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Transformation efficiencies of B. burgdorferi with pBSV2 or pKFSS1 in semisolid medium containing different antibioticsa
|
B.
burgdorferi transformants isolated by selection with spectinomycin
or streptomycin were analyzed for the presence of pKFSS1 by
transforming total genomic DNA from these clones into
E.
coli.
Genomic DNA was extracted from five randomly chosen spectinomycin-resistant
and two streptomycin-resistant
B.
burgdorferi colonies as described
previously (
28). DNA was transformed into chemically competent
E.
coli JM109, and the cells were plated on semisolid Luria-Bertani
medium containing 60 to 100 µg of spectinomycin ml
-1.
flgBp::
aadA confers resistance to both streptomycin and spectinomycin
in
E.
coli, but many common cloning strains are resistant to
streptomycin. Plasmid DNA was recovered from
E.
coli transformants
by alkaline lysis (
3). Only those
E.
coli cells transformed
with DNA from streptomycin-resistant pKFSS1 transformants of
B.
burgdorferi acquired resistance to spectinomycin; pKFSS1
was recovered from these
E.
coli transformants. pKFSS1 was not
recovered from any
B.
burgdorferi colonies isolated on plates
containing spectinomycin, suggesting that they were background
mutants.
Plasmid stability.
A randomly chosen B. burgdorferi transformant carrying pKFSS1 was serially passaged in liquid BSK-H medium without streptomycin selection at 34°C. After about 50 generations, the culture was plated on semisolid medium without selection, and 10 colonies were isolated. Total genomic DNA was extracted from B. burgdorferi clones and used to transform E. coli DH5
to screen for pKFSS1, as described above. Six of the 10 colonies isolated in the absence of streptomycin selection contained pKFSS1. Therefore, B. burgdorferi transformants maintained pKFSS1 for 50 generations. However, pKFSS1 is not as stable as the parental plasmid, pBSV2, which is maintained in all 20 colonies following
90 passages in the absence of selection, as assayed by PCR (36). This difference in stability was unexpected, because the two plasmids have the same replication origin and are nearly identical except for the selectable marker; pKFSS1 also has a truncated zeocin resistance gene downstream of the aadA gene.
Antibiotic resistance in B. burgdorferi.
The ability of pKFSS1 to confer resistance to selected aminoglycosides and spectinomycin was measured to assess whether the flgBp::aadA marker could be used in conjunction with the extant selectable markers that confer resistance to similar antibiotics. Resistance was assayed by inoculating media containing various concentrations of streptomycin, spectinomycin, kanamycin, and gentamicin antibiotics. Cultures of wild-type and transformed B. burgdorferi were inoculated into 4-ml cultures of BSK-H at approximately 106 cells ml-1 and grown at 34°C for about 72 h in the presence of the antibiotics. Cultures were assayed for growth by spectrophotometry as previously described (28). Assays were replicated three to five times. The antibiotic concentration that inhibits 50% of bacterial growth was determined for wild-type B. burgdorferi and pBSV2 and pKFSS1 transformants (Table 2). The flgBp::aadA cassette in B. burgdorferi transformants confers 10-fold resistance to spectinomycin and approximately 100-fold resistance to streptomycin. No cross-resistance to kanamycin or gentamicin was observed with the flgBp::aadA cassette. Additionally, the flgBp::aphI cassette carried on pBSV2 does not confer resistance to either spectinomycin or streptomycin.
Plasmid compatibility.
The ability to transform
B.
burgdorferi with two different shuttle
vectors would expand experimental opportunities. Therefore,
we transformed cells carrying pKFSS1 with the shuttle vector
pCE320 (
9), which uses a compatible replication origin from
a 32-kb circular plasmid and the
flgBp::
aphI kanamycin resistance
cassette. Plasmids carrying the same replication origin typically
are not maintained together in the same cell (
14), but plasmid
incompatibility has not been extensively studied in
B.
burgdorferi (
9,
35,
36). Therefore, pKFSS1 was also cotransformed with its
parental plasmid pBSV2. Plasmids were electroporated into
B.
burgdorferi, and cells were plated in semisolid medium containing
both kanamycin and streptomycin, as described above. As expected,
transforming cells carrying pKFSS1 with pCE320 yielded colonies
on plates with both kanamycin and streptomycin, indicating that
the cells contained both resistance cassettes. Surprisingly,
colonies resistant to both kanamycin and streptomycin were also
obtained from cells carrying pKFSS1 transformed with pBSV2,
although both plasmids carry the same replication origin derived
from the 9-kb circular plasmid cp9 (
35).
To test that these plasmids autonomously replicated in the cotransformant clones, DNA was isolated using a Wizard Plus Midipreps DNA purification system (Promega) and
7 µg was loaded on a 1% agarose gel in 1x TAE (40 mM Tris-20 mM acetate-1 mM EDTA) buffer. Electrophoresis and Southern blotting to an Immobilon-Ny+ membrane (Millipore) were performed essentially as described previously (1, 10), except the hybridization signal was detected using a FLA3000G radioisotope imaging system (Fuji film). The probes were amplified by two rounds of PCR using oligonucleotides aadA F+NdeI and aadA R+AatII or oligonucleotides kanR 88F (AATGTCGGGCAATCAGGTG) and kanR 488R (TCACTCGCATCAACCAAACC), and labeled using a Prime-It II random primer labeling kit (Stratagene). pKFSS1 and pCE320 differ in size, so they are readily resolved and detected in the cloned transformants by ethidium bromide staining (Fig. 2A). pKFSS1 and pBSV2 are similar in size, but they can be distinguished using either an aadA probe specific for pKFSS1 (Fig. 2B) or an aphI probe specific for pBSV2 and pCE320 (Fig. 2C).
Because pKFSS1 and pBSV2 carry the same origin of replication,
we assayed plasmid compatibility by growing the cotransformant
in the presence or absence of both kanamycin and streptomycin
for 40 generations, as described above. Cells were then plated
in the absence of antibiotic or in the presence of kanamycin,
streptomycin, or both kanamycin and streptomycin to assess the
stability of pKFSS1 and pBSV2 (Table
3). We expected that the
same number of colonies would be obtained on all four plates
from cells grown in the presence of antibiotics, which would
maintain selective pressure on those cells containing both plasmids.
Interestingly, cells on plates with streptomycin (either alone
or with kanamycin) formed about 30% fewer colonies than cells
on plates with kanamycin. We speculate that cells carrying pKFSS1
have a lower plating efficiency than cells carrying pBSV2, which
may explain the observed lower transformation efficiency of
pKFSS1 (Table
1). The mechanism for this lower plating efficiency
is unknown and unanticipated, considering the similarity of
pKFSS1 and pBSV2. Most cells grown in the absence of antibiotic
maintained pBSV2. However, only about half the colonies were
obtained on plates containing streptomycin (selecting for pKFSS1)
from the cells grown without antibiotic compared to cells grown
with an antibiotic. This is consistent with the above observation
that pKFSS1 is not as stable as pBSV2. Several colonies from
the
B.
burgdorferi cotransformant grown without antibiotic were
isolated and assayed for plasmid DNA by transformation of
E.
coli, as described above. All colonies contained the expected
plasmid(s) selected with the antibiotic(s) used for plating
(data not shown).
View this table:
[in this window]
[in a new window]
|
TABLE 3. Plating efficiencies in the presence of two antibiotics of a B. burgdorferi clone carrying both pBSV2 (kanamycin resistance) and pKFSS1 (streptomycin resistance) after 40 generations with or without selection
|
Conclusions.
Molecular genetic manipulation in
B.
burgdorferi, though relatively
immature, has finally advanced to the stage where complex genetic
studies can be conducted. Several methods to introduce foreign
DNA into
B.
burgdorferi have been described, including electroporation
(
27,
29), transduction (
10), and chemical transformation (
12).
Gene disruption and complementation experiments, made possible
by the development of selectable markers (
4,
12,
29,
31,
33)
and shuttle vectors (
9,
31,
35), are now available for probing
gene function in
B.
burgdorferi.
We examined the ability of the aadA gene to confer spectinomycin and streptomycin resistance in B. burgdorferi. This resistance gene functions in several bacteria, including Myxococcus xanthus, another genetically challenging organism (19). We demonstrated that a hybrid flgBp::aadA cassette provides approximately 100-fold resistance to streptomycin in B. burgdorferi (Table 2) and allows for selection of streptomycin-resistant transformants in semisolid medium. The aadA gene with its native promoter confers low-level antibiotic resistance (B. J. Kimmel, M. E. Kresge, and D. S. Samuels, unpublished data). Spectinomycin-resistant B. burgdorferi arose at a high frequency, regardless of whether they had been electroporated with pKFSS1, pBSV2, or no DNA (Table 1). We were unable to recover plasmid DNA from these spectinomycin-resistant colonies, which suggests that they were naturally occurring background mutants.
The ability to use streptomycin resistance as a selectable marker adds significantly to the existing antibiotic-resistant genes. Streptomycin is not clinically used to treat B. burgdorferi infections in humans, and aadA does not have the potential for homologous recombination into the B. burgdorferi genome. Limitations imposed by the coumermycin A1 marker have resulted in recent genetic studies relying on only the erythromycin resistance and kanamycin resistance markers (10, 12, 15, 16, 18, 20, 23, 25, 32). flgBp::aadA does not confer cross-resistance to either kanamycin or gentamicin (Table 2), allowing this resistance cassette to be used in conjunction with flgBp::aphI and flgBp::aacC1.
pKFSS1 is compatible with either pCE320 or pBSV2, even though pKFSS1 and pBSV2 have the same cp9 origin of replication. The comaintenance of these two plasmids is surprising because pBSV2 appears to displace the parental cp9 plasmid (35). In addition, other B. burgdorferi plasmids with the same replication origin and compatibility locus demonstrate plasmid incompatibility (9, 35, 36). However, unlike the other larger B. burgdorferi plasmids, cp9 does not encode a gene for a paralogous family 32 (PF32) protein (6, 8, 35). PF32 proteins are homologous to the ParA proteins that play a critical role in the stable maintenance of several well-characterized plasmids, including P1 and F (14). A number of factors, including copy number and the absence of the ParA homolog, may contribute to the maintenance of pBSV2 and pKFFS1 in the same B. burgdorferi cell. Whatever the reason, compatibility of pKFSS1 with either pCE320 or pBSV2 enables experimental approaches that require introducing genes or regulatory sequences on two different vectors. flgBp::aadA and pKFSS1 add an essential new capability to the genetic study of B. burgdorferi by furthering techniques to complement mutants, simultaneously disrupt multiple genes, monitor several promoters, or assay gene interactions.

ACKNOWLEDGMENTS
K. L. Frank and S. F. Bundle contributed equally to this work.
We thank Meghan Lybecker, Mike Minnick, and Justin Radolf for thoughtful and critical reading of the manuscript, Philip Stewart for providing pBSV2, Joachim Frey for providing pHP45
, Betsy Kimmel and Jill Dion for assistance, and Phil Youderian, Philip Stewart, Chuck Sohaskey, Jon Skare, Nyles Charon, Henry Krisch, Jim Bono, Lori Lubke, and Noel Keen for useful discussions or providing other materials.
This work was supported in part by grants from the National Science Foundation (MCB-9722408), National Institutes of Health (AI39695 and AI53195), and the University Grant Program. K.L.F. is the recipient of an IBS-CORE Undergraduate Research Fellowship through a grant from the Howard Hughes Medical Institute, a Watkins Scholarship from The University of Montana, and an Undergraduate Research Assistantship from UM NSF EPSCoR. K.L.F. was also supported by a NSF Research Experience for Undergraduates supplement. C.H.E. was supported by a grant from the National Institutes of Health (AI29735) to Justin D. Radolf and Melissa J. Caimano. D.S.S. was supported in part by a sabbatical award from The University of Montana.

FOOTNOTES
* Corresponding author. Mailing address: Division of Biological Sciences, 32 Campus Dr., #4824, The University of Montana, Missoula, MT 59812-4824. Phone: (406) 243-6145. Fax: (406) 243-4184. E-mail:
samuels{at}mso.umt.edu.

Present address: Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, MN 55905. 
Present address: Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030. 
Deceased. 

REFERENCES
1 - Alverson, J., S. F. Bundle, C. D. Sohaskey, M. C. Lybecker, and D. S. Samuels. 2003. Transcriptional regulation of the ospAB and ospC promoters from Borrelia burgdorferi. Mol. Microbiol. 48:1665-1677.[CrossRef][Medline]
2 - Alverson, J., and D. S. Samuels. 2002. groEL expression in gyrB mutants of Borrelia burgdorferi. J. Bacteriol. 184:6069-6072.[Abstract/Free Full Text]
3 - Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1999. Short protocols in molecular biology, 4th ed. Wiley, New York, N.Y.
4 - Bono, J. L., A. F. Elias, J. J. Kupko III, B. Stevenson, K. Tilly, and P. Rosa. 2000. Efficient targeted mutagenesis in Borrelia burgdorferi. J. Bacteriol. 182:2445-2452.[Abstract/Free Full Text]
5 - Bono, J. L., K. Tilly, B. Stevenson, D. Hogan, and P. Rosa. 1998. Oligopeptide permease in Borrelia burgdorferi: putative peptide-binding components encoded by both chromosomal and plasmid loci. Microbiology 144:1033-1044.[Abstract/Free Full Text]
6 - Casjens, S., N. Palmer, R. van Vugt, W. M. Huang, B. Stevenson, P. Rosa, R. Lathigra, G. Sutton, J. Peterson, R. J. Dodson, D. Haft, E. Hickey, M. Gwinn, O. White, and C. M. Fraser. 2000. A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35:490-516.[CrossRef][Medline]
7 - Coburn, J., and C. Cugini. 2003. Targeted mutation of the outer membrane protein P66 disrupts attachment of the Lyme disease agent, Borrelia burgdorferi, to integrin
vß3. Proc. Natl. Acad. Sci. USA 100:7301-7306.[Abstract/Free Full Text]
8 - Dunn, J. J., S. R. Buchstein, L.-L. Butler, S. Fisenne, D. S. Polin, B. N. Lade, and B. J. Luft. 1994. Complete nucleotide sequence of a circular plasmid from the Lyme disease spirochete, Borrelia burgdorferi. J. Bacteriol. 176:2706-2717.[Abstract/Free Full Text]
9 - Eggers, C. H., M. J. Caimano, M. L. Clawson, W. G. Miller, D. S. Samuels, and J. D. Radolf. 2002. Identification of loci critical for replication and compatibility of a Borrelia burgdorferi cp32 plasmid and use of a cp32-based shuttle vector for expression of fluorescent reporters in the Lyme disease spirochaete. Mol. Microbiol. 43:281-296.[CrossRef][Medline]
10 - Eggers, C. H., B. J. Kimmel, J. L. Bono, A. Elias, P. Rosa, and D. S. Samuels. 2001. Transduction by
BB-1, a bacteriophage of Borrelia burgdorferi. J. Bacteriol. 183:4771-4778.[Abstract/Free Full Text]
11 - Elias, A. F., J. L. Bono, J. A. Carroll, P. Stewart, K. Tilly, and P. Rosa. 2000. Altered stationary-phase response in a Borrelia burgdorferi rpoS mutant. J. Bacteriol. 182:2909-2918.[Abstract/Free Full Text]
12 - Elias, A. F., P. E. Stewart, D. Grimm, M. J. Caimano, C. H. Eggers, K. Tilly, J. L. Bono, D. R. Akins, J. D. Radolf, T. G. Schwan, and P. Rosa. 2002. Clonal polymorphism of Borrelia burgdorferi strain B31 MI: implications for mutagenesis in an infectious strain background. Infect. Immun. 70:2139-2150.[Abstract/Free Full Text]
13 - Ge, Y., I. G. Old, I. Saint Girons, and N. W. Charon. 1997. Molecular characterization of a large Borrelia burgdorferi motility operon which is initiated by a consensus
70 promoter. J. Bacteriol. 179:2289-2299.[Abstract/Free Full Text]
14 - Gerdes, K., J. Møller-Jensen, and R. B. Jensen. 2000. Plasmid and chromosome partitioning: surprises from phylogeny. Mol. Microbiol. 37:455-466.[CrossRef][Medline]
15 - Hübner, A., A. T. Revel, D. M. Nolen, K. E. Hagman, and M. V. Norgard. 2003. Expression of a luxS gene is not required for Borrelia burgdorferi infection of mice via needle inoculation. Infect. Immun. 71:2892-2896.[Abstract/Free Full Text]
16 - Hübner, A., X. Yang, D. M. Nolen, T. G. Popova, F. C. Cabello, and M. V. Norgard. 2001. Expression of Borrelia burgdorferi OspC and DbpA is controlled by a RpoN-RpoS regulatory pathway. Proc. Natl. Acad. Sci. USA 98:12724-12729.[Abstract/Free Full Text]
17 - Knight, S. W., B. J. Kimmel, C. H. Eggers, and D. S. Samuels. 2000. Disruption of the Borrelia burgdorferi gac gene, encoding the naturally synthesized GyrA C-terminal domain. J. Bacteriol. 182:2048-2051.[Abstract/Free Full Text]
18 - Li, C., R. G. Bakker, M. A. Motaleb, M. L. Sartakova, F. C. Cabello, and N. W. Charon. 2002. Asymmetrical flagellar rotation in Borrelia burgdorferi nonchemotactic mutants. Proc. Natl. Acad. Sci. USA 99:6169-6174.[Abstract/Free Full Text]
19 - Magrini, V., C. Creighton, D. White, P. L. Hartzell, and P. Youderian. 1998. The aadA gene of plasmid R100 confers resistance to spectinomycin and streptomycin in Myxococcus xanthus. J. Bacteriol. 180:6757-6760.[Abstract/Free Full Text]
20 - Motaleb, M. A., L. Corum, J. L. Bono, A. F. Elias, P. Rosa, D. S. Samuels, and N. W. Charon. 2000. Borrelia burgdorferi periplasmic flagella have both skeletal and motility functions. Proc. Natl. Acad. Sci. USA 97:10899-10904.[Abstract/Free Full Text]
21 - Nakaya, R., A. Nakamura, and Y. Murata. 1960. Resistance transfer agents in Shigella. Biochem. Biophys. Res. Commun. 3:654-659.[CrossRef][Medline]
22 - Nordstrand, A., A. G. Barbour, and S. Bergström. 2000. Borrelia pathogenesis research in the post-genomic and post-vaccine era. Curr. Opin. Microbiol. 3:86-92.[CrossRef][Medline]
23 - Östberg, Y., M. Pinne, R. Benz, P. Rosa, and S. Bergström. 2002. Elimination of channel-forming activity by insertional inactivation of the p13 gene in Borrelia burgdorferi. J. Bacteriol. 184:6811-6819.[Abstract/Free Full Text]
24 - Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313.[CrossRef][Medline]
25 - Purser, J. E., M. B. Lawrenz, M. J. Caimano, J. K. Howell, J. D. Radolf, and S. J. Norris. 2003. A plasmid-encoded nicotinamidase (PncA) is essential for infectivity of Borrelia burgdorferi in a mammalian host. Mol. Microbiol. 48:753-764.[CrossRef][Medline]
26 - Rosa, P., D. S. Samuels, D. Hogan, B. Stevenson, S. Casjens, and K. Tilly. 1996. Directed insertion of a selectable marker into a circular plasmid of Borrelia burgdorferi. J. Bacteriol. 178:5946-5953.[Abstract/Free Full Text]
27 - Samuels, D. S. 1995. Electrotransformation of the spirochete Borrelia burgdorferi, p. 253-259. In J. A. Nickoloff (ed.), Electroporation protocols for microorganisms, vol. 47. Humana Press, Totowa, N.J.
28 - Samuels, D. S., and C. F. Garon. 1993. Coumermycin A1 inhibits growth and induces relaxation of supercoiled plasmids in Borrelia burgdorferi, the Lyme disease agent. Antimicrob. Agents Chemother. 37:46-50.[Abstract/Free Full Text]
29 - Samuels, D. S., K. E. Mach, and C. F. Garon. 1994. Genetic transformation of the Lyme disease agent Borrelia burgdorferi with coumarin-resistant gyrB. J. Bacteriol. 176:6045-6049.[Abstract/Free Full Text]
30 - Samuels, D. S., R. T. Marconi, W. M. Huang, and C. F. Garon. 1994. gyrB mutations in coumermycin A1-resistant Borrelia burgdorferi. J. Bacteriol. 176:3072-3075.[Abstract/Free Full Text]
31 - Sartakova, M., E. Dobrikova, and F. C. Cabello. 2000. Development of an extrachromosomal cloning vector system for use in Borrelia burgdorferi. Proc. Natl. Acad. Sci. USA 97:4850-4855.[Abstract/Free Full Text]
32 - Sartakova, M. L., E. Y. Dobrikova, M. A. Motaleb, H. P. Godfrey, N. W. Charon, and F. C. Cabello. 2001. Complementation of a nonmotile flaB mutant of Borrelia burgdorferi by chromosomal integration of a plasmid containing a wild-type flaB allele. J. Bacteriol. 183:6558-6564.[Abstract/Free Full Text]
33 - Sartakova, M. L., E. Y. Dobrikova, D. A. Terekhova, R. Devis, J. V. Bugrysheva, O. V. Morozova, H. P. Godfrey, and F. C. Cabello. 2003. Novel antibiotic-resistance markers in pGK12-derived vectors for Borrelia burgdorferi. Gene 303:131-137.[CrossRef][Medline]
34 - Steere, A. C. 2001. Lyme disease. N. Engl. J. Med. 345:115-125.[Free Full Text]
35 - Stewart, P., R. Thalken, J. Bono, and P. Rosa. 2001. Isolation of a circular plasmid region sufficient for autonomous replication and transformation of infectious Borrelia burgdorferi. Mol. Microbiol. 39:714-721.[CrossRef][Medline]
36 - Stewart, P. E., G. Chaconas, and P. Rosa. 2003. Conservation of plasmid maintenance functions between linear and circular plasmids in Borrelia burgdorferi. J. Bacteriol. 185:3202-3209.[Abstract/Free Full Text]
37 - Sugino, Y., and Y. Hirota. 1962. Conjugal fertility associated with resistance factor R in Escherichia coli. J. Bacteriol. 84:902-910.[Abstract/Free Full Text]
38 - Tilly, K., S. Casjens, B. Stevenson, M. Bono, D. S. Samuels, D. Hogan, and P. Rosa. 1997. The Borrelia burgdorferi circular plasmid cp26: conservation of plasmid structure and targeted inactivation of the ospC gene. Mol. Microbiol. 23:361-373.
39 - Tilly, K., A. F. Elias, J. Errett, E. Fischer, R. Iyer, I. Schwartz, J. L. Bono, and P. Rosa. 2001. Genetics and regulation of chitobiose utilization in Borrelia burgdorferi. J. Bacteriol. 183:5544-5553.[Abstract/Free Full Text]
40 - Tilly, K., L. Lubke, and P. Rosa. 1998. Characterization of circular plasmid dimers in Borrelia burgdorferi. J. Bacteriol. 180:5676-5681.[Abstract/Free Full Text]
Journal of Bacteriology, November 2003, p. 6723-6727, Vol. 185, No. 22
0021-9193/03/$08.00+0 DOI: 10.1128/JB.185.22.6723-6727.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Kenedy, M. R., Vuppala, S. R., Siegel, C., Kraiczy, P., Akins, D. R.
(2009). CspA-Mediated Binding of Human Factor H Inhibits Complement Deposition and Confers Serum Resistance in Borrelia burgdorferi. Infect. Immun.
77: 2773-2782
[Abstract]
[Full Text]
-
Chen, Q., Fischer, J. R., Benoit, V. M., Dufour, N. P., Youderian, P., Leong, J. M.
(2008). In Vitro CpG Methylation Increases the Transformation Efficiency of Borrelia burgdorferi Strains Harboring the Endogenous Linear Plasmid lp56. J. Bacteriol.
190: 7885-7891
[Abstract]
[Full Text]
-
Siegel, C., Schreiber, J., Haupt, K., Skerka, C., Brade, V., Simon, M. M., Stevenson, B., Wallich, R., Zipfel, P. F., Kraiczy, P.
(2008). Deciphering the Ligand-binding Sites in the Borrelia burgdorferi Complement Regulator-acquiring Surface Protein 2 Required for Interactions with the Human Immune Regulators Factor H and Factor H-like Protein 1. J. Biol. Chem.
283: 34855-34863
[Abstract]
[Full Text]
-
Ouyang, Z., Blevins, J. S., Norgard, M. V.
(2008). Transcriptional interplay among the regulators Rrp2, RpoN and RpoS in Borrelia burgdorferi. Microbiology
154: 2641-2658
[Abstract]
[Full Text]
-
Boardman, B. K., He, M., Ouyang, Z., Xu, H., Pang, X., Yang, X. F.
(2008). Essential Role of the Response Regulator Rrp2 in the Infectious Cycle of Borrelia burgdorferi. Infect. Immun.
76: 3844-3853
[Abstract]
[Full Text]
-
Sal, M. S., Li, C., Motalab, M. A., Shibata, S., Aizawa, S.-I., Charon, N. W.
(2008). Borrelia burgdorferi Uniquely Regulates Its Motility Genes and Has an Intricate Flagellar Hook-Basal Body Structure. J. Bacteriol.
190: 1912-1921
[Abstract]
[Full Text]
-
Pal, U., Wang, P., Bao, F., Yang, X., Samanta, S., Schoen, R., Wormser, G. P., Schwartz, I., Fikrig, E.
(2008). Borrelia burgdorferi basic membrane proteins A and B participate in the genesis of Lyme arthritis. JEM
205: 133-141
[Abstract]
[Full Text]
-
Gautam, A., Hathaway, M., McClain, N., Ramesh, G., Ramamoorthy, R.
(2008). Analysis of the determinants of bba64 (P35) gene expression in Borrelia burgdorferi using a gfp reporter. Microbiology
154: 275-285
[Abstract]
[Full Text]
-
He, M., Boardman, B. K., Yan, D., Yang, X. F.
(2007). Regulation of Expression of the Fibronectin-Binding Protein BBK32 in Borrelia burgdorferi. J. Bacteriol.
189: 8377-8380
[Abstract]
[Full Text]
-
Smith, A. H., Blevins, J. S., Bachlani, G. N., Yang, X. F., Norgard, M. V.
(2007). Evidence that RpoS ({sigma}S) in Borrelia burgdorferi Is Controlled Directly by RpoN ({sigma}54/{sigma}N). J. Bacteriol.
189: 2139-2144
[Abstract]
[Full Text]
-
Blevins, J. S., Revel, A. T., Smith, A. H., Bachlani, G. N., Norgard, M. V.
(2007). Adaptation of a Luciferase Gene Reporter and lac Expression System to Borrelia burgdorferi. Appl. Environ. Microbiol.
73: 1501-1513
[Abstract]
[Full Text]
-
Bakker, R. G., Li, C., Miller, M. R., Cunningham, C., Charon, N. W.
(2007). Identification of Specific Chemoattractants and Genetic Complementation of a Borrelia burgdorferi Chemotaxis Mutant: Flow Cytometry-Based Capillary Tube Chemotaxis Assay. Appl. Environ. Microbiol.
73: 1180-1188
[Abstract]
[Full Text]
-
Dubytska, L., Godfrey, H. P., Cabello, F. C.
(2006). Borrelia burgdorferi ftsZ Plays a Role in Cell Division.. J. Bacteriol.
188: 1969-1978
[Abstract]
[Full Text]
-
Criswell, D., Tobiason, V. L., Lodmell, J. S., Samuels, D. S.
(2006). Mutations Conferring Aminoglycoside and Spectinomycin Resistance in Borrelia burgdorferi. Antimicrob. Agents Chemother.
50: 445-452
[Abstract]
[Full Text]
-
Motaleb, M. A., Miller, M. R., Li, C., Bakker, R. G., Goldstein, S. F., Silversmith, R. E., Bourret, R. B., Charon, N. W.
(2005). CheX Is a Phosphorylated CheY Phosphatase Essential for Borrelia burgdorferi Chemotaxis. J. Bacteriol.
187: 7963-7969
[Abstract]
[Full Text]
-
Brooks, C. S., Vuppala, S. R., Jett, A. M., Alitalo, A., Meri, S., Akins, D. R.
(2005). Complement Regulator-Acquiring Surface Protein 1 Imparts Resistance to Human Serum in Borrelia burgdorferi. J. Immunol.
175: 3299-3308
[Abstract]
[Full Text]
-
Bugrysheva, J. V., Bryksin, A. V., Godfrey, H. P., Cabello, F. C.
(2005). Borrelia burgdorferi rel Is Responsible for Generation of Guanosine-3'-Diphosphate-5'-Triphosphate and Growth Control. Infect. Immun.
73: 4972-4981
[Abstract]
[Full Text]
-
Yang, X. F., Lybecker, M. C., Pal, U., Alani, S. M., Blevins, J., Revel, A. T., Samuels, D. S., Norgard, M. V.
(2005). Analysis of the ospC Regulatory Element Controlled by the RpoN-RpoS Regulatory Pathway in Borrelia burgdorferi. J. Bacteriol.
187: 4822-4829
[Abstract]
[Full Text]
-
Revel, A. T., Blevins, J. S., Almazan, C., Neil, L., Kocan, K. M., de la Fuente, J., Hagman, K. E., Norgard, M. V.
(2005). bptA (bbe16) is essential for the persistence of the Lyme disease spirochete, Borrelia burgdorferi, in its natural tick vector. Proc. Natl. Acad. Sci. USA
102: 6972-6977
[Abstract]
[Full Text]
-
Kawabata, H., Norris, S. J., Watanabe, H.
(2004). BBE02 Disruption Mutants of Borrelia burgdorferi B31 Have a Highly Transformable, Infectious Phenotype. Infect. Immun.
72: 7147-7154
[Abstract]
[Full Text]
-
Babb, K., McAlister, J. D., Miller, J. C., Stevenson, B.
(2004). Molecular Characterization of Borrelia burgdorferi erp Promoter/Operator Elements. J. Bacteriol.
186: 2745-2756
[Abstract]
[Full Text]
-
Yang, X. F., Pal, U., Alani, S. M., Fikrig, E., Norgard, M. V.
(2004). Essential Role for OspA/B in the Life Cycle of the Lyme Disease Spirochete. JEM
199: 641-648
[Abstract]
[Full Text]