Previous Article | Next Article ![]()
Journal of Bacteriology, December 2003, p. 7092-7102, Vol. 185, No. 24
0021-9193/03/$08.00+0 DOI: 10.1128/JB.185.24.7092-7102.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Frank Thieme, Jana Gäbler,
Daniela Büttner, and Ulla Bonas*
Institute of Genetics, Martin-Luther-University Halle-Wittenberg, D-06099 Halle (Saale), Germany
Received 23 July 2003/ Accepted 18 September 2003
|
|
|---|
|
|
|---|
B
(41). While the repertoire of effector proteins appears to be relatively limited in animal pathogens (e.g., six known effectors in Yersinia spp. [29]), an unexpectedly high number of effectors is found in plant pathogens (e.g., approximately 40 candidates each in Ralstonia solanacearum and Pseudomonas syringae [14, 47]). Due to the low in vitro secretion efficiency, the identification of effector proteins by biochemical approaches has been difficult. Furthermore, genetic strategies have not uncovered a significant number of effectors, probably due to redundant functions or a minor contribution to pathogenicity under laboratory conditions. In plant pathogens, many effectors have been identified as the products of avirulence (avr) genes that betray the pathogen to the surveillance system of resistant plants. Recognition of Avr proteins by corresponding plant resistance (R) gene products leads to the specific induction of defense responses that often culminate in the hypersensitive response (HR), a rapid local cell death at the infection site concomitant with arrest of bacterial growth (30, 49).
Recently, the availability of genomic sequence information for several plant pathogens (Xanthomonas campestris pv. campestris strain ATCC 33913, X. axonopodis pv. citri strain 306, R. solanacearum strain GMI1000, and P. syringae pv. tomato strain DC3000) has marked a milestone for the identification of putative effectors by bioinformatic approaches (14, 17, 47). Effector gene candidates have been discovered due to homologies to known effectors or the presence of eukaryotic motifs that suggest a function inside the host cell. Furthermore, many effector genes differ in G+C content and codon usage from the average genomic DNA and are associated with mobile genetic elements, indicating their acquisition by horizontal gene transfer. These genomic regions, which presumably contribute to the evolution of virulence, are generally referred to as pathogenicity islands (PAIs) (27).
Our laboratory studies the TTS system and the type III secretome of X. campestris pv. vesicatoria, the causal agent of bacterial spot disease in pepper and tomato (8). The X. campestris pv. vesicatoria TTS system is encoded by a 23-kb chromosomal hrp (hypersensitive response and pathogenicity) gene cluster which contains six operons, hrpA to hrpF (5, 21, 22, 28, 45; U. Bonas, unpublished data). Among the more than 20 proteins encoded by the hrp gene cluster, nine are highly conserved in plant and animal pathogenic bacteria. These genes were renamed hrc (hrp conserved) and probably encode the core components of the secretion apparatus (3). The role of nonconserved Hrp proteins is less clear. HrpE1 is predicted to be the major subunit of the Hrp pilus, an extracellular appendage that is associated with the TTS apparatus and probably serves as a conduit for secreted proteins moving to the plant cell surface (32; E. Weber, T. Ojanen-Reuhs, R. Koebnik, and U. Bonas, unpublished data). Protein translocation into the plant cell cytosol is presumably mediated by the type III translocon, a predicted channel-like protein complex that inserts into the host cell membrane (9). Recently, HrpF has been proposed to be the pore-forming component of the type III translocon (10). Besides hrc and hrp genes, analysis of nonpolar mutants in the hrp gene cluster also identified hpa (hrp associated) genes that might contribute to, but are not essential for, the interaction with the plant (28, 40; U. Bonas, unpublished data). Sequence analysis of the left hrp-flanking region revealed the presence of an insertion sequence (IS)-like element as well as putative effector genes with low G+C content compared to the genomic average (64% over 100 kb [39]), indicating acquisition of this region by horizontal gene transfer (40).
hrp gene expression is induced in planta (48) and is controlled by the regulatory genes hrpG and hrpX, which are located outside of the hrp gene cluster. The HrpG protein belongs to the OmpR family of two-component regulatory systems (54) and controls the expression of a large gene regulon including hrpX. The AraC-type transcriptional activator HrpX regulates the expression of the operons hrpB to hrpF (52) and of most members of the hrpG regulon (39, 40). Many hrpX-regulated genes contain a PIP box (plant-inducible promoter box; consensus TTCG-N16-TTCG) in their promoters, which has been proposed to serve as a regulatory element. However, this motif is neither necessary nor sufficient to confer HrpX inducibility (8).
Many hrpG-regulated genes have been identified by cDNA-amplified fragment length polymorphism (AFLP)-based analysis of the expression profiles of two isogenic X. campestris pv. vesicatoria strains, 85-10 and 85*, which differ in their hrp gene expression status (39). Strain 85* carries hrpG*, a mutated form of the key regulatory gene hrpG that leads to the constitutive expression of hrp and other genes (39, 53). Members of the genome-wide hrpG regulon encode proteins with homology to transcriptional regulators, degradative enzymes, an adhesin, and type III effectors from other plant pathogens (39). So far, the products of three new hrpG-regulated genes have been shown to be secreted by the TTS system and have therefore been designated Xanthomonas outer protein (Xop) A, XopB, and XopD (39, 40).
In this study, we performed a detailed analysis of two hrpG-regulated genes, xopC and xopJ, which were previously identified by cDNA-AFLP (39). We confirm that the expression of both genes is regulated by HrpG and HrpX. Furthermore, we demonstrate that XopC and XopJ are two new effector proteins that are secreted and translocated by the TTS system into the plant cell. XopJ is homologous to members of the AvrRxv/YopJ family of type III effectors. In contrast, XopC appears to be unique to X. campestris pv. vesicatoria. DNA sequence analysis of the xopC region revealed that this locus is a PAI which is homologous to DNA regions in X. axonopodis pv. citri.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Published
strains and plasmids used in this study
|
Sequencing of the xopC region. For sequencing of the xopC region, cosmid clones hybridizing to hgi 37/41 were isolated from a genomic cosmid library of X. campestris pv. vesicatoria strain 75-3 in pLAFR3 (pXV238, pXV789, and pXV845 [35]). EcoRI/HindIII fragments derived from pXV845, pXV238, and pXV789 and containing hgi 37 and hgi 41 were subcloned into pBluescript II KS (pB-KS), giving pB37A (8-kb insert), pB37B (7-kb insert), and pB37C (4-kb insert), respectively. The sequence of the xopC region was determined by shotgun cloning of pB37A, pB37B, and pB37C and sequencing of the subclones by using an ABI 377 Prism DNA sequencer (Applied Biosystems Inc., Foster City, Calif.). The initial contig was extended in both directions by primer walking, using pXV238 as the template. Sequences were analyzed with Sequencher software (Gene Codes Corp., Ann Arbor, Mich.) and the DNASTAR package (DNASTAR Inc., Madison, Wis.). The inverted repeats (IRs) in the xopC region were searched using Megalign, Genequest (DNASTAR Inc.), and Blast algorithms (http://www.ncbi.nlm.nih.gov/blast/).
Generation
of mutations in xopC and xopJ.
A 1.0-kb deletion encompassing the
promoter region and 540 bp of the xopC open reading frame
(ORF) was achieved by Eco72I digestion and religation of
pB37B, giving pB37B
xopC. The pB37B
xopC 3.1-kb
NheI/XbaI fragment was cloned into the suicide
plasmid pOK (28), giving
pO37, and introduced into strain 85-10 by double crossover, creating
85-10
xopC.
To mutate xopJ, a 1.4-kb SalI/BglII fragment containing xopJ was amplified from X. campestris pv. vesicatoria strain 85-10 genomic DNA by PCR using the primers 11.Bgl (GAAGATCTTGACTGGCGATCAGAGATAGC) and 11.Sal (ACGCGTCGACTCCAAGACTTCGCACCGAAG) (underlined sequences indicate engineered restriction sites) and cloned into pCR2.1 (Invitrogen, Carlsbad, Calif.), giving pC11. A frameshift mutation was introduced at codon 128 by Bsp1407I digestion of pC11, fill-in, and religation, resulting in pCxopJFS. This mutation results in a premature stop codon after 143 codons. The pCxopJFS 1.4-kb SalI/BglII fragment was then cloned into pOK, giving pO11, and introduced into strain 85-10 by double crossover, giving 85-10xopJFS.
Epitope tagging of
XopC and XopJ.
The 1.4-kb
SalI/BglII fragment of pIC11 encompassing
xopJ and a 1.6-kb XhoI/BglII fragment
encompassing the first 466 codons of xopC amplified by PCR
from X. campestris pv. vesicatoria strain 85-10 genomic DNA
using the primers 37.Bgl
(GAAGATCTCCTTCGAGAACTTTCGCAATC) and
37.Xho (CCGCTCGAGCTCTTAAGTGTGCGTCTACTG)
(underlined sequences indicate engineered restriction sites)
were cloned into pIC1
(39) in frame with a
triple c-myc epitope, giving pIC11 and pIC37, respectively.
pIC37 and pIC11 were conjugated into strain 85*, giving
85*::pIC37 and 85*::pIC11,
respectively. The corresponding 85-10 derivatives were generated by
restoring the wild-type hrpG allele using pOG
(39). hrpX was
deleted from strains 85*::pIC37 and
85*::pIC11 by using pRX1, thus giving
85*
hrpX::pIC37 and
85*
hrpX::pIC11,
respectively.
Construction of
AvrBs3
2 fusion proteins.
To create fusions with
avrBs3
2, the GATEWAY (Invitrogen)
attR reading frame cassette B fused in frame with
avrBs3
2 was introduced into pLAFR6, giving
pL6GW356. The following promoters and 5' sequences of
xop genes were amplified from genomic DNA of X.
campestris pv. vesicatoria strain 75-3 by primers containing
attB sites: the first 200 codons of xopC
and 592-bp upstream sequence, the first 121 codons of hpaJ and
1,506-bp upstream sequence, and the first 155 codons of xopJ
and 720-bp upstream region. Genomic DNA of strain 82-8 was used to
amplify the first 200 codons of avrBs3 and 315-bp upstream
sequence. Primer sequences are available from the authors upon request.
The attB-flanked PCR products were recombined into
a donor vector and then transferred to pL6GW356 by recombination to
create the expression clones pL6xopC356, pL6hpaJ356, pL6xopJ356, and
pL6avrBs3356.
RNA analyses. RNA extraction, cDNA synthesis, and reverse transcription (RT)-PCRs were performed as described previously (39). Primer sequences are available from the authors upon request. General molecular biology experiments were performed according to standard protocols (1).
GUS assays. ß-Glucuronidase (GUS) assays were performed with exponentially growing X. campestris pv. vesicatoria as described previously (46). One GUS unit is defined as 1 nmol of 4-methylumbelliferone released per minute per bacterium.
Protein analysis and secretion experiments. Secretion experiments and Western blot analyses were performed as described previously (46). The following primary antibodies were used: polyclonal anti-AvrBs3 antibody (31), monoclonal anti-c-myc antibody (Roche, Mannheim, Germany), and polyclonal anti-HrcN antiserum (46). Horseradish peroxidase-labeled goat anti-mouse or goat anti-rabbit antibodies were used as secondary antibodies. Reactions were visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech, Piscataway, N.J.).
Nucleotide sequence accession number. The sequence of the 12.5-kb xopC region from X. campestris pv. vesicatoria strain 75-3 has been submitted to GenBank and assigned accession number AY389509.
|
|
|---|
|
View this table: [in a new window] |
TABLE 2. Characteristics
of predicted genes in the xopC region from X.
campestris pv. vesicatoria
|
To confirm
hrpG-dependent regulation of xopC, we performed
RT-PCRs. After bacterial growth in NYG medium, the xopC
transcript was detectable in strain 85* but not, or in small amounts,
in strain 85-10 and the hrpX deletion mutant
85*
hrpX (Fig.
1A). This indicates that expression of xopC is controlled by both
HrpG and HrpX, as has previously been shown for xopJ
(39). For a quantitative
analysis of the induction levels of both genes, we created
transcriptional fusions to a promoterless GUS gene and introduced the
corresponding constructs into the genomes of strains 85-10, 85*, and
85*
hrpX (see Materials and Methods). The analysis of
GUS activities after bacterial growth in NYG medium showed that
xopC and xopJ expression in 85* was 10 and 42 times
higher, respectively, than in the hrpG wild-type background
(Fig. 1B). Deletion of the
hrpX gene (strains
85*
hrpX::pIC37 and
85*
hrpX::pIC11) reduced GUS
activities to the levels observed in 85-10 (Fig.
1B), confirming that gene
expression is controlled by both hrpG and
hrpX.
![]() View larger version (25K): [in a new window] |
FIG. 1. Expression
of xopC, xopJ, and hpaJ (ORFA) is regulated
by hrpG and hrpX. (A) cDNA-AFLP (AFLP) and
RT-PCR (RT) analyses of hgi 37/41 (corresponds to
xopC) and hpaJ (ORFA) in X. campestris pv.
vesicatoria strains 85-10, 85*, and 85* hrpX, all
grown in NYG medium. cDNA-AFLP amplicons were visualized by
autoradiography. RT-PCR samples were separated on a 1.5% agarose
gel and stained with ethidium bromide. 16S ribosomal DNA was used as a
standard (rDNA). (B) Analysis of promoter activities of
xopC and xopJ using the uidA reporter gene.
Strains 85-10, 85*, and 85* hrpX containing pIC37 and
pIC11, respectively, were grown in NYG medium. Specific GUS activities
are the average of two cultures with duplicates. Values are displayed
using a logarithmic scale, and error bars represent the standard
deviations. GUS activities below 0.1 U/1010 CFU are
considered as background. One unit is defined as 1 nmol of
4-methylumbelliferone released per minute per
bacterium.
|
hrcV
by using the suicide vector pIC1. As shown in Fig.
2, proteins of 56 and 45 kDa, compatible with the predicted sizes of the
XopC protein fused to c-myc (51 kDa plus 5-kDa epitope; first
466 amino acids [aa] only) and XopJ-c-myc
(40 kDa plus 5-kDa epitope), respectively, were detected in total cell
extracts. The homology of XopJ to type III effectors as well as the
finding that several hgi genes encode type III-secreted
proteins (39,
40) prompted us to
investigate the secretion of XopJ and XopC. Therefore, the
corresponding 85* and 85*
hrcV derivatives were
incubated in secretion medium and total cell extracts and culture
supernatants were analyzed by immunoblotting. Both proteins could be
detected in the culture supernatants of the corresponding 85* strain
derivative but not in culture supernatants of 85*
hrcV
strains (Fig. 2),
indicating that secretion depends on a functional TTS system. HrcN, an
intracellular protein, was not detectable in the culture supernatants,
suggesting that no bacterial lysis had occurred. These data indicate
that xopJ and xopC encode type III-secreted
proteins.
![]() View larger version (28K): [in a new window] |
FIG. 2. XopC
and XopJ are secreted by the TTS system. Strains 85* and
85* hrcV containing pIC37 (A) and pIC11 (B),
respectively, were incubated in secretion medium. Total protein
extracts (10x concentrated) and supernatants (200x
concentrated) were separated by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (10% polyacrylamide) and analyzed by
immunoblotting using the c-myc antibody. Membranes were
reprobed with a specific antibody against the cytoplasmic protein HrcN
to ensure that no bacterial lysis had occurred. Molecular mass of
proteins is given in
kilodaltons.
|
2, which lacks aa 2 to 153, is no
longer delivered by the TTS system. However, it is still capable of
inducing the HR when expressed in resistant plant cells by using
Agrobacterium-mediated gene transfer and hence contains the
effector domain (50). The
fusion of a functional TTS and translocation signal to AvrBs3
2
should therefore restore its delivery by the TTS system and thus the
ability to induce the HR in resistant plants.
Here, the N termini
of XopJ and XopC were fused to AvrBs3
2 (Fig.
3A). In addition, as a positive control, the first 200 aa of AvrBs3 were
fused to AvrBs3
2 (AvrBs3200-AvrBs3
2). As a
negative control, we used the HrpF387-AvrBs3
2
fusion protein, which was previously shown to be secreted by the TTS
system but does not induce the HR when delivered by X.
campestris pv. vesicatoria into Bs3-expressing pepper
plants. Since the fusion protein still induces the HR when directly
expressed in resistant plants by use of Agrobacterium-mediated
gene transfer, it has been suggested that the N terminus of HrpF lacks
a functional translocation signal
(10). The
AvrBs3
2 fusion constructs were introduced into X.
campestris pv. vesicatoria strains 85*, 85*
hrcV,
and 85*
hrpF. Western blot analysis of total protein
extracts demonstrated that the XopJ155-,
XopC200-, and AvrBs3200-AvrBs3
2 fusion
proteins were expressed (Fig.
3B). After incubation of
the bacteria in secretion medium, XopJ155-AvrBs3
2
and XopC200-AvrBs3
2 were detected in the culture
supernatants of the 85* and 85*
hrpF strain
derivatives, but not in those of the corresponding
85*
hrcV strain derivatives (Fig.
3B). These results show
that the TTS signals of XopJ and XopC are located in the N-terminal
regions.
![]() View larger version (35K): [in a new window] |
FIG. 3. XopC
and XopJ N termini target AvrBs3 2 into the plant cell.
(A) Schematic representation of AvrBs3 2 fusion
proteins. The N termini of AvrBs3, HrpF, XopC, HpaJ, and XopJ were
fused to AvrBs3 2 and tested for secretion in vitro and the
induction of the HR in Bs3-expressing pepper plants. The
central repeat region of AvrBs3 is indicated by the striped box. White
boxes correspond to the N-terminal part of the tested fusion partner.
Numbers refer to amino acid positions at the fusion points. A plus sign
indicates the ability of fusion protein to be secreted and/or to induce
the HR on ECW-30R plants when delivered by X. campestris pv.
vesicatoria strain 85*. A minus sign indicates no secretion of fusion
proteins and/or no HR induction. (B) Western blot analysis of
AvrBs3 2 fusions expressed in strain 85*, the secretion mutant
85* hrcV, and 85* hrpF under control
of the native promoters. After incubation of the bacteria in secretion
medium, total protein extracts (10x concentrated) and
supernatants (200x concentrated) were separated by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (8%
polyacrylamide) and analyzed by immunoblotting using the
AvrBs3-specific antibody. Membranes were reprobed with a specific
antibody against the cytoplasmic protein HrcN to ensure that no
bacterial lysis had occurred (data not shown). (C) HR
induction in the resistant pepper plant ECW-30R. X. campestris
pv. vesicatoria strains were inoculated at 5 x 108
CFU/ml. Two days after inoculation, the leaves were bleached in
ethanol.
|
2,
XopJ155-AvrBs3
2, and
XopC200-AvrBs3
2 induced the HR in the
Bs3-expressing pepper cultivar ECW-30R but not in susceptible
ECW plants (data not shown). This indicates that the reporter protein
was translocated into the plant cell and was specifically recognized by
Bs3. No HR induction was observed in leaves of ECW and ECW-30R plants
infected with strain 85* delivering HrpF387-AvrBs3
2
(data not shown). Furthermore, the secretion mutant
85*
hrcV and the translocation mutant
85*
hrpF expressing the chimeric proteins did not
elicit the HR in ECW-30R plants (Fig.
3C), indicating that
translocation of the reporter protein into the plant cell depends on a
functional TTS system. These experiments demonstrate that the N termini
of XopC and XopJ contain signals for type III-dependent secretion and
translocation and validate the AvrBs3
2 protein as a suitable
reporter for the analysis of type III effector protein
translocation. Contribution of XopJ and XopC to bacterial virulence. The type III-dependent translocation of XopJ and XopC into the plant cell suggests that both proteins play a role in the plant-pathogen interaction. To study their contribution to bacterial virulence, a frameshift mutation in xopJ and a deletion in xopC, respectively, were introduced into the genome of X. campestris pv. vesicatoria strain 85-10. The resulting mutants were tested for symptom formation and in planta growth in susceptible pepper plants (ECW) as well as for HR elicitation in resistant pepper plants (ECW-10R). Strain 85-10 expresses avrBs1, which is recognized by the Bs1 resistance gene in ECW-10R (35). The mutations in xopJ and xopC had no visible effect on the phenotype and timing of the appearance of disease symptoms in susceptible plants and the HR induction in resistant plants compared to what was seen with the wild-type strain 85-10 (data not shown). Furthermore, the growth of both mutant strains in susceptible pepper plants ECW was not significantly altered (Fig. 4). Thus, we could not observe any obvious contribution of XopJ and XopC to X. campestris pv. vesicatoria virulence under the conditions tested.
![]() View larger version (25K): [in a new window] |
FIG. 4. Analysis
of xopJ and xopC mutants for growth in planta. X.
campestris pv. vesicatoria wild-type and mutant strains were
inoculated at 104 CFU/ml in 1 mM MgCl2 into the
intercellular spaces of fully expanded leaves of susceptible ECW
plants. Growth of strains 85-10, 85-10 hrpA-C,
85-10 xopC, and 85-10xopJFS was monitored
over a period of 8 days. Values represent the mean of three samples
from three different plants, and error bars indicate the standard
deviations. For the sake of clarity, error bars for strains
85-10 xopC and 85-10xopJFS were omitted.
Results shown are from one representative
experiment.
|
![]() View larger version (23K): [in a new window] |
FIG. 5. Comparison
between the xopC region from X. campestris pv.
vesicatoria strain 75-3 and corresponding regions from X.
axonopodis pv. citri strain 306. (A) Schematic overview
of the X. campestris pv. vesicatoria xopC region. The
locations of hgi 37 and hgi 41 (xopC) are
indicated by grey circles. The insertion site of the c-myc
coding sequence in pIC37 is indicated by a thin arrow. White
single-headed arrows represent ORFs with high coding probability
(DNAStar package) and the direction of transcription (Table
2). Black arrows indicate
putative effector genes. The double-headed arrow represents an IS
element. Open triangles indicate 62-bp IRs. The G+C content of
the region was calculated over 100-bp windows (59% on average)
and displayed using Genequest (DNAStar). Scale is given in kilobases.
(B) Schematic overview of the regions from X.
axonopodis pv. citri strain 306 (Xac) corresponding to
the hpaJ to ORFD sequences. The sequences are derived from
plasmid pXAC64 (GenBank accession no
AE008925;
3,594 to 18,000 bp) and the chromosomal section 346 (chrom.; GenBank
accession no.
AE011968;
1 to 10,000 bp). Open circles denote PIP boxes. The grey area
represents colinear DNA regions (more than 85% identity on the
DNA
level).
|
hrpX after
growth in NYG medium. ORFB, ORFC, and ORFD transcripts were amplified
at comparable levels in the three different strains, indicating that
gene expression was constitutive (data not shown). By contrast, no
transcript could be amplified for ORFE under the RT-PCR conditions used
(data not shown). The ORFA (hpaJ) transcript was detected only
in strain 85*, demonstrating that expression of the corresponding gene
is regulated by HrpG and HrpX (Fig.
1A). ORFA was therefore
designated hpaJ.
The homology of HpaJ to the type III
effector candidate HopPmaG from P. syringae pv. maculicola
(Table 2) prompted us to
investigate TTS and translocation of HpaJ. Therefore, the N terminus of
HpaJ was fused to AvrBs3
2 (Fig.
3A) and the corresponding
fusion protein was expressed in strains 85*, 85*
hrcV,
and 85*
hrpF. HpaJ121-AvrBs3
2 was
expressed in all strains but could not be detected in the culture
supernatant of strain 85* (Fig.
3B). Since HrpF, a
substrate of the TTS system, was detected in the supernatant (data not
shown), we conclude that lack of detection of
HpaJ121-AvrBs3
2 in the culture supernatant was not
due to a general defect in TTS. When infiltrated into pepper plants
that express the Bs3 gene, strain 85* carrying
HpaJ121-AvrBs3
2 did not induce the AvrBs3-specific
HR (Fig. 3C). Taken
together, these results suggest that the N terminus of HpaJ does not
contain a functional TTS and translocation
signal.
The xopC region is flanked by IRs that are associated with putative effectors in different xanthomonads. Interestingly, the xopC region of X. campestris pv. vesicatoria is flanked by 62-bp IRs (Fig. 5) that were initially identified in the vicinity of effector genes belonging to the avrBs3 family in Xanthomonas spp. (IR-L and IR-R [4, 18]). In addition to the xopC region, we also found single copies of these IRs next to xopB and avrBsT (Table 3). Furthermore, homology searches revealed the presence of 13 copies (eight flanking avrBs3 homologues and five in the region corresponding to the xopC locus from X. campestris pv. vesicatoria) in the genome of X. axonopodis pv. citri strain 306 (Fig. 5) (Table 3). In the genome of X. campestris pv. campestris strain ATCC 33913, we identified five IRs, four of which are present as single copies next to genes encoding putative type III-secreted proteins: AvrXccE1 (homologous to AvrPphE from P. syringae pv. phaseolicola), AvrBs1, AvrXccB (homologous to effectors of the YopJ/AvrRxv family), and AvrXccC (homologous to AvrC from P. syringae pv. glycinea). Using sequence alignments and informative polymorphic sites analysis, one can distinguish between IR-L- and IR-R-like repeats (Table 3). While most of the avrBs3 homologues are flanked by both IR-L (5') and IR-R (3') sequences, the majority of other putative type III effector genes is flanked by a single IR-L repeat in the 3' region of the coding sequence. Blast searches did not reveal homologous IRs in other plant pathogens, suggesting that these sequences are restricted to xanthomonads.
|
View this table: [in a new window] |
TABLE 3. Specific
IRs associated with genes coding for Xops
|
|
|
|---|
The signals that target XopJ and XopC for type III-dependent secretion and translocation reside in the N-terminal protein regions as has already been described for several effector proteins from plant and animal pathogenic bacteria (15). However, the nature of the secretion signal still remains enigmatic since type III-secreted proteins in both plant and animal pathogens do not share any N-terminal consensus sequence. Recently, comparative analyses of N-terminal amino acid compositions of P. syringae type III-secreted proteins revealed some similarities, such as a relatively high content of serine residues in the first 50 aa (26, 43). This is also true for the N-terminal regions of the Xanthomonas effectors XopC (16% serine) and XopJ (12% serine).
The functions of XopJ and XopC inside the plant cell remain to be investigated. Both genes appear to be restricted to X. campestris pv. vesicatoria strains, suggesting a specific role for xopJ and xopC in the interaction of X. campestris pv. vesicatoria with its respective host plants. Preliminary dipping experiments seem to confirm this for xopC (D. Büttner and U. Bonas, unpublished data). However, xopC and xopJ mutant strains were not affected in bacterial growth and symptom formation on susceptible plants after infiltration, indicating subtle contributions to bacterial virulence or functional redundancy. The latter might indeed be the case for XopJ, which belongs to the large YopJ/AvrRxv effector protein family (for a review, see reference 33), four members of which have been identified in X. campestris pv. vesicatoria (8). YopJ from Yersinia pestis presumably acts as a cysteine protease (42), and the putative catalytic residues are conserved in all homologues including XopJ. So far, a potential plant target of the predicted proteolytic activity has been identified only for PopP2 from R. solanacearum, which physically interacts with the corresponding resistance protein RRS1-R from Arabidopsis thaliana (19).
For XopC, we found no homology to proteins with known function in the database. Due to the low G+C content of xopC as well as the absence of homologous genes in other xanthomonads, xopC might have been acquired by horizontal gene transfer. Indeed, the xopC region contains typical features of PAIs, including sequences with low G+C content, an IS element, and genes encoding integrases and cointegrases. In addition to xopC, we identified hpaJ as a new hrpG-regulated gene in this region. Mutant studies will help to clarify whether HpaJ plays a role during the interaction with the plant, as is suggested by its coregulation with the TTS system. The presence of a Sec signal as well as the homology of HpaJ to transglycosylases suggests that it is secreted by the Sec system into the periplasm. Here, it might contribute to the remodeling of the peptidoglycan layer, a process that is presumably involved in the assembly of the TTS system (44). A similar scenario has been proposed for the flagellar assembly in Salmonella enterica, which requires periplasmic peptidoglycan-degrading enzymes (38). Furthermore, predicted peptidoglycan hydrolases in P. syringae and X. campestris pv. vesicatoria contribute to bacterial virulence (2, 40).
We did not observe secretion and translocation of HpaJ by the TTS system, which is consistent with its predicted function in the periplasm. However, the HpaJ homologue HopPmaG from P. syringae pv. maculicola, which also contains a Sec signal (predicted by the SignalP program [http://www.cbs.dtu.dk/services/SignalP/]), was recently shown to be translocated into the plant cell by use of the AvrRpt280-255 reporter (26). Since only 14 aa of HopPmaG were fused to the reporter, which is usually not sufficient to target a protein for type III-dependent translocation, it cannot be excluded that the delivery of the HopPmaG14-AvrRpt280-255 fusion into the plant was due to residual export signals in the AvrRpt280-255 reporter protein.
The region from hpaJ to ORFD in the xopC locus is more than 85% identical to sequences in the chromosome and the plasmid pXAC64 from X. axonopodis pv. citri (Fig. 5). It is intriguing that genes encoding effector protein candidates such as the AvrBs3 homologue PthA3 as well as AvrXacE2 and AvrXacE3, which are homologous to the effector protein AvrPphE from P. syringae pv. phaseolicola, are located next to these regions. Approximately 200 bp of the 5' sequence including promoter and coding regions of avrXacE3 and XAC3230 from X. axonopodis pv. citri are more than 85% identical to the corresponding region of xopJ, which is a member of the hrpG regulon from X. campestris pv. vesicatoria. It is therefore tempting to speculate that avrXacE3 and XAC3230 are also regulated by HrpG. Taken together, the low G+C content, the association with genetic mobile elements, the presence of putative effector and/or virulence genes, and the sequence diversity of this locus among different xanthomonads indicate that the xopC region in X. campestris pv. vesicatoria as well as the corresponding sequences in X. axonopodis pv. citri are PAIs.
Interestingly, the xopC region is flanked by IRs, which are also present in the corresponding regions of X. axonopodis pv. citri. Sequence analysis revealed that these IRs are often located in the vicinity of effector genes and thus might provide a useful search criterion for the identification of effector candidates by genomic approaches. In X. campestris pv. vesicatoria, the full set of type III effectors is not known yet. In this study, the products of two hrpG-induced genes were shown to be translocated into the plant cell, indicating that the hrpG regulon is a precious resource for the identification of type III effectors. More than 25 hgi genes still await characterization. In the future, sequence analyses will be greatly facilitated by the availability of the genomic sequence of X. campestris pv. vesicatoria strain 85-10 (in progress [http://www.genetik.uni-Bielefeld.de/GenoMik/partner/halle.html]) (11). This will provide the unique opportunity to identify specific virulence genes and host range determinants by comparative sequence analysis of different members of the genus Xanthomonas.
We thank C. Kretschmer and B. Rosinsky for excellent technical assistance.
This work was funded by a grant from the Deutsche Forschungsgemeinschaft (SFB 363) and the Bundesministerium für Bildung und Forschung to U.B.
Present
address: Max-Planck-Institute for Plant Breeding Research, D-50829
Cologne, Germany. ![]()
Present
address: Division of Cellular Immunology, German Cancer Research
Center, D-69120 Heidelberg, Germany. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»