Previous Article | Next Article ![]()
Journal of Bacteriology, December 2003, p. 7193-7201, Vol. 185, No. 24
0021-9193/03/$08.00+0 DOI: 10.1128/JB.185.24.7193-7201.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Department of Bacteriology, University of Wisconsin-Madison, Madison, Wisconsin
Received 5 June 2003/ Accepted 8 September 2003
|
|
|---|
|
|
|---|
![]() View larger version (42K): [in a new window] |
FIG. 1. Late
steps of cobamide biosynthesis in the bacterium S. enterica.
Intermediates are boxed and indicated below structures. Abbreviations:
AP-Pi, aminopropanol phosphate; AdoCbr,
adenosylcobyrinic acid a,c-diamide; AdoCbl,
adenosylcobalamin; CobS, cobalamin (5'-P)
synthase.
|
Analysis of the available archaeal genome sequences revealed the absence of an archaeal ortholog to the bacterial ATP:adenosylcobinamide (AdoCbi) kinase/GTP:adenosylcobinamide-phosphate (AdoCbi-P) guanylyltransferase (CobU in S. enterica). The transferase activity was shown to be required for de novo biosynthesis of cobamides and for the salvaging of unphosphorylated Cbi (19). The kinase activity, on the other hand, is only required for the salvaging of Cbi (8, 36) (Fig. 1). Recently, it was shown that the conserved archaeal cobY gene is the nonorthologous replacement of the S. enterica cobU gene. The CobY protein has the nucleoside triphosphate (NTP):AdoCbi-P nucleotidyltransferase activity required for de novo synthesis of cobamides but lacks the NTP:AdoCbi kinase activity necessary to salvage Cbi via the pathway used by bacteria (5, 36, 39).
The lack of an NTP:AdoCbi kinase ortholog in archaea raises three important questions. (i) Are archaea able to salvage Cbi? (ii) If they can, does an alternative, nonorthologous replacement of the bacterial NTP:AdoCbi kinase exist in these prokaryotes? (iii) If a nonorthologous replacement of the bacterial NTP:AdoCbi kinase does not exist in archaea, does an alternative, uncharacterized Cbi-salvaging pathway exist? Previous studies of Methanobacterium thermoautotrophicum strongly suggested that this archaeon can salvage Cbi (32). However, to the best of our knowledge, there are no reported studies of the pathway used by this or any other archaeon to salvage Cbi.
In this paper, we provide genetic evidence for the ability of the extremely halophilic archaeon Halobacterium sp. strain NRC-1 to efficiently salvage exogenous Cbi via an alternative pathway to the one used by bacteria. These studies demanded the functional characterization of two genes whose putative function had been annotated exclusively on the basis of their homology to the bacterial adenosylcobyric acid (AdoCby) and AdoCbi-P synthases (cbiP and cbiB, respectively) present in S. enterica (Fig. 1).
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Strains
and plasmids used in this study
|
Halobacterium studies. Strains were grown in liquid peptone (Oxoid, Hampshire, England) medium (18) lacking trace metals. Halobacterium cultures were grown to stationary phase at 37°C with shaking for 5 days. Cells used as inocula were harvested by centrifugation (10,000 x g for 2 min) with a Microfuge 18 centrifuge (Beckman-Coulter, Fullerton, Calif.) and washed once in a chemically defined medium (14). Cells were diluted 100-fold and used to inoculate the defined medium containing the appropriate corrinoid supplements. Cultures were grown at 37°C with shaking. Growth was monitored every 24 h by measuring the absorbance of the culture at 650 nm with a Spectronic 20D spectrophotometer (Milton Roy, Rochester, N.Y). In all cases, media were supplemented with uracil (450 µM).
S. enterica studies. Plasmids were introduced into S. enterica by passing them first through a restriction-deficient strain (37).
Anaerobic growth studies. Four independent colonies of each strain were patched onto Luria-Bertani-ampicillin (100 µg/ml) agar (6.6%), grown for 5 h at 37°C, and replica printed onto defined, no-carbon E medium (3) supplemented with glucose (11 mM), MgSO4 (1 mM), 1,2-propanediol (10 mM), CoCl (5 µM), ampicillin (25 µg/ml), and trace minerals (1). (CN)2Cby was added as indicated. Plates were incubated anaerobically in an ANA-PAK system (Scott Laboratories, Inc., Fiskeville, R.I.), with a BBL GasPak anaerobic system (Becton Dickinson, Cockeysville, Md). The growth of the strains after 24 h indicated de novo cobamide biosynthesis.
Aerobic growth studies. S. enterica strains were grown to full density in nutrient broth (Difco) supplemented with ampicillin (100 µg/ml). Cells were diluted 100-fold and used to inoculate the defined no-carbon E medium supplemented with glucose (11 mM), MgSO4 (1 mM), 1,2-propanediol (10 mM), ampicillin (25 µg/ml), and trace minerals (1). Corrinoid supplements were added as indicated. Cultures were monitored while grown at 37°C with continuous shaking (19 Hz) in an EL808 Ultra Microplate Reader (Bio-Tek Instruments, Inc., Winooski, Vt).
Plasmid constructions.
Plasmids were propagated in the
Escherichia coli strain DH5
except where noted. In
all cases, Halobacterium sp. strain NRC-1 genomic DNA for PCR
was prepared as previously described
(39). Methanosarcina
mazei strain Goe1 DNA for PCR was a gift from Gerhard Gottschalk
(Göttingen, Germany). All primers were purchased from Integrated
DNA Technologies, Inc. (Coralville, Iowa). Underlined portions of the
primer sequences (see below) indicate introduced restriction
sites.
Halobacterium plasmids. A diagram of the Halobacterium sp. strain NRC-1 DNA included in the most relevant plasmids is included in Fig. 2B.
![]() View larger version (22K): [in a new window] |
FIG. 2. Putative
operons in Halobacterium sp. strain NRC-1 containing
cbiP (Vng1576G) and cbiB (Vng1578H) and plasmid
constructions. (A) The reported ORF designation is shown
above each rectangle with our annotation below it. The reported length
(base pairs) of each ORF is indicated within each box. (B)
Brackets connected by solid lines indicate the regions of DNA that were
included in plasmids pCBIP2, pCBIP7, pVNG1578-2, and pVNG1578-3. Dashed
lines indicate regions that were not included in the plasmids. The
DNA restriction enzyme sites used for cloning purposes are
labeled below the
brackets.
|
HindIII5'#2
(GTTCGGGAAAAGCTTCGCACGCAG) and the
3' reverse primer cbiP
EcoRV3'
(CTGGAGTGGGATATCGGTGAGCAAC) were used
to amplify an 804-bp PCR fragment from strain MPK414 genomic DNA.
Amplified DNA was cut with HindIII/EcoRV restriction
enzymes (unless otherwise noted, the underlined portion of the sequence
is the restriction enzyme site), purified with a QIAquick gel
extraction kit (QIAGEN; Valencia, Calif.), and cloned into the
HindIII/SmaI restriction site of plasmid pMPK428,
which contains the wild-type allele of the Halobacterium sp.
ura3 gene and a mevinolin resistance determinant
(22). The resulting
plasmid is referred to as pCBIP1.
(ii)
Plasmid pCBIP2.
Plasmid
pCBIP2 (
cbiP ura3+) carries an
in-frame deletion of the Halobacterium sp. strain NRC-1
cbiP gene and was constructed as follows. The 5'
primer cbiP
XbaI5'
(GCACGTGGTCTAGATGATGAAAG) and reverse
3' primer cbiP
HindIII3'
(CACGACGAGTAAGCTTTCGGCGTC) were used to
amplify an 807-bp fragment from MPK414 genomic DNA. The fragment was
cut with XbaI/HindIII restriction enzymes, gel
purified, and cloned into the XbaI/HindIII
restriction site of plasmid pCBIP1 to create plasmid pCBIP2. The latter
contained an in-frame deletion of cbiP that replaced bases 303
to 1376 with a 6-bp HindIII restriction site, thus deleting
358 of the 512 amino acids. Plasmid pCBIP2 also carries the mevinolin
resistance determinant and a wild-type allele of the ura3
gene.
(iii) Plasmid pCBIP4. The 5' primer cbiPCompEcoRI5' (TCTAGAGAATTCGAGCCGACGTTCGTGACCGAG) and reverse primer cbiPCompBglII3' (AGATCTTAGATCTAAAAGCCGCGCCGGTTCAAACGACGTTGACACGGTAG) were used to amplify a 1,739-bp PCR product from strain MPK414 genomic DNA. The fragment was cloned into pGEM-T with the Promega pGEM-T cloning kit (Madison, Wis.) to yield the plasmid pCBIP4.
(iv) Plasmid pCBIP5. The fragment carried on plasmid pCBIP4 was excised as a 1,721-bp fragment with an EcoRI/BglII digest, gel purified, and cloned into the EcoRI/BglII restriction site of pT7-7 (33) to yield plasmid pCBIP5.
(v) Plasmid pCBIP6. The 5' primer cbiPCompXbaI5' (TCTAGATCTAGACCCAACTGTGGTTGCATACG) and reverse primer cbiPCompEcoRI3' (GAATTCGAATTCGCCGTACGTCAGCAGTTCG) were used to amplify a 286-bp PCR product from strain MPK414 genomic DNA. The fragment was cut with XbaI/EcoRI restriction enzymes, gel purified, and cloned into the XbaI/EcoRI restriction site of plasmid pCBIP5 to yield plasmid pCBIP6.
(vi) Plasmid pCBIP7. The 268-bp XbaI/EcoRI and 1,721-bp EcoRI/BglII fragments from plasmid pCBIP6 were excised as a single 1,989-bp fragment with XbaI/BglII restriction enzymes, gel purified, and cloned into the XbaI/BglII restriction site of plasmid pMPK424 (21), which was prepared from the dam mutant strain GM2163 (New England Biolabs, Manchester, Mass.) to yield plasmid pCBIP7 (ura3+ cbiP+). Plasmid pCBIP7 contained the 1,989-bp fragment flanked by a sequence that would allow recombination at the Halobacterium sp. strain NRC-1 ura3 locus. The resulting plasmid carried a wild-type copy of the cbiP gene, including 107 bases 5' of the putative start codon and 218 bases upstream of the putative operon. To include these sequences, parts of the Vng1572C and Vng1574G open reading frames (ORFs) were also cloned, but the segments carried an in-frame fusion that fused amino acid residue 15 (of 300) of Vng1572C to residue 191 (of 225) of Vng1574G with Glu and Phe encoded by the introduced EcoRI site (Fig. 2B). Including these sequences should preserve the regulation of cbiP in its own operon without including other genes. Flanking the 3' end was a 16-bp sequence derived from the bop transcription terminator sequence (9) to ensure termination of the cbiP mRNA transcript.
(vii) Plasmid pVNG1578-1. The 5' primer Vng1578NcoI5' (CCATGGCCATGGGTCGTCTACGCCGGAGGTGG) and 3' reverse primer Vng1578HindIII3' (AAGCTTAAGCTTACCTCGAACAGCGGCTTCTCG) were used to amplify an 855-bp PCR fragment from strain MPK414 genomic DNA. The fragment was cut with NcoI/HindIII restriction enzymes, gel purified, and cloned into the NcoI/HindIII restriction site of plasmid pMPK428, which contains the wild-type allele of Halobacterium sp. strain NRC-1 ura3 and a mevinolin resistance determinant (22). The resulting plasmid is referred to as pVng1578-1.
(viii) Plasmid
pVNG1578-2.
Plasmid
pVNG1578-2 (
cbiB ura3+) carried an
in-frame deletion of the Halobacterium sp. strain NRC-1
cbiB gene and was constructed as follows. The 5'
primer Vng1578XbaI5'
(TCTAGATCTAGACGCGCACGTCGACCTCGACC) and
reverse 3' primer Vng1578NcoI3'
(CCATGGCCATGGCGTCCACGGTCGGTCGACG) were
used to amplify an 841-bp fragment from MPK414 genomic DNA. The
fragment was cut with XbaI/NcoI restriction enzymes,
gel purified, and cloned into the XbaI/NcoI
restriction site of plasmid pVNG1578-1 to create plasmid pVNG1578-2.
The latter contained an in-frame deletion of cbiB that
replaced bases 133 to 897 with a 6-bp NcoI restriction site,
thus deleting 255 of the 308 amino acids. Plasmid pVNG1578-2 also
carries the mevinolin resistance determinant and a wild-type allele of
the ura3 gene.
(ix) Plasmid pVNG1578-3. The plasmid pVng1578-3 (cbiB+ ura3+) carries a wild-type allele of the Halobacterium sp. strain NRC-1 cbiB gene and was constructed as follows. The 5' primer cbiBCompXbaI5' (GAATCCTCTAGATGACCGACCGATTCAAGTCC) and the reverse primer cbiBCompBglII3' (GAATTCAGATCTAAAAGCCGCGCCGGTTGGTGATGAACGCCTCCCAG) were used to amplify a 1,398-bp PCR product from strain JE6693 (a derivative of MPK414) with an in-frame deletion on Vng1577, deleting bases 103 to 408 (J. C. Escalante-Semerena, laboratory collection) genomic DNA. The fragment was cut with Xba/BglII restriction enzymes, gel purified, and cloned into the Xba/BglII restriction site of plasmid pMPK424 (21) (prepared from the mutant strain GM2163 dam) (New England Biolabs, Manchester, Mass.) to yield plasmid pVNG1578-3 (ura3+ cbiB+). The latter contains the cloned fragment flanked by a sequence that would allow recombination at the ura3 locus of Halobacterium sp. strain NRC-1. The resulting plasmid carried a wild-type copy of the cbiB gene, including 47 bases upstream of the putative start codon and 200 bases upstream of the putative operon. To include these sequences, part of ORF Vng1577C was also cloned, but it carried an in-frame deletion spanning from residue 35 to residue 136 (of 152). Including theses sequences should preserve the regulation of cbiB in its own operon without including other genes. Flanking the 3' end was a 16-bp sequence derived from the bop transcription terminator sequence (9) to ensure transcriptional termination of the cbiB mRNA transcript.
S. enterica plasmid pCBIP9. The plasmid pCBIP9 contained a wild-type allele of S. enterica cbiP under the control of the lac promoter and ribosome-binding site and was constructed as follows. The fragment carried on plasmid pCBIP3 (Escalante-Semerena, laboratory collection) included only the S. enterica cbiP ORF and was excised as a 1,520-bp fragment with an NdeI/Xho1 digest, gel purified, and cloned into the NdeI/SalI restriction site of pT7-7 (33) to produce plasmid pCBIP9(cbiP+).
M. mazei plasmids. (i) Plasmid pMmCBIP1. Plasmid pMmCBIP1 (cbiP+) contained a wild-type allele of M. mazei strain Goe1 cbiP (ORF Mma0093) under the control of the lac promoter and ribosome-binding site and was constructed as follows. The 5' primer Mma0093-Blunt#1 (TGAATAATAAAAAGCCTGTTTGCGCAG) and the reverse primer Mma0093-Sal1-3' (CGCGTGGTCGACTCAGACTCCTGC) were used to amplify a 1,512-bp PCR product from M. mazei genomic DNA. The fragment was treated with polynucleotide kinase, cut with SalI, gel purified, and cloned into the NdeI/SalI site of pT7-7 (prepared by cutting plasmid pT7-7 with NdeI, blunt ending with the MBI Fermentas [Amherst, N.Y.] DNA polymerase I large [Klenow] fragment, and digesting with SalI to produce the plasmid pMmCBIP1 [cbiP+]).
(ii) Plasmid pMmCBIB1. Plasmid pMmCBIB1 (cbiB+) contained a wild-type allele of M. mazei strain Goe1 cbiB (ORF Mma2059) under the control of the lac promoter and ribosome-binding site and was constructed as follows. The 5' primer MmcbiB-5'NdeI #2 (5'-AGCCTATCATATGATCATACCGGACAGC-3') and the reverse primer MmcbiB-3' SalI (5'-ATTGATCTGGAGTAAGTCGACTTTTCAGGG-3') were used to amplify a 1,025-bp PCR product from M. mazei genomic DNA. The fragment was cut with NdeI/SalI restriction enzymes, gel purified, and cloned into the NdeI/SalI restriction site of plasmid pT7-7 to produce plasmid pMmCBIB1 (cbiB+).
Halobacterium
strain constructions. (i) Construction of a
cbiP
mutant strain.
An in-frame
deletion of cbiP in the chromosome of strain MPK414
(
ura3) was generated by using previously described
methodology (20).
Briefly, strain JE6738 (
ura3
cbiP) was
constructed by transforming strain MPK414 with plasmid pCBIP2 as
described previously
(15). Flanking sequences
of over 700 bases on each side of the deleted cbiP gene
ensured efficient recombination of the fragment into the chromosome.
Mevinolin-resistant transformants were selected as described previously
(15) and replated on
medium containing 5-FOA to select for the loss of the plasmid
(20). Colonies resistant
to 5-FOA were screened by PCR to identify the desired recombinant
(
cbiP). DNA sequencing was used to confirm the
in-frame deletion of the cbiP gene in the chromosome of strain
JE6738.
(ii) Construction of a
cbiB mutant strain.
An in-frame deletion of cbiB
in the chromosome of strain MPK414 was generated by using the same
strategy as mentioned above. Strain JE6791 (
ura3
cbiB) was constructed with strain MPK414 and plasmid
pVNG1578-2. DNA sequencing was used to confirm the in-frame deletion of
the cbiB gene in the chromosome of strain
JE6791.
(iii) Construction of a
cbiP complementation strain.
Complementation studies were
performed with a single copy of the wild-type allele of the gene in
question placed at the ura3 locus. For cbiP
complementation studies, a wild-type allele of cbiP was placed
at the chromosomal ura3 locus of strain JE6738. Plasmid pCBIP7
was transformed into strain JE6738, and strains carrying the
cbiP+ allele at the chromosomal
ura3 locus (strain JE7001 [
ura3
cbiP
ura3::cbiP+])
were isolated by using the same ura3-based gene replacement
method for the isolation of deleted genes. PCR and DNA sequencing
verified the presence of cbiP+ at the
ura3 locus.
(iv) Construction
of a cbiB complementation strain.
For cbiB complementation
studies a wild-type allele of cbiB was placed at the
chromosomal ura3 locus of strain JE6791. Plasmid pVNG1578-3
was transformed into strain JE6791, and a strain carrying the
cbiB+ allele at the chromosomal
ura3 locus (strain JE6930 [
ura3
cbiB
ura3::cbiB+])
was isolated. PCR and DNA sequencing verified the presence of
cbiB+ at the ura3
locus.
|
|
|---|
Identification of the cbiP and cbiB genes of Halobacterium. ORF Vng1576G (gene identification [gi] number 15790548) of the Halobacterium sp. strain NRC-1 genome sequence (17) was identified as the putative cbiP gene of this archaeon based on the 40% identity and 53% similarity of the predicted gene product to the CbiP protein of S. enterica. In the Halobacterium genome, the cbiP (ORF Vng1576G) gene is located at the 3' end of a putative operon containing ORF Vng1574G and ORF Vng1573G, which encode the putative orthologs of the bacterial ATP:co(I)rrinoid adenosyltransferase (CobA in S. enterica) and the cobyrinic acid a,c-diamide synthase (CbiA in S. enterica), respectively (Fig. 2A). These two proteins are believed to modify the corrinoid immediately preceding the CbiP-catalyzed step (38).
ORF Vng1578H (gi number 15790550) of the Halobacterium genome sequence was identified as the putative cbiB gene of this archaeon based on the 30% identity and 43% similarity of the predicted gene product to the CbiB of S. enterica. In the Halobacterium genome, the cbiB gene is the promoter-distal gene in a putative operon containing one other ORF of unknown function (Fig. 2A).
cbiP
(ORF Vng1576G) is a cobamide biosynthetic gene in
Halobacterium.
To
determine if strain JE6738 (
cbiP) was deficient in
cobamide biosynthesis, growth was assessed in defined medium where
cobamides were essential for growth. Unlike strain MPK414
(cbiP+), strain JE6738
(
cbiP) failed to grow in the defined medium lacking
corrinoids (Fig.
3A).
To determine if the observed lack of growth of JE6738 was caused by the
inability to synthesize cobamides de novo, the medium was supplemented
with Cby (the nonadenosylated product of the CbiP-catalyzed reaction).
The addition of Cby restored wild-type growth of JE6738 (Fig.
3A) but did not
significantly enhance the growth of the wild-type strain (data not
shown). The doubling times of strains MPK414 and JE6738 in medium
supplemented with Cby were very similar (30 and 27 h,
respectively), whereas doubling times could not be calculated for the
strains that displayed extremely poor growth. These data strongly
suggested that the absence of cbiP function correlated with
the predicted phenotype of a strain lacking AdoCby synthase activity
under conditions that demand de novo synthesis of cobamides. This
finding led to the proposal that ORF Vng1576G was the archaeal ortholog
of the CbiP.
![]() View larger version (38K): [in a new window] |
FIG. 3. Nutritional
studies of Halobacterium sp. strain NRC-1 strains.
Cobamide-dependent growth of Halobacterium sp. strain NRC-1
strains in the defined liquid medium at 37° is reported as
absorbance at 650 nm as a function of time. The strains are indicated
by their genotypes. The corrinoids added to the medium are indicated
next to the genotypes. The strains used were MPK414
cbiP+ cbiB+,
JE6738 cbiP, JE7001 cbiP
ura3::cbiP+,
JE6791 cbiB, and JE6930 cbiB
ura3::cbiB+.
Abbreviations: Cby, cobyric acid dicyanide; Cbi, cobinamide dicyanide;
Cbi-GDP; cobinamide-GDP dicyanide. In all cases, corrinoids were used
at concentrations of 100
pM.
|
cbiP) (Fig.
3A) but did not
significantly enhance the growth of the wild-type strain (data not
shown). The ability of Halobacterium to salvage Cbi suggested
the existence of an enzyme that can convert Cbi to a true intermediate
of the de novo pathway. A mutation in the CbiB enzyme would block the
pathway at a point that would allow us to ascertain whether the entry
point for Cbi salvaging in archaea occurred via AdoCbi-P (as in
bacteria) or via a new metabolic
route.
cbiB (ORF Vng1578H) is a
cobamide biosynthetic gene in Halobacterium.
Unlike strain MPK414, strain JE6791
(
cbiB) cannot grow in the defined medium lacking
corrinoids (Fig. 3B). To
test if the lack of growth was due to the inability to synthesize
cobamides, Cbi-GDP (a pathway intermediate downstream of the
CbiB-catalyzed reaction) (Fig.
1) was added to the
medium. Cbi-GDP restored the growth of strain JE6791 (30-h doubling
time) (Fig. 3B) but did
not significantly enhance growth of the wild-type strain MPK414 (data
not shown). The addition of Cby (a pathway intermediate prior to the
CbiB-catalyzed reaction), however, failed to restore growth of strain
JE6791 (Fig. 3B). These
results were consistent with a block in the synthesis of AdoCbi-P and
led us to propose that ORF Vng1578H in Halobacterium encodes
the archaeal ortholog of S. enterica CbiB
enzyme.
CbiB activity is required for Cbi
salvaging.
As mentioned
above, strain JE6738 (
cbiP) can salvage Cbi; however,
the addition of Cbi to the medium did not restore the growth of strain
JE6791 (
cbiB) (Fig.
3B). These results
confirmed that in Halobacterium Cbi must enter the de novo
pathway at an entry point prior to the CbiB-catalyzed step. This
finding is also consistent with the observation that Cbi and AdoCbi are
not intermediates of the archaeal de novo pathway. If they were, strain
JE6791 would be predicted to be able to salvage
Cbi.
Complementation of cbiP and
cbiB mutants of Halobacterium.
The observed AdoCby auxotrophy of
JE6738 (
cbiP) and the AdoCbi-GDP auxotrophy of JE6791
(
cbiB) were corrected when the
cbiP+ and cbiB+
alleles were reintroduced into the appropriate strains. Strain JE7001
(
cbiP
ura3::cbiP+) and strain
JE6930 (cbiB+
ura3::cbiB+) grew in
the defined medium without any corrinoid supplementation (Fig.
3) with a doubling time of
26 and 34 h, respectively. The growth rate of these strains
was similar to the rates of strains JE6738 (
cbiP) and
JE6791 (
cbiB) growing on medium supplemented with the
correct corrinoid supplements. These results showed that the
cbiP+ or cbiB+
functions were necessary and sufficient to restore de novo cobamide
synthesis in the mutant strains.
The archaeal cbiP and cbiB genes complement S. enterica cbiP and cbiB mutants. To further support the conclusion that the archaeal orthologs of cbiP and cbiB do function as AdoCby and AdoCbi-P synthases in vivo, we tested the ability of archaeal cbiP and cbiB orthologs to complement S. enterica cbiP and cbiB mutants. To investigate this possibility, the cbiP and cbiB orthologs from the archaeal methanogen M. mazei strain Goe1 were cloned. Previous work in the laboratory has shown that Halobacterium genes do not express well in S. enterica, whereas genes from archaeal methanogens are well expressed (36). M. mazei ORF Mm0093 (gi number 21226195) showed 42% identity and 58% similarity to the Halobacterium cbiP gene, and ORF Mm2059 (gi number 21228161) showed 28% identity and 45% similarity to the cbiB gene of Halobacterium.
For this purpose, S. enterica strains carrying null alleles of metE and either cbiP or cbiB were used. The mutation in metE inactivates the cobamide-independent methionine synthase (MetE) enzyme, thus demanding cobamide-dependent methylation of homocysteine to yield methionine by the action of the MetH enzyme (35). An insertion in either cbiP or cbiB eliminated de novo cobamide synthesis.
For cbiP complementation, the positive control plasmid pCBIP9 (containing a wild-type allele of S. enterica cbiP+) or plasmid pMmCBIP1 (M. mazei cbiP+) was introduced into the S. enterica cbiP metE mutant strain JE588.
For cbiB complementation, a plasmid containing a wild-type allele of either S. enterica cbiB (the positive control plasmid pSeCBIB4) or M. mazei cbiB (plasmid pMmCBIB1) was introduced into the S. enterica cbiB metE mutant strain JE6368. Residual expression of the cbiP or cbiB genes in the absence of the T7 RNA polymerase allowed us to assess complementation. In both cases, plasmid pT7-7 was used as a vector-only negative control.
To test cbiP complementation, S. enterica was grown anaerobically, where the cells can synthesize cobamides de novo. Complementation of cobamide biosynthesis was observed when either S. enterica or M. mazei cbiP was provided in trans to JE588 but not with the control vector (Fig. 4A). Growth was similar for all strains when (CN)2Cby was added (Fig. 4B). These results were consistent with the archaeal CbiP enzyme having AdoCby synthase activity in vivo.
![]() View larger version (58K): [in a new window] |
FIG. 4. Nutritional
studies of S. enterica cbiP mutants. Cobamide-dependent growth
of S. enterica strains grown anaerobically in defined solid
medium at 37°C without a corrinoid supplement (A) or
with 15 nM (CN)2Cby (B). The strains are indicated by their
genotypes. The strains used were TR6583 metE
cbiP+ and JE588 metE cbiP. The
plasmids used were pT7-7, vector-only control; pCBIP9, S. enterica
cbiP+; and pMmCBIP1, M. mazei
cbiP+.
|
![]() View larger version (32K): [in a new window] |
FIG. 5. Nutritional
studies of S. enterica cbiB mutants. Cobamide-dependent growth
of S. enterica strains grown aerobically in defined liquid
medium at 37°C is reported as absorbance at 650 nm as a
function of time. The strains are indicated by their genotypes. The
corrinoids added to the medium are indicated next to the genotypes. The
strains used were TR6583 metE cbiP+ and
JE6368 metE cbiB. The plasmids used were pT7-7, vector
control; pSeCBIB4, S. enterica cbiB+; and
pMmCBIB1, M. mazei cbiB+. Abbreviations:
Cby, cobyric acid dicyanide; Cbi, cobinamide dicyanide. In all cases,
corrinoids were used at concentrations of 15
nM.
|
|
|
|---|
Biochemical roles of two archaeal genes in cobamide biosynthesis. The results of the nutritional analysis of mutants of the extremely halophilic archaeon Halobacterium sp. strain NRC-1 showed that ORFs Vng1576G and Vng1578H were necessary for de novo cobamide biosynthesis and that ORF Vng1578H was necessary for salvaging cobyric acid from the environment. The conclusions drawn from these analyses were fully supported by complementation analyses of bona fide S. enterica mutants lacking either CbiP or CbiB activities by M. mazei strain Goe1 genes. On the basis of this work, we propose that Halobacterium ORF Vng1578H be annotated as encoding the AdoCbi-P synthase enzyme and that the putative annotation of Vng1576G as encoding the AdoCby synthase enzyme is correct. ORF Vng1578H should be renamed as cbiB to reflect its involvement in cobamide biosynthesis in archaea. This nomenclature should be extended to the ORFs Mm0093 (cbiP) and Mm2059 (cbiB) of M. mazei strain Goe1.
In this study, corrinoid intermediates have been assumed to be adenosylated in vivo. Although this fact has been established in bacteria (12), it is unknown if the corrinoids are adenosylated in archaea. Because archaea possess a putative ortholog of CobA and archaeal genes can complement S. enterica cob mutants, it is assumed that the corrinoid substrates for the archaeal enzymes are adenosylated.
The archaeal pathway for salvaging Cbi is different from the bacterial pathway. The requirement for CbiB enzyme activity for the salvaging of Cbi by Halobacterium is key to the proposal that the archaeal pathway for salvaging this precursor is different from the one that operates in bacteria (Fig. 1 and 6). In bacteria, CbiB is not required for Cbi salvaging because the NTP:AdoCbi kinase activity of CobU directly converts AdoCbi to AdoCbi-P, the product of the CbiB enzyme (Fig. 1). The kinase activity of CobU effectively bypasses the need for CbiB. The tight block in Cbi salvaging observed in Halobacterium cbiB mutants strongly suggests that the point of entry of Cbi salvaging in this archaeon is AdoCby, which can then be converted by the action of CbiB to AdoCbi-P, the substrate for the next enzyme of the archaeal pathway, i.e., CobY (Fig. 6). It is unlikely that the point of entry is prior to AdoCby, because Halobacterium cbiP mutants can readily salvage Cbi. We propose that, in archaea, AdoCbi is the substrate for an unidentified amidohydrolase enzyme that cleaves off the (R)-1-amino-2-propanol moiety of AdoCbi to yield AdoCby, the substrate of CbiB (Fig. 6). We favor this hypothesis on the basis of preliminary data obtained in our laboratory, which show that this AdoCbi amidohydrolase activity is present in cell extracts of E. coli overexpressing a single gene of M. mazei (J. D. Woodson and J. C. Escalante-Semerena, unpublished results). The requirement of an adenosylated substrate is speculative, and it is possible that the corrin ring is adenosylated after entering the de novo pathway. The identification of the gene encoding the amidohydrolase activity and the isolation and characterization of this new cobamide biosynthetic enzyme will be reported elsewhere.
![]() View larger version (21K): [in a new window] |
FIG. 6. A
new model for the late steps of cobamide biosynthesis in archaea.
Intermediates are boxed and indicated below structures. The
adenosylation of archaeal intermediates is putative. The putative
archaeal orthologs of the bacterial CobA and CobS
(16) proteins are
indicated. Abbreviations: AP-Pi,
aminopropanol phosphate; AP, aminopropanol; AdoCbr, adenosylcobyrinic
acid a,c-diamide; AdoCby, adenosylcobyric acid;
AdoCbi, adenosylcobinamide; CobS, cobalamin (5'-P) synthase;
CobY, NTP:AdoCbi-P
nucleotidyltransferase.
|
We thank P. Renz for his gift of (CN)2Cby and G. Gottschalk for his gift of M. mazei chromosomal DNA.
|
|
|---|
-(5-hydroxybenzimidazolyl)cobamide (factor
III) by vitamin B12 in Methanobacterium
thermoautotrophicum. J. Bacteriol.
169:3076-3081.
H. J. Bacteriol.
182:4227-4233.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»