Previous Article | Next Article 
Journal of Bacteriology, April 2003, p. 2066-2079, Vol. 185, No. 7
0021-9193/03/$08.00+0 DOI: 10.1128/JB.185.7.2066-2079.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Identification, Timing, and Signal Specificity of Pseudomonas aeruginosa Quorum-Controlled Genes: a Transcriptome Analysis
Martin Schuster,1 C. Phoebe Lostroh,1 Tomoo Ogi,2 and E. P. Greenberg1*
Department of Microbiology and W. M. Keck Microbial Communities and Cell Signaling Program, University of Iowa, Iowa City, Iowa 52242,1
Genome Damage and Stability Centre, University of Sussex, Falmer, Brighton BN1 9QG, United Kingdom2
Received 30 August 2002/
Accepted 5 December 2002

ABSTRACT
There are two interrelated acyl-homoserine lactone quorum-sensing-signaling
systems in
Pseudomonas aeruginosa. These systems, the LasR-LasI
system and the RhlR-RhlI system, are global regulators of gene
expression. We performed a transcriptome analysis to identify
quorum-sensing-controlled genes and to better understand quorum-sensing
control of
P. aeruginosa gene expression. We compared gene expression
in a LasI-RhlI signal mutant grown with added signals to gene
expression without added signals, and we compared a LasR-RhlR
signal receptor mutant to its parent. In all, we identified
315 quorum-induced and 38 quorum-repressed genes, representing
about 6% of the
P. aeruginosa genome. The quorum-repressed genes
were activated in the stationary phase in quorum-sensing mutants
but were not activated in the parent strain. The analysis of
quorum-induced genes suggests that the signal specificities
are on a continuum and that the timing of gene expression is
on a continuum (some genes are induced early in growth, most
genes are induced at the transition from the logarithmic phase
to the stationary phase, and some genes are induced during the
stationary phase). In general, timing was not related to signal
concentration. We suggest that the level of the signal receptor,
LasR, is a critical trigger for quorum-activated gene expression.
Acyl-homoserine lactone quorum sensing appears to be a system
that allows ordered expression of hundreds of genes during
P. aeruginosa growth in culture.

INTRODUCTION
Pseudomonas aeruginosa is an opportunistic pathogen of humans,
other animals, plants, and lower eukaryotes (
16). There are
two acyl-homoserine lactone (acyl-HSL) quorum-sensing systems
in
P. aerugionosa, LasI-LasR and RhlI-RhlR. LasI is responsible
for the synthesis of
N-3-oxododecanoyl-HSL (3OC12-HSL), and
LasR is a 3OC12-HSL-responsive transcription factor. RhlI is
responsible for the synthesis of
N-butanoyl-HSL (C4-HSL), and
RhlR is a C4-HSL-responsive transcription factor. Both of the
acyl-HSLs can diffuse through the cell envelope, so a critical
cell population density is required to produce signals at levels
sufficient for quorum-controlled gene regulation. Acyl-HSL signaling
is an important virulence factor in
P. aeruginosa (for recent
reviews see references
9,
19, and
31).
Previously, Whiteley et al. identified quorum-controlled genes in P. aeruginosa by screening a library of random Tn5-lacZ insertions in the genome of an acyl-HSL synthesis mutant for induction of ß-galactosidase by signal addition (33); 35 quorum-controlled genes were identified. Based on the number of mutants screened and the number of insertions in putative operons, it was estimated that there were over 200 additional quorum-controlled genes. The lacZ induction patterns were grouped into four categories depending on the timing of induction and the signal response specificity. Some genes responded to addition of acyl-HSL signals early in culture growth, and others showed a substantial delay, responding to signals only in the stationary phase. Some genes responded specifically to 3OC12-HSL, and others required both signals for the maximal response. The requirement for both signals to obtain a maximal response is thought to be related to the fact that both rhlR and rhlI are induced by LasR-LasI (14, 22). We have studied several quorum-controlled promoters. Some of the promoters show a high level of specificity for 3OC12-HSL and LasR, while others show specificity for C4-HSL and RhlR but also show a substantial response to 3OC12-HSL and LasR (32).
Other investigators have presented evidence showing that additional genes are controlled by quorum sensing in P. aeruginosa (2, 3, 5, 10-13, 15, 18, 21, 26, 27, 29, 35, 36). Furthermore, several reports have shown that a variety of regulatory proteins can influence the timing of quorum-controlled gene expression (1, 4, 6, 24, 26, 34), but mechanistic details for these proteins are scarce.
Here we describe a transcriptome analysis in which we utilized Affymetrix GeneChip genome arrays to test the hypothesis that there are over 200 quorum-controlled genes in P. aeruginosa, to identify as many members of this putative regulon as possible, and to gain insight into the timing and specificity of quorum-controlled gene expression.

MATERIALS AND METHODS
Bacterial strains and growth conditions.
The
P. aeruginosa strains used were PAO-MW1 (
rhlI::Tn
501 lasI::
tetA)
(
33) and PAO
lasR rhlR (
lasR::Tc
r
rhlR::Gm
r), as well as the
isogenic PAO1 parent strain (
25). Bacteria were grown in buffered
Luria-Bertani broth, which contained 10 g of typtone (Difco)
per liter, 5 g of yeast extract (Difco) per liter, 5 g of NaCl
per liter, and 50 mM 3-(
N-morpholino)propanesulfonic acid (pH
7.0). Synthetic acyl-HSLs (Aurora Biosciences) were added to
PAO-MW1 cultures at final concentrations of 2 µM for 3OC12-HSL
and 10 µM for C4-HSL, as indicated below. To inoculate
the cultures used for transcript profiling, cells grown to the
mid-logarithmic phase were added to 100 ml of prewarmed medium
in 500-ml culture flasks. The initial optical densities at 600
nm (OD
600) were 0.05 for PAO-MW1 and 0.01 for PAO1 and PAO
lasR rhlR. Cultures were incubated at 37°C in a rotating shaker
at 250 rpm. Growth was monitored by determining the OD
600.
Expression profiling experiments.
For studies with the signal generation mutant we isolated RNA from cultures at the following optical densities: 0.2, 0.4, 0.8, 1.4, 2.0, 3.0, and 4.0. For studies with the signal receptor mutant and its parent we isolated RNA from cultures at optical densities of 0.05, 0.1, 0.2, 0.4, 0.8, 1.4, 2.0, 3.0, and 4.0. Between 1 x 109 and 2 x 109 cells were mixed with RNA Protect Bacteria reagent (Qiagen) and treated as recommended by the manufacturer's mechanical disruption and lysis protocol. RNA was purified by using RNeasy mini columns (Qiagen), including the on-column DNase I digestion described by the manufacturer. In addition, we treated the eluted RNA for 1 h at 37°C with DNase I (0.1 U per µg of RNA). DNase I was removed by using DNA-Free (Ambion) or by RNeasy column purification. RNA integrity was monitored by agarose gel electrophoresis of glyoxylated samples.
Further sample preparation and processing of the P. aeruginosa GeneChip genome arrays were done as described by the manufacturer (Affymetrix), with minor modifications suggested by M. Wolfgang (Harvard University). For cDNA synthesis we used 12 µg of purified RNA, semirandom hexamer primers with an average G+C content of 75%, and Superscript II reverse transcriptase (Life Technologies). Control RNAs from yeast, Arabidopsis, and Bacillus subtilis genes (provided by S. Lory) were added to the reaction mixtures to monitor assay performance. Probes for these transcripts are tiled on the GeneChip arrays. RNA was removed from the PCR mixtures by alkaline hydrolysis. The cDNA synthesis products were purified and fragmented by brief incubation with DNase I, and the 3' termini of the fragmentation products were labeled with biotin-ddUTP. Fragmented and labeled cDNA was hybridized to an array by overnight incubation at 50°C. Washing, staining, and scanning of microarrays were performed with an Affymetrix fluidic station.
Analysis of expression profiling experiments.
We used the Affymetrix Microarray Software suite (MAS) (version 5.0) to determine transcript levels and whether there were differences in transcript levels when different samples were compared. Affymetrix scaling was used to normalize data from different arrays. A scale factor is derived from the mean signal of all of the probe sets on an array and a user-defined target signal. The signal from each individual probe set is multiplied by this scale factor. For any given array between 18 and 28% of the mRNAs were considered absent by MAS, indicating that the corresponding genes were not expressed at levels above background levels. Furthermore, the average changes in control transcript intensities were less than twofold for any comparison of array data. This indicates that the efficiency of cDNA synthesis and labeling was similar from sample to sample.
For comparison analyses, the log2 ratio for absolute transcript signals obtained from a given pair of arrays was calculated by using MAS. A statistical algorithm of the software also assigned a change call for each transcript pair, which indicated whether the level of a transcript was significantly increased, decreased, or not changed compared to the level for the baseline sample. The baseline samples were those derived from cultures of PAO-MW1 without added acyl-HSL and from cultures of PAO lasR rhlR. Graphical analysis of the signal log ratios from each experiment (any pair of arrays) revealed a normal distribution with a mean very close to zero (no change). Among the transcripts with significant increases or decreases compared to the baseline in one or more samples, we subjected those that showed a
2.5-fold change to further analysis.
For cluster analyses and transcript pattern analyses we used GeneSpring software (Silicon Genetics, Redwood City, Calif.). The fold change values for each gene were normalized independently by defining the half-maximal value for the gene as 1 and representing all other values as a ratio of that value. This scaling procedure allowed direct visual comparison of gene expression patterns within an experiment, as well as between experiments. GeneSpring was also used to sort genes according to the P. aeruginosa genome project (http://www.pseudomonas.com).
Identification of las-rhl box-like sequences.
A 20-bp consensus sequence (ACCTGCCAGATCTGGCAGGT) was derived from the following previously identified las-rhl box-like sequences in quorum-sensing-controlled genes: PA1869 (qsc117), PA1896 (qsc102), hcnA, lasB, lasI, and phzA (32), as well as PA2592 (qsc104), PA3327 (qsc126), PA4217 (qsc132), rhlA, and rhlI (33). To search the entire P. aeruginosa genome for sequences similar to this consensus, we developed a computer program based on the program used previously to search for LexA binding sites (8). The scoring matrix of the program is based on a heterology index (HI), which determines the degree of divergence of any 20-nucleotide sequence from the consensus las-rhl box sequence. Sequences in a region from 400 bp upstream to 50 bp downstream of annotated translational start sites were considered potential las-rhl boxes if they showed an HI of less than 13.

RESULTS
Genes induced by addition of acyl-HSL signals to the P. aeruginosa signal generation mutant: validation of the microarray analysis.
Previously, the effects of acyl-HSLs on chromosomal
lacZ insertions
in a quorum-sensing signal generation mutant (MW1, a
lasI rhlI mutant) were studied (
33), and 39 loci that responded to the
addition of 3OC12-HSL and C4-HSL were identified. These loci
correspond to 35 different genes in the previously published
annotation of the
P. aeruginosa genome (
28). Two insertions
originally thought to reside in two adjacent genes (qsc109 and
qsc110) are in a single predicted gene (PA2402), and three insertions
(qsc114, qsc127, and qsc136) were oriented in a direction opposite
that of the predicted open reading frames.
To validate the microarray approach, we grew the signal generation mutant with or without 3OC12-HSL and C4-HSL under conditions identical to those used in the previous study (identical medium, growth temperature, acyl-HSL concentrations, etc.) and examined whether the genes identified previously responded to signal addition in a transcriptome analysis. Most genes in the P. aeruginosa genome showed no significant response. Among 638 genes that showed a maximal response to acyl-HSL addition of at least 2.5-fold, 29 of the 35 previously described qsc genes (33) were identified (Table 1). The six remaining genes all exhibited relatively low induction levels in the previous study (33). Four of these six genes, PA2385 (qsc112), PA2401 (qsc111), PA2402 (qsc109-110), and PA2426 (qsc108), showed a significant response to signal addition in our analysis, but the response was less than 2.5-fold. Two genes, PA0051 (qsc137) and PA4084 (qsc113), showed no response. Taken together, our results showed quite good agreement with the results of the previous study (33).
Some of the genes identified in the previous study have also
been determined by other workers to be quorum controlled (for
example,
hcnABC) (
23). There are genes other than those described
in the previous study that have been reported to be quorum controlled.
Most of these genes (for example,
lasA [
20,
29] and
rsaL [
5])
were confirmed by our transcriptome study. A few were not confirmed,
including
toxA (
11) and
sodA (
13). It is not possible to draw
conclusions about the genes that were not confirmed by the transcriptome
analysis. The experimental conditions and strains that were
used previously were different from those that we used.
Quorum-activated regulon.
To identify a larger group of genes in the quorum-sensing regulon of P. aeruginosa, we used the results of the experiment described above, and we performed an additional independent experiment in which we compared transcripts in a quorum-sensing signal receptor double mutant to transcripts in the parent strain. This was an independent procedure to assess whether genes are controlled by quorum sensing. We reasoned that genes showing differential regulation with both approaches (addition of signals to a signal generation mutant and a parent compared to a signal receptor mutant) were likely influenced by quorum sensing. The wild-type P. aeruginosa strain, the signal receptor mutant, and the signal generation mutant grown with and without added acyl-HSL signals showed similar growth patterns under the conditions of our experiments (Fig. 1).
As mentioned above, we identified 638 genes that were induced
or repressed by addition of the acyl-HSL signals to the signal
generation mutant. We identified 810 genes that were differentially
expressed in the parent compared to the signal receptor mutant.
In all, there was an overlapping set of 411 genes. Visual inspection
of the expression patterns of individual genes led to exclusion
of 58 genes. These genes either showed expression levels close
to the background level or showed inconsistent regulatory patterns
when the two experimental approaches were compared. An interesting
example of an inconsistent regulatory pattern was observed with
a few genes identified and classified as late 3OC12-HSL-dependent
genes in the previous study. These genes, PA2401, PA2402, and
PA2385 (qsc109-110, qsc111, and qsc112) showed the predicted
regulatory pattern in our transcriptome analysis of the signal
generation mutant (although they showed low response levels
of 2.0, 2.1, and 2.3, respectively), but they showed quorum-controlled
repression when the parent was compared to the signal receptor
mutant. In all then, we identified 315 genes which we believe
to be quorum activated. These genes and some information regarding
their expression are shown in Table
1.
There is no obvious chromosomal clustering of the genes identified (Fig. 2). The final set of quorum-induced genes represents about 6% of the genome. This is somewhat higher than but not too different from the previous prediction that around 2 to 4% of the genome is quorum induced. However, the genes that we have identified are likely a subset of the quorum regulon. For example, we used one standard set of growth conditions for all of our experiments; it is not unreasonable to believe that other genes in the regulon might be revealed by altering the growth medium or culture conditions. In our experiments about 20 to 30% of the transcripts were undetectable; some of these transcripts might be quorum controlled or expressed at higher levels under different conditions. As discussed above, we also filtered the data set, and we do not believe that the genes that survived the filtering procedure represent an exhaustive compilation of quorum-controlled genes. Rather, the data provide a conservative estimate of quorum-controlled genes. Among the genes listed in Table 1, the most overrepresented categories consist of genes known or predicted to be involved in the production of secreted products. Genes in the adaptation and protection categories and in the central intermediary metabolism categories are also overrepresented.
Quorum-repressed genes.
We identified 38 quorum-repressed genes (Table
2). These genes
showed lower transcript levels in the late logarithmic and stationary
phases in the wild type than in the receptor mutant, as well
as in the signal generation mutant in the presence of signals
than in the mutant grown without added signal. All of the repressed
genes responded as well or nearly as well to 3OC12-HSL alone
as they did to 3OC12-HSL and C4-HSL together. The expression
patterns of a representative quorum-repressed gene, PA0433,
are shown in Fig.
3. A curiousity is that these genes are expressed
at low levels throughout growth of the parent strain. They are
derepressed only in the mutants and only during the late logarithmic
and stationary phases. Among the quorum-repressed genes with
known or predicted functions, those involved in carbohydrate
utilization or nutrient transport appeared to be the most abundant
(Table
2).
Operons and las-rhl box-like sequences.
One would expect that all of the genes in an operon should show
similar quorum control. In fact, we observed that strings of
genes appeared (Tables
1 and
2). These strings often represent
known or suspected operons, and the genes in a given string
show similar quorum responses (signal responses and timing of
induction). For example, the
hcn genes (PA2193 to PA2195) are
known to exist in an operon (
23). Consistent with this, our
transcriptome analysis indicated these genes were coinduced
by quorum sensing. PA2365 to PA2372 represent a string of quorum-controlled
genes with unknown functions. We suggest that these genes represent
an operon. On the other hand, many of the quorum-controlled
genes are not adjacent to other quorum-controlled genes listed
in Tables
1 and
2. To assess whether these genes may also be
organized in operons (neighboring genes would have been eliminated
if they showed induction just under the 2.5-fold threshold)
and to confirm the hypothesis that strings of adjacent quorum-controlled
genes are in operons, we performed a more systematic analysis.
Operon organization was allowed only if every gene within a
gene cluster was in the same orientation, if every gene was
activated or every gene was repressed, if there was less than
250 bp between two adjacent open reading frames, and if the
absolute transcript profiles of the candidate genes in the parent
P. aeruginosa strain showed patterns similar to each other (correlation
coefficient of

0.95 with the GeneSpring standard correlation
algorithm). By using these criteria, we identified 87 possible
operons, 71 of which were activated and 16 of which were repressed
(Fig.
4). More than 60 additional genes showing coregulation
with the genes listed in Tables
1 and
2 were identified by this
analysis.
We used a computer algorithm to search for
las-rhl boxes in
regions upstream of quorum-regulated genes. On the basis of
a stringent criterion (an HI of <10), 55 of the
P. aeruginosa genes contain a box in the upstream regulatory region. Twenty-five
(45%) of these genes are quorum controlled, and 15 represent
the first gene in a predicted operon (Table
1 and Fig.
4). At
a lower stringency (an HI of <13), we identified 185 genes
with
las-rhl box-like sequences. Forty-eight (26%) of these
genes are quorum controlled, and 19 represent the first gene
in a predicted operon. Only one
las-rhl box-like sequence was
found upstream of a quorum-repressed gene. We did not identify
potential boxes for all of our quorum-activated genes. This
suggests that some of the genes might be controlled indirectly
by quorum sensing or that the search criteria were not sufficiently
refined. These possibilities are not mutually exclusive. We
also found
las-rhl boxes for genes that did not appear to be
quorum controlled. Again, this suggests that these genes might
be quorum controlled under other conditions or that the search
criteria need further refinement. We believe that the search
algorithm was biased because it was based on the relatively
small subset of quorum-controlled genes with established
las-rhl boxes (see Materials and Methods). There was no apparent bias,
however, with respect to the timing of induction or signal specificity
of the identified genes.
Signal specificity.
In a previous limited analysis of quorum-controlled gene expression, genes were classified into the following categories based on their responses to the signals: genes that responded equally well to 3OC12-HSL and to 3OC12-HSL and C4-HSL together and genes that responded best only when both 3OC12-HSL and C4-HSL were present (33). It appears from the microarray data that the responses are on a continuum, with some genes responding no better to both signals than they do to 3OC12-HSL alone and other genes showing progressively greater responses to both signals compared to the responses to 3OC12-HSL alone. For example, PA2423 responded no better to both signals then it did to 3OC12-HSL alone, PA0122 responded well to 3OC12-HSL alone but showed an approximately threefold-greater response with both signals, and PA2069 did not respond at all to 3OC12-HSL alone but showed a large response in the presence of both signals (Table 1). This suggests that some genes respond to 3OC12-HSL specifically, others respond with various specificities to either signal, and others respond to C4-HSL specifically. The genes encoding anthranilate dioxygenase, antABC (PA2512 to PA2514), are an exceptional case. These genes were strongly repressed in the presence of 3OC12-HSL alone but were activated in the presence of both signals.
Timing of quorum-controlled gene activation.
The previous analysis (33) showed that induction of some genes, early genes, could be triggered early in the logarithmic phase by addition of signals. With other genes, late genes, there was a delay in induction even in the presence of excess added signal (33). By examining the microarray data we were able to learn about the timing of quorum-sensing-controlled gene induction in the wild-type strain, and we were able to obtain a broader understanding of the influence of acyl-HSL signal addition on control of the quorum regulon. The patterns of quorum-controlled gene expression were remarkably similar in the parent and in the signal generation mutant grown in the presence of 3OC12-HSL and C4-HSL (Fig. 5). A small number of transcripts showed the greatest induction early in growth. Other genes exhibited low levels of induction early in growth but did not reach maximum levels of induction until later in growth. Most transcripts were induced at culture optical densities between 0.8 and 2.0. Some transcripts showed increased abundance relative to the baseline level only at culture optical densities greater than 2.0 (stationary phase). Thus, the transcriptome analysis suggests that the timing of quorum-controlled gene induction is on a continuum, although most genes in the regulon appeared to be activated during the transition from the logarithmic phase to the stationary phase (optical densities between 0.8 and 2.0). The timing of induction for most genes was not affected by exogenous addition of 3OC12-HSL and C4-HSL. Examples of each of the gene expression patterns described above are shown in Fig. 6.
We hypothesize that even in the parent strain at the earliest
sampling time (optical density, 0.05) there were sufficient
acyl-HSL levels for induction of the early genes and that some
other factor was limiting expression of transcripts that were
triggered to accumulate later in growth (because of the large
volume of culture that would be required, it was impractical
to examine cultures at lower optical densities). What other
factor might account for the acyl-HSL-independent triggering
of quorum gene induction? An obvious possibility is that the
acyl-HSL receptors are limiting in the early logarithmic phase
and that the abundance of these factors increases during culture
growth. We hypothesize that quorum-controlled promoters that
are active in the early logarithmic phase bind the transcription
factors and effectively titrate them away from other quorum-controlled
promoters. As the level of LasR increases, additional quorum-controlled
genes should show expression. A prediction of this hypothesis
is that
lasR, and consequently
rhlR, should show increased transcript
abundance as a culture grows. Thus, we examined the microarray
data with respect to
lasR and
rhlR (Fig.
7). Starting at an
optical density of around 0.8 the levels of the
lasR and
rhlR transcripts increased markedly, which is consistent with previous
results obtained with reporter fusions (
1,
22). For
lasR, some
increase was observed in the wild-type strain and in the signal
generation mutant with or without added signal. Thus, the increase
was, at least in part, independent of quorum sensing. This result
is consistent with but does not constitute proof of the model
for timing of quorum-controlled gene expression described above.

DISCUSSION
We used Affymetrix GeneChip technology to expand the list of
genes reported to be controlled by quorum sensing in
P. aeruginosa.
In all, we have identified over 300 genes (about 6% of the
P. aeruginosa genome) that appear to be part of the quorum regulon
(Tables
1 and
2 and Fig.
2 and
4). The fact that these genes
were identified in two different types of analyses (one of which
involved a comparison of a signal generation mutant with itself
in the presence of added signals and the other of which involved
a comparison of a signal receptor mutant with its parent) lends
confidence to our conclusions. Because timing is important in
quorum-controlled gene expression, we examined cultures at several
different points during growth. Thus, we minimized problems
in identifying genes with relatively unstable transcripts. Nevertheless,
the genes that we have identified represent a conservative estimate
of the quorum-controlled regulon in
P. aeruginosa. We filtered
the data in several ways, and of course we examined only cultures
grown in one medium at one temperature. Additional experiments
in which quorum sensing is examined under different conditions
are necessary to more fully understand the breadth of quorum
sensing as a global regulator of gene expression in
P. aeruginosa.
An accompanying paper (
30a) provides further insight in this
regard.
Of the genes which we identified, most were induced by quorum sensing, although some were repressed (Tables 1 and 2). Most repressed genes showed a curious response. They showed derepression only in mutant backgrounds (Fig. 3). Perhaps these genes are activated in the wild type under specific conditions other than those which we used. Expression of these genes might require inducers not present in our experiments or might require other environmental conditions.
Although the most strongly activated genes reported by Whiteley et al. (33) were among the most strongly activated genes according to the microarray analysis, we do not want to attach great significance to the levels of induction we observed. For some genes the levels of induction varied substantially between the signal addition analysis and the comparison of the receptor mutant and parent. In the most extreme cases, some genes showed activation by addition of a signal to the signal generation mutant and repression in the comparison of the receptor mutant with the parent. This indicates that there may be other factors in P. aeruginosa that contribute to control by acyl-HSLs. One possible factor is the LasR-RhlR signal receptor homolog QscR. We know that this protein somehow influences quorum-controlled gene expression in P. aeruginosa, but we do not know how it functions mechanistically (4).
In general, the representation of functional classes in the quorum-controlled regulon was similar to that in the entire P. aeruginosa genome. For example, 43% of the genes in Tables 1 and 2 have unknown functions, compared with 46% of the genes in the entire P. aeruginosa genome. As expected, many quorum-controlled genes are in the secreted-factor category. There are several genes with adaptation and protection functions, and perhaps more surprising is the finding that there are genes coding for general metabolic functions. Caution should be used when significance is attached to individual genes in a functional group. However, there are genes in the general metabolic function group with well-established functions; for example, PA3183 codes for glucose-6-phosphate dehydrogenase, an enzyme essential for glucose catabolism in P. aeruginosa. Why might this gene show quorum control? This is an example of a gene coding for an enzyme with multiple cellular functions. Glucose-6-phosphate dehydrogenase is an NADP-dependent dehydrogenase. As such, it is an NADPH generator, and in fact through this activity it is known to protect P. aeruginosa from oxidative stress by enhancing glutathione synthesis (17). We imagine that without quorum sensing glucose-6-phosphate dehydrogenase can be produced in a quantity sufficient for glucose catabolism but that quorum sensing can boost the levels for alternate functions of this enzyme.
We found that the specificities of responses to 3OC12-HSL versus the specificities of responses to the two signals together showed great variability (although genes in apparent operons showed responses similar to each other). Some of the genes shown in Table 1 appeared to respond specifically to 3OC12-HSL; other genes seemed to respond to 3OC12-HSL, but activation was boosted by addition of C4-HSL; and still other genes seemed to respond to C4-HSL, showing no response to 3OC12-HSL alone. A previous view was that some genes show specificity for 3OC12-HSL and others show specificity for C4-HSL (9, 31). Some of the C4-HSL-dependent genes show some relaxation of specificity (32). The array data suggest that there is a continuum of specificity responses.
The idea of a continuum of responses extends to the timing of quorum-controlled gene induction. We were more interested in the timing of induction or repression than the maximal transcript levels because the maximal levels result from a complex set of factors that presumably include rates of transcription and transcript stability. When we examined timing we saw that there was great variability (Table 1 and Fig. 5 and 6). Some genes showed increased expression early in growth; for most genes the onset of induction was in the late logarithmic to early stationary phase; and some genes were not induced until the stationary phase. In general, timing was similar in the wild type and in the signal generation mutant grown in the presence of saturating levels of added signals. This indicates that over the range of culture densities in our experiments, the trigger for quorum-controlled gene activation was not signal accumulation. The P. aeruginosa quorum-sensing elements are the two signals synthesized by the signal generators LasI and RhlI and the two signal receptors, LasR and RhlR. If the levels of the signals do not govern the onset of induction, then one might hypothesize that receptor levels govern the onset of induction. In fact, we observed that lasR and rhlR transcript levels increased during the late logarithmic and early stationary phases (Fig. 7), which coincided with the induction of most quorum-activated genes. This finding is consistent with the hypothesis, but more evidence is required to determine its validity. The lasR transcript levels were largely independent of quorum sensing. There are other factors in P. aeruginosa that have been reported to control lasR transcription. These factors include the regulators Vfr (1) and GacA (26), as well as the stringent response (30).
Our results for the timing of gene expression raise an interesting question. Are genes whose expression is not directly triggered by exogenous signals really quorum controlled? We believe that there is no evidence to the contrary. Activation of any of the genes which we identified requires sufficient signal. Signal can accumulate only when a critical population density has been reached. The fact that under at least some conditions additional criteria must be met for transcriptional activation of many genes in the regulon does not alter the fact that a quorum is nevertheless required. In fact, a culture medium-dependent delay in the induction of Vibrio fischeri luminescence, even with ample signal, was observed by Eberhard in 1972 (7).
The finding that signal specificity is on a continuum and the hypothesis that levels of LasR and RhlR might control the precise timing of quorum-controlled gene expression lead to the idea that this regulatory system consisting of two signal generators and two signal receptors can allow for an elaborate pattern of expression of hundreds of genes in P. aeruginosa. Genes can be triggered at different times during culture growth, and they can respond to one or both of the signals to various degrees. The simplistic view that quorum sensing leads to the coordinate expression of genes in the quorum-controlled regulon at a critical population density at which the signals have accumulated to a requisite concentration underestimates the complexity of this regulatory circuitry.

ACKNOWLEDGMENTS
We thank Matt Wolfgang and Steve Lory for sharing information
and tools for GeneChip use and analysis, we thank Lora Huang
from the University of Iowa DNA Facility for array processing,
and we thank Niels Bagge for helpful discussions.
This study was supported by grant GM59026 from the National Institute of General Medicine. Support was also provided through a therapeutic development grant from the Cystic Fibrosis Foundation and by a grant from The Procter & Gamble Company, Cincinnati, Ohio. C.P.L. was supported by U.S. Public Health Service training grant T32-AI 07511.
The contents of this paper are solely the responsibility of the authors and do not necessarily represent the official views of the National Institute of General Medicine.

FOOTNOTES
* Corresponding author. Mailing address: 540 EMRB, Newton Road, Roy and Lucille Carver College of Medicine, University of Iowa, Iowa City, IA 52242. Phone: (319) 335-7775. Fax: (319) 335-7949. E-mail:
Everett-greenberg{at}uiowa.edu.

For a commentary on this article, see page 2061 in this issue. 

REFERENCES
1 - Albus, A. M., E. C. Pesci, L. J. Runyen-Janecky, S. E. West, and B. H. Iglewski. 1997. Vfr controls quorum sensing in Pseudomonas aeruginosa. J. Bacteriol. 179:3928-3935.[Abstract/Free Full Text]
2 - Brint, J. M., and D. E. Ohman. 1995. Synthesis of multiple exoproducts in Pseudomonas aeruginosa is under the control of RhlR-RhlI, another set of regulators in strain PAO1 with homology to the autoinducer-responsive LuxR-LuxI family. J. Bacteriol. 177:7155-7163.[Abstract/Free Full Text]
3 - Chapon-Herve, V., M. Akrim, A. Latifi, P. Williams, A. Lazdunski, and M. Bally. 1997. Regulation of the xcp secretion pathway by multiple quorum-sensing modulons in Pseudomonas aeruginosa. Mol. Microbiol. 24:1169-1178.[CrossRef][Medline]
4 - Chugani, S. A., M. Whiteley, K. M. Lee, D. D. Argenio, C. Manoil, and E. P. Greenberg. 2001. QscR, a modulator of quorum-sensing signal synthesis and virulence in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 98:2752-2757.[Abstract/Free Full Text]
5 - de Kievit, T., P. C. Seed, J. Nezezon, L. Passador, and B. H. Iglewski. 1999. RsaL, a novel repressor of virulence gene expression in Pseudomonas aeruginosa. J. Bacteriol. 181:2175-2184.[Abstract/Free Full Text]
6 - Diggle, S. P., K. Winzer, A. Lazdunski, P. Williams, and M. Camara. 2002. Advancing the quorum in Pseudomonas aeruginosa: MvaT and the regulation of N-acylhomoserine lactone production and virulence gene expression. J. Bacteriol. 184:2576-2586.[Abstract/Free Full Text]
7 - Eberhard, A. 1972. Inhibition and activation of bacterial luciferase synthesis. J. Bacteriol. 109:1101-1105.[Abstract/Free Full Text]
8 - Fernandez De Henestrosa, A. R., T. Ogi, S. Aoyagi, D. Chafin, J. J. Hayes, H. Ohmori, and R. Woodgate. 2000. Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol. Microbiol. 35:1560-1572.[CrossRef][Medline]
9 - Fuqua, C., M. R. Parsek, and E. P. Greenberg. 2001. Regulation of gene expression by cell-to-cell communication: acyl-homoserine lactone quorum sensing. Annu. Rev. Genet. 35:439-468.[CrossRef][Medline]
10 - Gambello, M. J., and B. H. Iglewski. 1991. Cloning and characterization of the Pseudomonas aeruginosa lasR gene, a transcriptional activator of elastase expression. J. Bacteriol. 173:3000-3009.[Abstract/Free Full Text]
11 - Gambello, M. J., S. Kaye, and B. H. Iglewski. 1993. LasR of Pseudomonas aeruginosa is a transcriptional activator of the alkaline protease gene (apr) and an enhancer of exotoxin A expression. Infect. Immun. 61:1180-1184.[Abstract/Free Full Text]
12 - Glessner, A., R. S. Smith, B. H. Iglewski, and J. B. Robinson. 1999. Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of twitching motility. J. Bacteriol. 181:1623-1629.[Abstract/Free Full Text]
13 - Hassett, D. J., J. F. Ma, J. G. Elkins, T. R. McDermott, U. A. Ochsner, S. E. West, C. T. Huang, J. Fredericks, S. Burnett, P. S. Stewart, G. McFeters, L. Passador, and B. H. Iglewski. 1999. Quorum sensing in Pseudomonas aeruginosa controls expression of catalase and superoxide dismutase genes and mediates biofilm susceptibility to hydrogen peroxide. Mol. Microbiol. 34:1082-1093.[CrossRef][Medline]
14 - Latifi, A., M. Foglino, K. Tanaka, P. Williams, and A. Lazdunski. 1996. A hierarchical quorum-sensing cascade in Pseudomonas aeruginosa links the transcriptional activators LasR and RhIR (VsmR) to expression of the stationary-phase sigma factor RpoS. Mol. Microbiol. 21:1137-1146.[CrossRef][Medline]
15 - Latifi, A., M. K. Winson, M. Foglino, B. W. Bycroft, G. S. Stewart, A. Lazdunski, and P. Williams. 1995. Multiple homologues of LuxR and LuxI control expression of virulence determinants and secondary metabolites through quorum sensing in Pseudomonas aeruginosa PAO1. Mol. Microbiol. 17:333-343.[CrossRef][Medline]
16 - Lyczak, J. B., C. L. Cannon, and G. B. Pier. 2000. Establishment of Pseudomonas aeruginosa infection: lessons from a versatile opportunist. Microbes Infect. 2:1051-1060.[CrossRef][Medline]
17 - Ma, J. F., P. W. Hager, M. L. Howell, P. V. Phibbs, and D. J. Hassett. 1998. Cloning and characterization of the Pseudomonas aeruginosa zwf gene encoding glucose-6-phosphate dehydrogenase, an enzyme important in resistance to methyl viologen (paraquat). J. Bacteriol. 180:1741-1749.[Abstract/Free Full Text]
18 - Ochsner, U. A., and J. Reiser. 1995. Autoinducer-mediated regulation of rhamnolipid biosurfactant synthesis in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 92:6424-6428.[Abstract/Free Full Text]
19 - Parsek, M. R., and E. P. Greenberg. 2000. Acyl-homoserine lactone quorum sensing in gram-negative bacteria: a signaling mechanism involved in associations with higher organisms. Proc. Natl. Acad. Sci. USA 97:8789-8793.[Abstract/Free Full Text]
20 - Passador, L., J. M. Cook, M. J. Gambello, L. Rust, and B. H. Iglewski. 1993. Expression of Pseudomonas aeruginosa virulence genes requires cell-to-cell communication. Science 260:1127-1130.[Abstract/Free Full Text]
21 - Pearson, J. P., E. C. Pesci, and B. H. Iglewski. 1997. Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes. J. Bacteriol. 179:5756-5767.[Abstract/Free Full Text]
22 - Pesci, E. C., J. P. Pearson, P. C. Seed, and B. H. Iglewski. 1997. Regulation of las and rhl quorum sensing in Pseudomonas aeruginosa. J. Bacteriol. 179:3127-3132.[Abstract/Free Full Text]
23 - Pessi, G., and D. Haas. 2000. Transcriptional control of the hydrogen cyanide biosynthetic genes hcnABC by the anaerobic regulator ANR and the quorum-sensing regulators LasR and RhlR in Pseudomonas aeruginosa. J. Bacteriol. 182:6940-6949.[Abstract/Free Full Text]
24 - Pessi, G., F. Williams, Z. Hindle, K. Heurlier, M. T. Holden, M. Camara, D. Haas, and P. Williams. 2001. The global posttranscriptional regulator RsmA modulates production of virulence determinants and N-acylhomoserine lactones in Pseudomonas aeruginosa. J. Bacteriol. 183:6676-6683.[Abstract/Free Full Text]
25 - Rahim, R., U. A. Ochsner, C. Olvera, M. Graninger, P. Messner, J. S. Lam, and G. Soberon-Chavez. 2001. Cloning and functional characterization of the Pseudomonas aeruginosa rhlC gene that encodes rhamnosyltransferase 2, an enzyme responsible for di-rhamnolipid biosynthesis. Mol. Microbiol. 40:708-718.[CrossRef][Medline]
26 - Reimmann, C., M. Beyeler, A. Latifi, H. Winteler, M. Foglino, A. Lazdunski, and D. Haas. 1997. The global activator GacA of Pseudomonas aeruginosa PAO positively controls the production of the autoinducer N-butyryl-homoserine lactone and the formation of the virulence factors pyocyanin, cyanide, and lipase. Mol. Microbiol. 24:309-319.[CrossRef][Medline]
27 - Stintzi, A., K. Evans, J. M. Meyer, and K. Poole. 1998. Quorum-sensing and siderophore biosynthesis in Pseudomonas aeruginosa: lasR/lasI mutants exhibit reduced pyoverdine biosynthesis. FEMS Microbiol. Lett. 166:341-345.[CrossRef][Medline]
28 - Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, and I. T. Paulsen. 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406:947-948.[CrossRef][Medline]
29 - Toder, D. S., M. J. Gambello, and B. H. Iglewski. 1991. Pseudomonas aeruginosa LasA: a second elastase under the transcriptional control of lasR. Mol. Microbiol. 5:2003-2010.[Medline]
30 - van Delden, C., R. Comte, and A. M. Bally. 2001. Stringent response activates quorum sensing and modulates cell density-dependent gene expression in Pseudomonas aeruginosa. J. Bacteriol. 183:5376-5384.[Abstract/Free Full Text]
30 - Wagner, V. E., D. Bushnell, L. Passador, A. I. Brooks, and B. H. Iglewski. 2003. Microarray analysis of Pseudomonas aeruginosa quorum-sensing regulons: effects of growth phase and environment. J. Bacteriol. 185:2080-2095.
31 - Whitehead, N. A., A. M. Barnard, H. Slater, N. J. Simpson, and G. P. Salmond. 2001. Quorum-sensing in Gram-negative bacteria. FEMS Microbiol. Rev. 25:365-404.[CrossRef][Medline]
32 - Whiteley, M., and E. P. Greenberg. 2001. Promoter specificity elements in Pseudomonas aeruginosa quorum-sensing-controlled genes. J. Bacteriol. 183:5529-5534.[Abstract/Free Full Text]
33 - Whiteley, M., K. M. Lee, and E. P. Greenberg. 1999. Identification of genes controlled by quorum sensing in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 96:13904-13909.[Abstract/Free Full Text]
34 - Whiteley, M., M. R. Parsek, and E. P. Greenberg. 2000. Regulation of quorum sensing by RpoS in Pseudomonas aeruginosa. J. Bacteriol. 182:4356-4360.[Abstract/Free Full Text]
35 - Winson, M. K., M. Camara, A. Latifi, M. Foglino, S. R. Chhabra, M. Daykin, M. Bally, V. Chapon, G. P. Salmond, B. W. Bycroft, et al. 1995. Multiple N-acyl-L-homoserine lactone signal molecules regulate production of virulence determinants and secondary metabolites in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 92:9427-9431.[Abstract/Free Full Text]
36 - Winzer, K., C. Falconer, N. C. Garber, S. P. Diggle, M. Camara, and P. Williams. 2000. The Pseudomonas aeruginosa lectins PA-IL and PA-IIL are controlled by quorum sensing and by RpoS. J. Bacteriol. 182:6401-6411.[Abstract/Free Full Text]
Journal of Bacteriology, April 2003, p. 2066-2079, Vol. 185, No. 7
0021-9193/03/$08.00+0 DOI: 10.1128/JB.185.7.2066-2079.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Ghosh, D., Roy, K., Williamson, K. E., Srinivasiah, S., Wommack, K. E., Radosevich, M.
(2009). Acyl-Homoserine Lactones Can Induce Virus Production in Lysogenic Bacteria: an Alternative Paradigm for Prophage Induction. Appl. Environ. Microbiol.
75: 7142-7152
[Abstract]
[Full Text]
-
Khajanchi, B. K., Sha, J., Kozlova, E. V., Erova, T. E., Suarez, G., Sierra, J. C., Popov, V. L., Horneman, A. J., Chopra, A. K.
(2009). N-Acylhomoserine lactones involved in quorum sensing control the type VI secretion system, biofilm formation, protease production, and in vivo virulence in a clinical isolate of Aeromonas hydrophila. Microbiology
155: 3518-3531
[Abstract]
[Full Text]
-
Tian, Z.-X., Fargier, E., Mac Aogain, M., Adams, C., Wang, Y.-P., O'Gara, F.
(2009). Transcriptome profiling defines a novel regulon modulated by the LysR-type transcriptional regulator MexT in Pseudomonas aeruginosa. Nucleic Acids Res
0: gkp828v1-gkp828
[Abstract]
[Full Text]
-
Boulette, M. L., Baynham, P. J., Jorth, P. A., Kukavica-Ibrulj, I., Longoria, A., Barrera, K., Levesque, R. C., Whiteley, M.
(2009). Characterization of Alanine Catabolism in Pseudomonas aeruginosa and Its Importance for Proliferation In Vivo. J. Bacteriol.
191: 6329-6334
[Abstract]
[Full Text]
-
Chandler, J. R., Duerkop, B. A., Hinz, A., West, T. E., Herman, J. P., Churchill, M. E. A., Skerrett, S. J., Greenberg, E. P.
(2009). Mutational Analysis of Burkholderia thailandensis Quorum Sensing and Self-Aggregation. J. Bacteriol.
191: 5901-5909
[Abstract]
[Full Text]
-
Gupta, R., Gobble, T. R., Schuster, M.
(2009). GidA Posttranscriptionally Regulates rhl Quorum Sensing in Pseudomonas aeruginosa. J. Bacteriol.
191: 5785-5792
[Abstract]
[Full Text]
-
Lesic, B., Starkey, M., He, J., Hazan, R., Rahme, L. G.
(2009). Quorum sensing differentially regulates Pseudomonas aeruginosa type VI secretion locus I and homologous loci II and III, which are required for pathogenesis. Microbiology
155: 2845-2855
[Abstract]
[Full Text]
-
Steindler, L., Bertani, I., De Sordi, L., Schwager, S., Eberl, L., Venturi, V.
(2009). LasI/R and RhlI/R Quorum Sensing in a Strain of Pseudomonas aeruginosa Beneficial to Plants. Appl. Environ. Microbiol.
75: 5131-5140
[Abstract]
[Full Text]
-
Lopez, D., Vlamakis, H., Losick, R., Kolter, R.
(2009). Paracrine signaling in a bacterium. Genes Dev.
23: 1631-1638
[Abstract]
[Full Text]
-
Gurich, N., Gonzalez, J. E.
(2009). Role of Quorum Sensing in Sinorhizobium meliloti-Alfalfa Symbiosis. J. Bacteriol.
191: 4372-4382
[Abstract]
[Full Text]
-
Mashburn-Warren, L., Howe, J., Brandenburg, K., Whiteley, M.
(2009). Structural Requirements of the Pseudomonas Quinolone Signal for Membrane Vesicle Stimulation. J. Bacteriol.
191: 3411-3414
[Abstract]
[Full Text]
-
Kohler, T., Buckling, A., van Delden, C.
(2009). Cooperation and virulence of clinical Pseudomonas aeruginosa populations. Proc. Natl. Acad. Sci. USA
106: 6339-6344
[Abstract]
[Full Text]
-
Sarnovsky, R., Rea, J., Makowski, M., Hertle, R., Kelly, C., Antignani, A., Pastrana, D. V., FitzGerald, D. J.
(2009). Proteolytic Cleavage of a C-terminal Prosequence, Leading to Autoprocessing at the N Terminus, Activates Leucine Aminopeptidase from Pseudomonas aeruginosa. J. Biol. Chem.
284: 10243-10253
[Abstract]
[Full Text]
-
Damron, F. H., Napper, J., Teter, M. A., Yu, H. D.
(2009). Lipotoxin F of Pseudomonas aeruginosa is an AlgU-dependent and alginate-independent outer membrane protein involved in resistance to oxidative stress and adhesion to A549 human lung epithelia. Microbiology
155: 1028-1038
[Abstract]
[Full Text]
-
Bernard, C. S., Bordi, C., Termine, E., Filloux, A., de Bentzmann, S.
(2009). Organization and PprB-Dependent Control of the Pseudomonas aeruginosa tad Locus, Involved in Flp Pilus Biology. J. Bacteriol.
191: 1961-1973
[Abstract]
[Full Text]
-
Mikkelsen, H., Bond, N. J., Skindersoe, M. E., Givskov, M., Lilley, K. S., Welch, M.
(2009). Biofilms and type III secretion are not mutually exclusive in Pseudomonas aeruginosa. Microbiology
155: 687-698
[Abstract]
[Full Text]
-
Dekimpe, V., Deziel, E.
(2009). Revisiting the quorum-sensing hierarchy in Pseudomonas aeruginosa: the transcriptional regulator RhlR regulates LasR-specific factors. Microbiology
155: 712-723
[Abstract]
[Full Text]
-
Ramsey, M. M., Whiteley, M.
(2009). Polymicrobial interactions stimulate resistance to host innate immunity through metabolite perception. Proc. Natl. Acad. Sci. USA
106: 1578-1583
[Abstract]
[Full Text]
-
Manos, J., Arthur, J., Rose, B., Tingpej, P., Fung, C., Curtis, M., Webb, J. S., Hu, H., Kjelleberg, S., Gorrell, M. D., Bye, P., Harbour, C.
(2008). Transcriptome analyses and biofilm-forming characteristics of a clonal Pseudomonas aeruginosa from the cystic fibrosis lung. J Med Microbiol
57: 1454-1465
[Abstract]
[Full Text]
-
Sugimura, M., Maseda, H., Hanaki, H., Nakae, T.
(2008). Macrolide Antibiotic-Mediated Downregulation of MexAB-OprM Efflux Pump Expression in Pseudomonas aeruginosa. Antimicrob. Agents Chemother.
52: 4141-4144
[Abstract]
[Full Text]
-
Farrow, J. M. III, Sund, Z. M., Ellison, M. L., Wade, D. S., Coleman, J. P., Pesci, E. C.
(2008). PqsE Functions Independently of PqsR-Pseudomonas Quinolone Signal and Enhances the rhl Quorum-Sensing System. J. Bacteriol.
190: 7043-7051
[Abstract]
[Full Text]
-
Tarighi, S., Wei, Q., Camara, M., Williams, P., Fletcher, M. P., Kajander, T., Cornelis, P.
(2008). The PA4204 gene encodes a periplasmic gluconolactonase (PpgL) which is important for fitness of Pseudomonas aeruginosa. Microbiology
154: 2979-2990
[Abstract]
[Full Text]
-
Skindersoe, M. E., Alhede, M., Phipps, R., Yang, L., Jensen, P. O., Rasmussen, T. B., Bjarnsholt, T., Tolker-Nielsen, T., Hoiby, N., Givskov, M.
(2008). Effects of Antibiotics on Quorum Sensing in Pseudomonas aeruginosa. Antimicrob. Agents Chemother.
52: 3648-3663
[Abstract]
[Full Text]
-
Upritchard, H. G., Cordwell, S. J., Lamont, I. L.
(2008). Immunoproteomics To Examine Cystic Fibrosis Host Interactions with Extracellular Pseudomonas aeruginosa Proteins. Infect. Immun.
76: 4624-4632
[Abstract]
[Full Text]
-
Liang, H., Li, L., Dong, Z., Surette, M. G., Duan, K.
(2008). The YebC Family Protein PA0964 Negatively Regulates the Pseudomonas aeruginosa Quinolone Signal System and Pyocyanin Production. J. Bacteriol.
190: 6217-6227
[Abstract]
[Full Text]
-
Overhage, J., Campisano, A., Bains, M., Torfs, E. C. W., Rehm, B. H. A., Hancock, R. E. W.
(2008). Human Host Defense Peptide LL-37 Prevents Bacterial Biofilm Formation. Infect. Immun.
76: 4176-4182
[Abstract]
[Full Text]
-
Willcox, M. D. P., Zhu, H., Conibear, T. C. R., Hume, E. B. H., Givskov, M., Kjelleberg, S., Rice, S. A.
(2008). Role of quorum sensing by Pseudomonas aeruginosa in microbial keratitis and cystic fibrosis. Microbiology
154: 2184-2194
[Abstract]
[Full Text]
-
Kiely, P. D., O'Callaghan, J., Abbas, A., O'Gara, F.
(2008). Genetic analysis of genes involved in dipeptide metabolism and cytotoxicity in Pseudomonas aeruginosa PAO1. Microbiology
154: 2209-2218
[Abstract]
[Full Text]
-
Lenz, A. P., Williamson, K. S., Pitts, B., Stewart, P. S., Franklin, M. J.
(2008). Localized Gene Expression in Pseudomonas aeruginosa Biofilms. Appl. Environ. Microbiol.
74: 4463-4471
[Abstract]
[Full Text]
-
Kukavica-Ibrulj, I., Sanschagrin, F., Peterson, A., Whiteley, M., Boyle, B., MacKay, J., Levesque, R. C.
(2008). Functional genomics of PycR, a LysR family transcriptional regulator essential for maintenance of Pseudomonas aeruginosa in the rat lung. Microbiology
154: 2106-2118
[Abstract]
[Full Text]
-
Takaya, A., Tabuchi, F., Tsuchiya, H., Isogai, E., Yamamoto, T.
(2008). Negative Regulation of Quorum-Sensing Systems in Pseudomonas aeruginosa by ATP-Dependent Lon Protease. J. Bacteriol.
190: 4181-4188
[Abstract]
[Full Text]
-
Oglesby, A. G., Farrow, J. M. III, Lee, J.-H., Tomaras, A. P., Greenberg, E. P., Pesci, E. C., Vasil, M. L.
(2008). The Influence of Iron on Pseudomonas aeruginosa Physiology: A REGULATORY LINK BETWEEN IRON AND QUORUM SENSING. J. Biol. Chem.
283: 15558-15567
[Abstract]
[Full Text]
-
Overhage, J., Bains, M., Brazas, M. D., Hancock, R. E. W.
(2008). Swarming of Pseudomonas aeruginosa Is a Complex Adaptation Leading to Increased Production of Virulence Factors and Antibiotic Resistance. J. Bacteriol.
190: 2671-2679
[Abstract]
[Full Text]
-
Ravantti, J. J., Ruokoranta, T. M., Alapuranen, A. M., Bamford, D. H.
(2008). Global Transcriptional Responses of Pseudomonas aeruginosa to Phage PRR1 Infection. J. Virol.
82: 2324-2329
[Abstract]
[Full Text]
-
Rao, J., DiGiandomenico, A., Unger, J., Bao, Y., Polanowska-Grabowska, R. K., Goldberg, J. B.
(2008). A novel oxidized low-density lipoprotein-binding protein from Pseudomonas aeruginosa. Microbiology
154: 654-665
[Abstract]
[Full Text]
-
Baert, B., Baysse, C., Matthijs, S., Cornelis, P.
(2008). Multiple phenotypic alterations caused by a c-type cytochrome maturation ccmC gene mutation in Pseudomonas aeruginosa. Microbiology
154: 127-138
[Abstract]
[Full Text]
-
Sztajer, H., Lemme, A., Vilchez, R., Schulz, S., Geffers, R., Yip, C. Y. Y., Levesque, C. M., Cvitkovitch, D. G., Wagner-Dobler, I.
(2008). Autoinducer-2-Regulated Genes in Streptococcus mutans UA159 and Global Metabolic Effect of the luxS Mutation. J. Bacteriol.
190: 401-415
[Abstract]
[Full Text]
-
Yarwood, J. M., Paquette, K. M., Tikh, I. B., Volper, E. M., Greenberg, E. P.
(2007). Generation of Virulence Factor Variants in Staphylococcus aureus Biofilms. J. Bacteriol.
189: 7961-7967
[Abstract]
[Full Text]
-
Kirisits, M. J., Margolis, J. J., Purevdorj-Gage, B. L., Vaughan, B., Chopp, D. L., Stoodley, P., Parsek, M. R.
(2007). Influence of the Hydrodynamic Environment on Quorum Sensing in Pseudomonas aeruginosa Biofilms. J. Bacteriol.
189: 8357-8360
[Abstract]
[Full Text]
-
Antunes, L. C. M., Schaefer, A. L., Ferreira, R. B. R., Qin, N., Stevens, A. M., Ruby, E. G., Greenberg, E. P.
(2007). Transcriptome Analysis of the Vibrio fischeri LuxR-LuxI Regulon. J. Bacteriol.
189: 8387-8391
[Abstract]
[Full Text]
-
Palmer, K. L., Aye, L. M., Whiteley, M.
(2007). Nutritional Cues Control Pseudomonas aeruginosa Multicellular Behavior in Cystic Fibrosis Sputum. J. Bacteriol.
189: 8079-8087
[Abstract]
[Full Text]
-
Patrauchan, M. A., Sarkisova, S. A., Franklin, M. J.
(2007). Strain-specific proteome responses of Pseudomonas aeruginosa to biofilm-associated growth and to calcium. Microbiology
153: 3838-3851
[Abstract]
[Full Text]
-
Son, M. S., Matthews, W. J. Jr., Kang, Y., Nguyen, D. T., Hoang, T. T.
(2007). In Vivo Evidence of Pseudomonas aeruginosa Nutrient Acquisition and Pathogenesis in the Lungs of Cystic Fibrosis Patients. Infect. Immun.
75: 5313-5324
[Abstract]
[Full Text]
-
Morici, L. A., Carterson, A. J., Wagner, V. E., Frisk, A., Schurr, J. R., zu Bentrup, K. H., Hassett, D. J., Iglewski, B. H., Sauer, K., Schurr, M. J.
(2007). Pseudomonas aeruginosa AlgR Represses the Rhl Quorum-Sensing System in a Biofilm-Specific Manner. J. Bacteriol.
189: 7752-7764
[Abstract]
[Full Text]
-
Sandoz, K. M., Mitzimberg, S. M., Schuster, M.
(2007). From the Cover: Social cheating in Pseudomonas aeruginosa quorum sensing. Proc. Natl. Acad. Sci. USA
104: 15876-15881
[Abstract]
[Full Text]
-
Lequette, Y., Rollet, E., Delangle, A., Greenberg, E. P., Bohin, J.-P.
(2007). Linear osmoregulated periplasmic glucans are encoded by the opgGH locus of Pseudomonas aeruginosa. Microbiology
153: 3255-3263
[Abstract]
[Full Text]
-
Brown, S. A., Whiteley, M.
(2007). A Novel Exclusion Mechanism for Carbon Resource Partitioning in Aggregatibacter actinomycetemcomitans. J. Bacteriol.
189: 6407-6414
[Abstract]
[Full Text]
-
Williams, P., Winzer, K., Chan, W. C, Camara, M.
(2007). Look who's talking: communication and quorum sensing in the bacterial world. Phil Trans R Soc B
362: 1119-1134
[Abstract]
[Full Text]
-
Barnard, A. M.L, Bowden, S. D, Burr, T., Coulthurst, S. J, Monson, R. E, Salmond, G. P.C
(2007). Quorum sensing, virulence and secondary metabolite production in plant soft-rotting bacteria. Phil Trans R Soc B
362: 1165-1183
[Abstract]
[Full Text]
-
Bjarnsholt, T., Givskov, M.
(2007). Quorum-sensing blockade as a strategy for enhancing host defences against bacterial pathogens. Phil Trans R Soc B
362: 1213-1222
[Abstract]
[Full Text]
-
Duan, K., Surette, M. G.
(2007). Environmental Regulation of Pseudomonas aeruginosa PAO1 Las and Rhl Quorum-Sensing Systems. J. Bacteriol.
189: 4827-4836
[Abstract]
[Full Text]
-
Toyofuku, M., Nomura, N., Fujii, T., Takaya, N., Maseda, H., Sawada, I., Nakajima, T., Uchiyama, H.
(2007). Quorum Sensing Regulates Denitrification in Pseudomonas aeruginosa PAO1. J. Bacteriol.
189: 4969-4972
[Abstract]
[Full Text]
-
Li, L.-L., Malone, J. E., Iglewski, B. H.
(2007). Regulation of the Pseudomonas aeruginosa Quorum-Sensing Regulator VqsR. J. Bacteriol.
189: 4367-4374
[Abstract]
[Full Text]
-
Michel, G. P. F., Durand, E., Filloux, A.
(2007). XphA/XqhA, a Novel GspCD Subunit for Type II Secretion in Pseudomonas aeruginosa. J. Bacteriol.
189: 3776-3783
[Abstract]
[Full Text]
-
Ishida, T., Ikeda, T., Takiguchi, N., Kuroda, A., Ohtake, H., Kato, J.
(2007). Inhibition of Quorum Sensing in Pseudomonas aeruginosa by N-Acyl Cyclopentylamides. Appl. Environ. Microbiol.
73: 3183-3188
[Abstract]
[Full Text]
-
Bottomley, M. J., Muraglia, E., Bazzo, R., Carfi, A.
(2007). Molecular Insights into Quorum Sensing in the Human Pathogen Pseudomonas aeruginosa from the Structure of the Virulence Regulator LasR Bound to Its Autoinducer. J. Biol. Chem.
282: 13592-13600
[Abstract]
[Full Text]
-
Jensen, P. O., Bjarnsholt, T., Phipps, R., Rasmussen, T. B., Calum, H., Christoffersen, L., Moser, C., Williams, P., Pressler, T., Givskov, M., Hoiby, N.
(2007). Rapid necrotic killing of polymorphonuclear leukocytes is caused by quorum-sensing-controlled production of rhamnolipid by Pseudomonas aeruginosa. Microbiology
153: 1329-1338
[Abstract]
[Full Text]
-
Farrow, J. M. III, Pesci, E. C.
(2007). Two Distinct Pathways Supply Anthranilate as a Precursor of the Pseudomonas Quinolone Signal. J. Bacteriol.
189: 3425-3433
[Abstract]
[Full Text]
-
Stoltz, D. A., Ozer, E. A., Ng, C. J., Yu, J. M., Reddy, S. T., Lusis, A. J., Bourquard, N., Parsek, M. R., Zabner, J., Shih, D. M.
(2007). Paraoxonase-2 deficiency enhances Pseudomonas aeruginosa quorum sensing in murine tracheal epithelia. Am. J. Physiol. Lung Cell. Mol. Physiol.
292: L852-L860
[Abstract]
[Full Text]
-
Rey, F. E., Heiniger, E. K., Harwood, C. S.
(2007). Redirection of Metabolism for Biological Hydrogen Production. Appl. Environ. Microbiol.
73: 1665-1671
[Abstract]
[Full Text]
-
Subsin, B., Chambers, C. E., Visser, M. B., Sokol, P. A.
(2007). Identification of Genes Regulated by the cepIR Quorum-Sensing System in Burkholderia cenocepacia by High-Throughput Screening of a Random Promoter Library. J. Bacteriol.
189: 968-979
[Abstract]
[Full Text]
-
Yan, A., Huang, X., Liu, H., Dong, D., Zhang, D., Zhang, X., Xu, Y.
(2007). An rhl-like quorum-sensing system negatively regulates pyoluteorin production in Pseudomonas sp. M18. Microbiology
153: 16-28
[Abstract]
[Full Text]
-
Lujan, A. M., Moyano, A. J., Segura, I., Argarana, C. E., Smania, A. M.
(2007). Quorum-sensing-deficient (lasR) mutants emerge at high frequency from a Pseudomonas aeruginosa mutS strain. Microbiology
153: 225-237
[Abstract]
[Full Text]
-
Jensen, V., Lons, D., Zaoui, C., Bredenbruch, F., Meissner, A., Dieterich, G., Munch, R., Haussler, S.
(2006). RhlR Expression in Pseudomonas aeruginosa Is Modulated by the Pseudomonas Quinolone Signal via PhoB-Dependent and -Independent Pathways. J. Bacteriol.
188: 8601-8606
[Abstract]
[Full Text]
-
Muh, U., Hare, B. J., Duerkop, B. A., Schuster, M., Hanzelka, B. L., Heim, R., Olson, E. R., Greenberg, E. P.
(2006). A structurally unrelated mimic of a Pseudomonas aeruginosa acyl-homoserine lactone quorum-sensing signal. Proc. Natl. Acad. Sci. USA
103: 16948-16952
[Abstract]
[Full Text]
-
Barraud, N., Hassett, D. J., Hwang, S.-H., Rice, S. A., Kjelleberg, S., Webb, J. S.
(2006). Involvement of Nitric Oxide in Biofilm Dispersal of Pseudomonas aeruginosa.. J. Bacteriol.
188: 7344-7353
[Abstract]
[Full Text]
-
Muh, U., Schuster, M., Heim, R., Singh, A., Olson, E. R., Greenberg, E. P.
(2006). Novel Pseudomonas aeruginosa Quorum-Sensing Inhibitors Identified in an Ultra-High-Throughput Screen. Antimicrob. Agents Chemother.
50: 3674-3679
[Abstract]
[Full Text]
-
Zimmermann, S., Wagner, C., Muller, W., Brenner-Weiss, G., Hug, F., Prior, B., Obst, U., Hansch, G. M.
(2006). Induction of neutrophil chemotaxis by the quorum-sensing molecule N-(3-oxododecanoyl)-L-homoserine lactone.. Infect. Immun.
74: 5687-5692
[Abstract]
[Full Text]
-
Waters, C. M., Bassler, B. L.
(2006). The Vibrio harveyi quorum-sensing system uses shared regulatory components to discriminate between multiple autoinducers. Genes Dev.
20: 2754-2767
[Abstract]
[Full Text]
-
Laskowski, M. A., Kazmierczak, B. I.
(2006). Mutational Analysis of RetS, an Unusual Sensor Kinase-Response Regulator Hybrid Required for Pseudomonas aeruginosa Virulence.. Infect. Immun.
74: 4462-4473
[Abstract]
[Full Text]
-
de Bentzmann, S., Aurouze, M., Ball, G., Filloux, A.
(2006). FppA, a Novel Pseudomonas aeruginosa Prepilin Peptidase Involved in Assembly of Type IVb Pili. J. Bacteriol.
188: 4851-4860
[Abstract]
[Full Text]
-
Xiao, G., He, J., Rahme, L. G.
(2006). Mutation analysis of the Pseudomonas aeruginosa mvfR and pqsABCDE gene promoters demonstrates complex quorum-sensing circuitry. Microbiology
152: 1679-1686
[Abstract]
[Full Text]
-
Smith, E. E., Buckley, D. G., Wu, Z., Saenphimmachak, C., Hoffman, L. R., D'Argenio, D. A., Miller, S. I., Ramsey, B. W., Speert, D. P., Moskowitz, S. M., Burns, J. L., Kaul, R., Olson, M. V.
(2006). From the Cover: Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc. Natl. Acad. Sci. USA
103: 8487-8492
[Abstract]
[Full Text]
-
Nalca, Y., Jansch, L., Bredenbruch, F., Geffers, R., Buer, J., Haussler, S.
(2006). Quorum-Sensing Antagonistic Activities of Azithromycin in Pseudomonas aeruginosa PAO1: a Global Approach.. Antimicrob. Agents Chemother.
50: 1680-1688
[Abstract]
[Full Text]
-
Fuqua, C.
(2006). The QscR Quorum-Sensing Regulon of Pseudomonas aeruginosa: an Orphan Claims Its Identity. J. Bacteriol.
188: 3169-3171
[Full Text]
-
Lequette, Y., Lee, J.-H., Ledgham, F., Lazdunski, A., Greenberg, E. P.
(2006). A Distinct QscR Regulon in the Pseudomonas aeruginosa Quorum-Sensing Circuit. J. Bacteriol.
188: 3365-3370
[Abstract]
[Full Text]
-
Aspedon, A., Palmer, K., Whiteley, M.
(2006). Microarray Analysis of the Osmotic Stress Response in Pseudomonas aeruginosa.. J. Bacteriol.
188: 2721-2725
[Abstract]
[Full Text]
-
Babu, M. M., Priya, M. L., Selvan, A. T., Madera, M., Gough, J., Aravind, L., Sankaran, K.
(2006). A Database of Bacterial Lipoproteins (DOLOP) with Functional Assignments to Predicted Lipoproteins.. J. Bacteriol.
188: 2761-2773
[Abstract]
[Full Text]
-
Rasmussen, T. B., Givskov, M.
(2006). Quorum sensing inhibitors: a bargain of effects.. Microbiology
152: 895-904
[Abstract]
[Full Text]
-
An, D., Danhorn, T., Fuqua, C., Parsek, M. R.
(2006). Quorum sensing and motility mediate interactions between Pseudomonas aeruginosa and Agrobacterium tumefaciens in biofilm cocultures.. Proc. Natl. Acad. Sci. USA
103: 3828-3833
[Abstract]
[Full Text]
-
Sio, C. F., Otten, L. G., Cool, R. H., Diggle, S. P., Braun, P. G., Bos, R., Daykin, M., Camara, M., Williams, P., Quax, W. J.
(2006). Quorum Quenching by an N-Acyl-Homoserine Lactone Acylase from Pseudomonas aeruginosa PAO1. Infect. Immun.
74: 1673-1682
[Abstract]
[Full Text]
-
Camilli, A., Bassler, B. L.
(2006). Bacterial small-molecule signaling pathways.. Science
311: 1113-1116
[Abstract]
[Full Text]
-
Yang, S., Lopez, C. R., Zechiedrich, E. L.
(2006). Quorum sensing and multidrug transporters in Escherichia coli. Proc. Natl. Acad. Sci. USA
103: 2386-2391
[Abstract]
[Full Text]
-
Huang, J. J., Petersen, A., Whiteley, M., Leadbetter, J. R.
(2006). Identification of QuiP, the Product of Gene PA1032, as the Second Acyl-Homoserine Lactone Acylase of Pseudomonas aeruginosa PAO1. Appl. Environ. Microbiol.
72: 1190-1197
[Abstract]
[Full Text]
-
Gould, T. A., Herman, J., Krank, J., Murphy, R. C., Churchill, M. E. A.
(2006). Specificity of Acyl-Homoserine Lactone Synthases Examined by Mass Spectrometry. J. Bacteriol.
188: 773-783
[Abstract]
[Full Text]
-
Rampioni, G., Bertani, I., Zennaro, E., Polticelli, F., Venturi, V., Leoni, L.
(2006). The Quorum-Sensing Negative Regulator RsaL of Pseudomonas aeruginosa Binds to the lasI Promoter. J. Bacteriol.
188: 815-819
[Abstract]
[Full Text]
-
Gao, M., Chen, H., Eberhard, A., Gronquist, M. R., Robinson, J. B., Rolfe, B. G., Bauer, W. D.
(2005). sinI- and expR-Dependent Quorum Sensing in Sinorhizobium meliloti. J. Bacteriol.
187: 7931-7944
[Abstract]
[Full Text]
-
Southey-Pillig, C. J., Davies, D. G., Sauer, K.
(2005). Characterization of Temporal Protein Production in Pseudomonas aeruginosa Biofilms. J. Bacteriol.
187: 8114-8126
[Abstract]
[Full Text]
-
Wu, M., Guina, T., Brittnacher, M., Nguyen, H., Eng, J., Miller, S. I.
(2005). The Pseudomonas aeruginosa Proteome during Anaerobic Growth. J. Bacteriol.
187: 8185-8190
[Abstract]
[Full Text]
-
Farah, C., Vera, M., Morin, D., Haras, D., Jerez, C. A., Guiliani, N.
(2005). Evidence for a Functional Quorum-Sensing Type AI-1 System in the Extremophilic Bacterium Acidithiobacillus ferrooxidans. Appl. Environ. Microbiol.
71: 7033-7040
[Abstract]
[Full Text]
-
Koch, B., Liljefors, T., Persson, T., Nielsen, J., Kjelleberg, S., Givskov, M.
(2005). The LuxR receptor: the sites of interaction with quorum-sensing signals and inhibitors. Microbiology
151: 3589-3602
[Abstract]
[Full Text]
-
Hickman, J. W., Tifrea, D. F., Harwood, C. S.
(2005). A chemosensory system that regulates biofilm formation through modulation of cyclic diguanylate levels. Proc. Natl. Acad. Sci. USA
102: 14422-14427
[Abstract]
[Full Text]
-
Waite, R. D., Papakonstantinopoulou, A., Littler, E., Curtis, M. A.
(2005). Transcriptome Analysis of Pseudomonas aeruginosa Growth: Comparison of Gene Expression in Planktonic Cultures and Developing and Mature Biofilms. J. Bacteriol.
187: 6571-6576
[Abstract]
[Full Text]
-
Visick, K. L., Fuqua, C.
(2005). Decoding Microbial Chatter: Cell-Cell Communication in Bacteria. J. Bacteriol.
187: 5507-5519
[Full Text]
-
Kirisits, M. J., Prost, L., Starkey, M., Parsek, M. R.
(2005). Characterization of Colony Morphology Variants Isolated from Pseudomonas aeruginosa Biofilms. Appl. Environ. Microbiol.
71: 4809-4821
[Abstract]
[Full Text]
-
Malott, R. J., Baldwin, A., Mahenthiralingam, E., Sokol, P. A.
(2005). Characterization of the cciIR Quorum-Sensing System in Burkholderia cenocepacia. Infect. Immun.
73: 4982-4992
[Abstract]
[Full Text]
-
Palmer, K. L., Mashburn, L. M., Singh, P. K., Whiteley, M.
(2005). Cystic Fibrosis Sputum Supports Growth and Cues Key Aspects of Pseudomonas aeruginosa Physiology. J. Bacteriol.
187: 5267-5277
[Abstract]
[Full Text]
-
Heurlier, K., Denervaud, V., Haenni, M., Guy, L., Krishnapillai, V., Haas, D.
(2005). Quorum-Sensing-Negative (lasR) Mutants of Pseudomonas aeruginosa Avoid Cell Lysis and Death. J. Bacteriol.
187: 4875-4883
[Abstract]
[Full Text]
-
Salunkhe, P., Smart, C. H. M., Morgan, J. A. W., Panagea, S., Walshaw, M. J., Hart, C. A., Geffers, R., Tummler, B., Winstanley, C.
(2005). A Cystic Fibrosis Epidemic Strain of Pseudomonas aeruginosa Displays Enhanced Virulence and Antimicrobial Resistance. J. Bacteriol.
187: 4908-4920
[Abstract]
[Full Text]