Previous Article
Journal of Bacteriology, June 2004, p. 4046-4050, Vol. 186, No. 12
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.12.4046-4050.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Microarray Analysis and Functional Characterization of the Nitrosative Stress Response in Nonmucoid and Mucoid Pseudomonas aeruginosa
Aaron M. Firoved,1 Simon R. Wood,2,3 Wojciech Ornatowski,1 Vojo Deretic,1 and Graham S. Timmins2*
Department of Molecular Genetics and Microbiology,1
College of Pharmacy, Toxicology Program, University of New Mexico Health Sciences Center, Albuquerque, New Mexico 87131,2
Division of Oral Biology, Leeds Dental Institute, University of Leeds, Leeds, United Kingdom3
Received 4 September 2003/
Accepted 2 March 2004

ABSTRACT
The type strain of
Pseudomonas aeruginosa, PAO1, showed great
upregulation of many nitrosative defense genes upon treatment
with
S-nitrosoglutathione, while the mucoid strain PAO578II
showed no further upregulation above its constitutive upregulation
of
nor and
fhp. NO
· consumption however, showed that
both strains mount functional, protein synthesis-dependent NO
·-consumptive
responses.

TEXT
The prevalence of
Pseudomonas aeruginosa in individuals with
cystic fibrosis (CF) is thought to be due to derangements of
salt concentrations in airway surface fluid, bacterial adhesion
to airway epithelial cells, and nitric oxide (NO
·)-mediated
innate immunity (
23). While these factors can be interrelated
(
5), decreased NO
·-mediated innate immunity is clearly
important (
15). NO
· is a potently bactericidal component
of the innate immune system (
3,
19) that acts either directly
or via its ready conversion to other species, e.g., peroxynitrite
and
S-nitrosothiols. Microarray studies have demonstrated mucoidy-induced
expression increases for genes whose products, such as nitric
oxide reductase (
nor) and flavohemoglobin (
fhp), are involved
in defense against NO
· (
7). Conversion to mucoidy in
the CF-infected host increases general bacterial resistance
to host clearance and antibiotics (
11,
17), to which constitutive
NO
· defense by Nor and Fhp may contribute. To further
characterize this NO
· resistance, we induced nitrosative
defense responses in the
P. aeruginosa type strain, PAO1 (which
is nonmucoid), and its mucoid derivative strain, PA0578II, by
using
S-nitrosoglutathione (GSNO). GSNO is a physiologically
relevant NO
· donor that provides a nonvolatile carrier
of NO
· in the airway surface fluid of the lung (
27) and
whose levels are decreased in the lower airways in individuals
with CF (
12). These characteristics are thought to be important
in the pathogenesis of
P. aeruginosa in cases of CF (
10). Gene
expression was determined by microarray analysis as previously
described (
7). Furthermore, rates of in vivo NO
· consumption
were measured by a microelectrode technique.
Microarray analysis of nitrosative defense by GSNO.
GSNO (13) was added to cultures of PAO1 and its mucoid derivative, PAO578II (4, 8), for 30 min at a 5 mM final concentration, and then RNA extraction and analysis were performed as previously described (7). Strain PAO578II is a prototypical strain of mucoid isolates from individuals with CF: it carries both the mucA22 and sup-2 mutations (4, 8). The GSNO treatment caused growth arrest, but plate assays showed it not to be bactericidal (data not shown). The results from three microarray chips, i.e., independent identical experiments, were obtained for each strain (see Table S1 in the supplemental material). Each value from each chip represents the average of 13 independent spots for each gene on each chip, providing further averaging. Ratios of gene expression levels in GSNO-treated bacteria to those in controls were calculated, and the 30 most upregulated, annotated genes (28) for each strain were selected (see the online annotation project at http://www.pseudomonas.com). All statistical analysis was done by t testing (with Microcal Origin software).
The P. aeruginosa mucoid strain PAO578II and the nonmucoid strain PAO1 were grown and treated with GSNO as described above. Total cellular RNA was isolated by using the AquaPure RNA isolation kit (Bio-Rad) and treated with DNA-free (Ambion) to remove any contaminating DNA. Reverse transcription was performed with a Retroscript kit (Ambion) per the manufacturer's protocol. The total cDNA was quantified by spectrophotometry, and exactly 50 ng was used in each real-time PCR. Real-time PCR was carried out in triplicate on an iCycler iQ real-time PCR detection system (Bio-Rad) by using iQ SYBR Green Supermix (Bio-Rad) with 50 ng of cDNA and a 500 nM concentration of each primer. Controls consisted of samples to which no cDNA template had been added or to which original RNA was added. Primers were designed for norB and fhp with Primer Express software (Applied Biosystems, Foster City, Calif.). The PCR primers for norB were CCAATGGCTCCCTGAAATTC and GCCCGACGAAGAGGATCA. The primers for fhp were TGCGCCGCAACTATTCG and TTGACGCTGATGCGGTATTC. Following PCR, relative expression levels were calculated by using 2
CT, where
CT represents the difference between cycling times (CT) for the two samples being compared. The CT is the point at which the PCR cycle crosses the preset logarithmic threshold.
Nonmucoid strain PAO1 strongly upregulates transcription of nitrosative defense genes upon GSNO treatment.
Of the 30 most upregulated genes (upregulated more than threefold, with a P value of <0.05), 12 are involved with metabolizing oxides of nitrogen and 2 have antioxidative functions (Table 1). The most highly upregulated gene, fhp, codes for flavohemoglobin, which oxidatively metabolizes NO· to NO3 by using O2 and NADPH (14) The genes norB and norC code for NO· reductase (Nor), which reductively metabolizes NO· to relatively inert N2O and thus can protect against nitrosative stress. This parallel induction of both nor and fhp is consistent with the physiological need to detoxify NO· as rapidly as possible. Nor, an integral inner membrane protein (32), is well placed to detoxify NO· as it enters bacterial cells, while cytosolic Fhp can act only once NO· has entered the cell. These capabilities can be viewed as providing nitrosative defense throughout the cell. To confirm the microarray analysis, real-time PCR was performed upon fhp and norB. In PAO1, upon GSNO treatment, the fhp and norB gene expression levels were 194- and 23-fold higher than those of the non-GSNO-treated controls, respectively (P < 0.00001). Other classes of genes involved in denitrification were also upregulated; their connections to the metabolic pathways are shown in Fig. 1. For example, moaB1 codes for the synthesis of the molybdopterin cofactor of nitrate reductase, and narK1 codes for a nitrate transporter (32). However, expression of adhC, glutathione-dependent formaldehyde dehydrogenase, which directly metabolizes GSNO and would be expected to be upregulated (16), was in fact not increased (0.8-fold increase; not significant).
View this table:
[in this window]
[in a new window]
|
TABLE 1. Gene expression ratios for 30 most upregulated genes of P. aeruginosa PAO1 and corresponding genes of mucoid strain PAO578II under nitrosative stress with GSNO compared to controls
|
The mucoid strain PAO578II displays limited upregulation of nitrosative defense genes but upregulates pyochelin and other stress proteins.
The mucoid strain PAO578II exhibited a substantially different
pattern of gene activation upon GSNO treatment, with a hallmark
being little or no upregulation of the key nitrosative defense
genes,
nor and
fhp, that are upregulated in PAO1 (Table
1).
This finding was confirmed by real-time PCR analysis of
fhp and
norB. In the mucoid strain PAO578II, upon GSNO treatment
the gene expression ratios for
fhp and
norB were increased 1.15-fold
and decreased 1.9-fold, respectively, over those of the non-GSNO
treated controls (
P < 0.025). The
fhp and
nor genes are already
greatly upregulated in mucoid cells; however, this is not the
case for most of the other genes shown. The reason for this
difference is unclear. The data showing little constitutive
or GSNO-induced upregulation in mucoid strain PAO578II (compared
to that in PAO1) of most genes (excluding
nor and
fhp) involved
in denitrification are in contrast to the expectation that mucoid
P. aeruginosa uses the denitrification pathway in respiration
during mucoid colonization (
30). One potential explanation,
at least for the
nir genes, is that Nir is proinflammatory due
to increased epithelial-cell interleukin-8 production (
18,
21).
The lack of upregulation of
nir is consistent with mucoidy-associated
persistence in the lung and a decrease in the systemic virulence
of most mucoid CF-associated isolates (
31). The pattern of upregulated
genes in PAO578II (Table
2) was quite different from that of
the genes in PAO1. One category of genes showing significant
increases in expression in GSNO-treated mucoid strain PAO578II
was that of the damage control and repair genes
bfr,
groEL,
grpE,
grx,
hslU, and
ohr, which were upregulated 4.3-, 5.2-,
5.4-, 6.1-, 5.6-, and 13.7-fold, respectively. These damage
control and repair genes were not significantly upregulated
in PAO1. Although
nor and
fhp are constitutively upregulated
upon conversion to mucoidy (and hence in PAO578II) (
7), this
upregulation appears insufficient to completely protect against
nitrosative damage; hence, these repair mechanisms are induced.
Another major class of genes upregulated by GSNO in PAO578II
was that of the
pch genes that are involved in synthesis of
the siderophore pyochelin (
22,
24), which were also upregulated
in PAO1 (although only the upregulation of
pchF reached significance
at a
P value of <0.05). In particular,
pchA (whose product
is a rate-limiting step in pyochelin synthesis in
P. aeruginosa)
(
9) is strongly upregulated. Expression of the pyochelin receptor
gene (
fptA) (
1) was also increased 4.6-fold (
P < 0.05). It
is as yet unclear, however, whether this upregulation of
pchF resulted from the known disregulation of iron metabolism caused
by nitrosative stress (
6) or from a metabolic requirement for
iron. Pyoverdin genes were not upregulated significantly in
PAO578II or PAO1 by GSNO.
View this table:
[in this window]
[in a new window]
|
TABLE 2. Gene expression ratios for 30 most upregulated genes of P. aeruginosa PAO578II and corresponding genes of mucoid strain PAO1 under nitrosative stress with GSNO compared to controls
|
Gene expression responses of conversion to mucoidy in PAO578II and of nitrosative defense in PAO1 are essentially independent.
A comparative study of the upregulation by nitrosative stress
and mucoidy (shown for selected genes in Table
3) showed little
cross-correlation between genes induced by mucoidy in PAO578II
(
7) and nitrosative stress. The control pathways involved in
mucoidy and nitrosative defense appear to be essentially independent.
View this table:
[in this window]
[in a new window]
|
TABLE 3. Comparison of gene expression ratios for P. aeruginosa PAO1 and mucoid strain PAO578II under nitrosative stress with GSNO with mucoidy-induced gene expression ratios determined previously for PAO578II
|
Expression of adherence genes is downregulated by nitrosative stress in both PAO1 and PAO578II.
A recent study has shown that NO
· decreases adherence
between
P. aeruginosa and airway epithelial cells (
5). Upon
the onset of nitrosative stress, the expression of several important
adherence genes, including
fliO (
26),
fliD (
2), and several
cupA and
cupB genes (
29), was significantly downregulated in
both PAO1 and mucoid strain PAO578II (Table
4). This downregulation
may explain the decreased adherence, and maximizing this effect
may provide a useful treatment strategy for CF.
View this table:
[in this window]
[in a new window]
|
TABLE 4. Gene expression ratios of potential adhesion-related genes in P. aeruginosa PAO1 and mucoid strain PAO578II under nitrosative stress with GSNO compared to control
|
In vivo NO· consumption analysis.
For the analysis of NO
· consumption, 45 min of GSNO exposure
was used (to allow protein expression from increased mRNA),
followed by centrifugation and resuspension in fresh Luria-Bertani
(LB) medium. NO
· (final concentration, 50 µM) was
added to 1 ml of stirred aerobic culture (3
x 10
8 CFU/ml) in
a glass chamber at 37°C (
20). The NO
· concentration
was measured with a daily calibrated inNO-T system (Harvard
Apparatus, Holliston, Mass.). The baseline NO
· consumption
of mucoid strain PAO578II (14.6 ± 1.1 pmol 10
8 CFU
1 s
1) was significantly higher than that of nonmucoid strain
PAO1 (5.8 ± 4.9 pmol 10
8 CFU
1 s
1), at a
P value of <0.01, in accordance with its higher expression
of
nor and
fhp genes. NO
· consumption was substantially
increased with GSNO treatment for both PAO1 and PAO578II (Fig.
2). This GSNO-induced increase in NO
· consumption was
inhibited in both strains by the protein synthesis inhibitor
tetracycline (Fig.
3). We observed a 15-fold increase in NO
· consumption in PAO1 (from 0 to 105 min) (Fig.
2), consistent
with the microarray data for
nor and
fhp. For mucoid strain
PAO578II, the induction of NO
· consumption by GSNO that
we observed was sixfold higher than that demonstrated by the
microarray data for PAO578II, in which neither
nor nor
fhp genes
were upregulated. This difference may be the result of induction
of an NO
·-consuming system other than Nor or Fhp or of
a posttranscriptional regulation process that increases synthesis
of Nor or Fhp in the absence of increased mRNA.
These data could have implications for our understanding of
P. aeruginosa pathogenesis in individuals with CF. For example,
the limited effectiveness of clinical NO
· or GNSO therapies
for CF (
25,
27) could derive in part from an induction of NO
·-consuming,
nitrosative defense systems, as demonstrated here. While this
induction may explain the failure of these NO
· and GSNO
treatments, our studies with tetracycline suggest that combination
therapy with a protein synthesis-inhibiting antibiotic could
circumvent this problem. Additionally, characterization of NO
· defenses of PAO1 and PAO578II at the protein level could provide
an understanding of the nitrosative defense of clinically important
mucoid strains.

ACKNOWLEDGMENTS
This work was supported by National Institutes of Health grant
AI31139 (to V.D.) and by a microarray supplement (to V.D.) and
a grant (to G.S.T.) from the Cystic Fibrosis Foundation. Microarry
instrumentation was supported by the Keck-UNM genomics core.

FOOTNOTES
* Corresponding author. Mailing address: College of Pharmacy, Toxicology Program, University of New Mexico Health Sciences Center, Albuquerque, NM 87131. Phone: (505) 272-4103. Fax: (505) 272-6749. E-mail:
gtimmins{at}salud.unm.edu.

Supplemental material for this article may be found at http://jb.asm.org/. 

REFERENCES
1 - Ankenbauer, R. G., and H. N. Quan. 1994. FptA, the Fe(III)-pyochelin receptor of Pseudomonas aeruginosa: a phenolate siderophore receptor homologous to hydroxamate siderophore receptors. J. Bacteriol. 176:307-319.[Abstract/Free Full Text]
2 - Arora, S. K., B. W. Ritchings, E. C. Almira, S. Lory, and R. Ramphal. 1998. The Pseudomonas aeruginosa flagellar cap protein, FliD, is responsible for mucin adhesion. Infect. Immun. 66:1000-1007.[Abstract/Free Full Text]
3 - Bogdan, C., M. Rollinghoff, and A. Diefenbach. 2000. Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity. Curr. Opin. Immunol. 12:64-76.[CrossRef][Medline]
4 - Boucher, J. C., H. Yu, M. H. Mudd, and V. Deretic. 1997. Mucoid Pseudomonas aeruginosa in cystic fibrosis: characterization of muc mutations in clinical isolates and analysis of clearance in a mouse model of respiratory infection. Infect. Immun. 65:3838-3846.[Abstract]
5 - Darling, K. E. A., and T. Evans. 2003. Effects of nitric oxide on Pseudomonas aeruginosa infection of epithelial cells from a human respiratory cell line derived from a patient with cystic fibrosis. Infect. Immun. 71:2341-2349.[Abstract/Free Full Text]
6 - D'Autreaux, B., D. Touati, B. Bersch, J. M. Latour, and I. Michaud-Soret. 2002. Direct inhibition by nitric oxide of the transcriptional ferric uptake regulation protein via nitrosylation of the iron. Proc. Natl. Acad. Sci. USA 99:16619-16624.[Abstract/Free Full Text]
7 - Firoved, A. M., and V. Deretic. 2003. Microarray analysis of global gene expression in mucoid Pseudomonas aeruginosa. J. Bacteriol. 185:1071-1081.[Abstract/Free Full Text]
8 - Fyfe, J. A., and J. R. Govan. 1980. Alginate synthesis in mucoid Pseudomonas aeruginosa: a chromosomal locus involved in control. J. Gen. Microbiol. 119:443-450.[Medline]
9 - Gaille, C., C. Reimmann, and D. Haas. 2003. Isochorismate synthase (PchA), the first and rate-limiting enzyme in salicylate biosynthesis of Pseudomonas aeruginosa. J. Biol. Chem. 278:16893-16898.[Abstract/Free Full Text]
10 - Gaston, B., F. Ratjen, J. W. Vaughan, N. R. Malhotra, R. G. Canady, A. H. Snyder, J. F. Hunt, S. Gaertig, and J. B. Goldberg. 2002. Nitrogen redox balance in the cystic fibrosis airway: effects of antipseudomonal therapy. Am. J. Respir. Crit. Care Med. 165:387-390.[Abstract/Free Full Text]
11 - Govan, J. R. W., and V. Deretic. 1996. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol. Rev. 60:539-574.[Abstract/Free Full Text]
12 - Grasemann, H., B. Gaston, K. Fang, K. Paul, and F. Ratjen. 1999. Decreased levels of nitrosothiols in the lower airways of patients with cystic fibrosis and normal pulmonary function. J. Pediatr. 135:770-772.[CrossRef][Medline]
13 - Hart, T. W. 1985. Some observations concerning the s-nitroso and s-phenylsulfonyl derivatives of L-cysteine and glutathione. Tetrahedron Lett. 26:2013-2016.[CrossRef]
14 - Hausladen, A., A. J. Gow, and J. S. Stamler. 1998. Nitrosative stress: metabolic pathway involving the flavohemoglobin. Proc. Natl. Acad. Sci. USA 95:14100-14105.[Abstract/Free Full Text]
15 - Kelley, T. J., and M. L. Drumm. 1998. Inducible nitric oxide synthase expression is reduced in cystic fibrosis murine and human airway epithelial cells. J. Clin. Investig. 102:1200-1207.[Medline]
16 - Liu, L., A. Hausladen, M. Zeng, L. Que, J. Heitman, and J. S. Stamler. 2001. A metabolic enzyme for S-nitrosothiol conserved from bacteria to humans. Nature 410:490-494.[CrossRef][Medline]
17 - Martin, D. W., M. J. Schurr, M. H. Mudd, J. R. W. Govan, B. W. Holloway, and V. Deretic. 1993. Mechanism of conversion to mucoidy in Pseudomonas aeruginosa infecting cystic fibrosis patients. Proc. Natl. Acad. Sci. USA 90:8377-8381.[Abstract/Free Full Text]
18 - Mori, N., K. Oishi, B. Sar, N. Mukaida, T. Nagatake, K. Matsushima, and N. Yamamoto. 1999. Essential role of transcription factor nuclear factor-
B in regulation of interleukin-8 gene expression by nitrite reductase from Pseudomonas aeruginosa in respiratory epithelial cells. Infect. Immun. 67:3872-3878.[Abstract/Free Full Text]
19 - Nathan, C., and M. U. Shiloh. 2000. Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc. Natl. Acad. Sci. USA 97:8841-8848.[Abstract/Free Full Text]
20 - O'Donnell, V., K. Taylor, S. Parthasarathy, H. Kuhn, V. DarleyUsmar, and B. Freeman. 1998. Turnover-dependent consumption of nitric oxide by 15-lipoxygenase: modulation of nitric oxide signalling and 15-lipoxygenase activity. Free Rad. Biol. Med. 25:172.
21 - Oishi, K., B. Sar, A. Wada, Y. Hidaka, S. Matsumoto, H. Amano, F. Sonoda, S. Kobayashi, T. Hirayama, T. Nagatake, and K. Matsushima. 1997. Nitrite reductase from Pseudomonas aeruginosa induces inflammatory cytokines in cultured respiratory cells. Infect. Immun. 65:2648-2655.[Abstract]
22 - Patel, H. M., J. Tao, and C. T. Walsh. 2003. Epimerization of an L-cysteinyl to a D-cysteinyl residue during thiazoline ring formation in siderophore chain elongation by pyochelin synthetase from Pseudomonas aeruginosa. Biochemistry 42:10514-10527.[CrossRef][Medline]
23 - Poschet, J., E. Perkett, and V. Deretic. 2002. Hyperacidification in cystic fibrosis: links with lung disease and new prospects for treatment. Trends Mol. Med. 8:512-519.[CrossRef][Medline]
24 - Quadri, L. E., T. A. Keating, H. M. Patel, and C. T. Walsh. 1999. Assembly of the Pseudomonas aeruginosa nonribosomal peptide siderophore pyochelin: in vitro reconstitution of aryl-4,2-bisthiazoline synthetase activity from PchD, PchE, and PchF. Biochemistry 38:14941-14954.[CrossRef][Medline]
25 - Ratjen, F., S. Gartig, H. G. Wiesemann, and H. Grasemann. 1999. Effect of inhaled nitric oxide on pulmonary function in cystic fibrosis. Respir. Med. 93:579-583.[CrossRef][Medline]
26 - Simpson, D. A., R. Ramphal, and S. Lory. 1995. Characterization of Pseudomonas aeruginosa fliO, a gene involved in flagellar biosynthesis and adherence. Infect. Immun. 63:2950-2957.[Abstract]
27 - Snyder, A. H., M. E. McPherson, J. F. Hunt, M. Johnson, J. S. Stamler, and B. Gaston. 2002. Acute effects of aerosolized S-nitrosoglutathione in cystic fibrosis. Am. J. Respir. Crit. Care Med. 165:922-926.[Abstract/Free Full Text]
28 - Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L. Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer, G. K. Wong, Z. Wu, and I. T. Paulsen. 2000. Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-964.[CrossRef][Medline]
29 - Vallet, I., J. Olson, S. Lory, A. Lazdunski, and A. Filloux. 2001. The chaperone/usher pathways of Pseudomonas aeruginosa: identification of fimbrial gene clusters (cup) and their involvement in biofilm formation. Proc. Natl. Acad. Sci. USA 98:6911-6916.[Abstract/Free Full Text]
30 - Yoon, S. S., R. F. Hennigan, G. M. Hilliard, U. A. Ochsner, K. Parvatiyar, M. C. Kamani, H. L. Allen, T. R. DeKievit, P. R. Gardner, U. Schwab, J. J. Rowe, B. H. Iglewski, T. R. McDermott, R. P. Mason, D. J. Wozniak, R. E. W. Hancock, M. R. Parsek, T. L. Noah, R. C. Boucher, and D. J. Hassett. 2002. Pseudomonas aeruginosa anaerobic respiration in biofilms: relationships to cystic fibrosis pathogenesis. Devel. Cell 3:593-603.
31 - Yu, H., J. C. Boucher, N. Hibler, and V. Deretic. 1996. Virulence properties of Pseudomonas aeruginosa lacking the extreme-stress sigma factor AlgU (
E). Infect. Immun. 64:2774-2781.[Abstract]
32 - Zumft, W. G. 1997. Cell biology and molecular basis of denitrification. Microbiol. Mol. Biol. Rev. 61:533-616.[Abstract]
Journal of Bacteriology, June 2004, p. 4046-4050, Vol. 186, No. 12
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.12.4046-4050.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Van Alst, N. E., Wellington, M., Clark, V. L., Haidaris, C. G., Iglewski, B. H.
(2009). Nitrite Reductase NirS Is Required for Type III Secretion System Expression and Virulence in the Human Monocyte Cell Line THP-1 by Pseudomonas aeruginosa. Infect. Immun.
77: 4446-4454
[Abstract]
[Full Text]
-
Hay, I. D., Remminghorst, U., Rehm, B. H. A.
(2009). MucR, a Novel Membrane-Associated Regulator of Alginate Biosynthesis in Pseudomonas aeruginosa. Appl. Environ. Microbiol.
75: 1110-1120
[Abstract]
[Full Text]
-
Kukavica-Ibrulj, I., Sanschagrin, F., Peterson, A., Whiteley, M., Boyle, B., MacKay, J., Levesque, R. C.
(2008). Functional genomics of PycR, a LysR family transcriptional regulator essential for maintenance of Pseudomonas aeruginosa in the rat lung. Microbiology
154: 2106-2118
[Abstract]
[Full Text]
-
Pullan, S. T., Gidley, M. D., Jones, R. A., Barrett, J., Stevanin, T. M., Read, R. C., Green, J., Poole, R. K.
(2007). Nitric Oxide in Chemostat-Cultured Escherichia coli Is Sensed by Fnr and Other Global Regulators: Unaltered Methionine Biosynthesis Indicates Lack of S Nitrosation. J. Bacteriol.
189: 1845-1855
[Abstract]
[Full Text]
-
Barraud, N., Hassett, D. J., Hwang, S.-H., Rice, S. A., Kjelleberg, S., Webb, J. S.
(2006). Involvement of Nitric Oxide in Biofilm Dispersal of Pseudomonas aeruginosa.. J. Bacteriol.
188: 7344-7353
[Abstract]
[Full Text]
-
Romeo, T.
(2006). When the Party Is Over: a Signal for Dispersal of Pseudomonas aeruginosa Biofilms. J. Bacteriol.
188: 7325-7327
[Full Text]
-
Arai, H., Hayashi, M., Kuroi, A., Ishii, M., Igarashi, Y.
(2005). Transcriptional Regulation of the Flavohemoglobin Gene for Aerobic Nitric Oxide Detoxification by the Second Nitric Oxide-Responsive Regulator of Pseudomonas aeruginosa. J. Bacteriol.
187: 3960-3968
[Abstract]
[Full Text]