Previous Article | Next Article ![]()
Journal of Bacteriology, July 2004, p. 4152-4158, Vol. 186, No. 13
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.13.4152-4158.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Center for Oral Biology, Aab Institute for Biomedical Sciences,2 Department of Microbiology and Immunology, University of Rochester, Rochester, New York 146421
Received 8 January 2004/ Accepted 24 March 2004
|
|
|---|
pH. The results suggest that altered membrane composition can significantly affect the acid survival capabilities, as well as several enzymatic activities, of S. mutans. |
|
|---|
In response to acidification of its environment, the cariogenic organism Streptococcus mutans increases the proportion of monounsaturated membrane fatty acids (19, 33). Using a glucose-shock chemostat model system, we observed that this increase occurs when the organism is allowed to self-acidify through the metabolism of glucose and occurs rapidly over time (19). This shift of membrane composition could be prevented by the addition of the fatty acid biosynthesis inhibitor cerulenin, which in turn, rendered the organism more acid sensitive (19). The significance of monounsaturated membrane fatty acids in low-pH survival of S. mutans UA159 was further explored here.
The enzyme responsible for the generation of monounsaturated membrane fatty acids in S. mutans was unknown. In E. coli, the bacterial model for fatty acid biosynthesis, unsaturated fatty acids are generated through the activity of FabA (13, 36). However, based upon sequence homology searches, FabA was not identifiable in the S. mutans genome (2). Recently, a novel protein was characterized in S. pneumoniae that is capable of isomerizing trans unsaturated bonds to their cis isomers (24). In an extensive biochemical and genetic analysis, the novel enzyme, termed FabM, was shown to be a trans-2, cis-3-decenoyl-ACP isomerase. Using this information, a putative homologue was identified in the S. mutans strain UA159. A mutant with an isogenic mutation in fabM was generated, and its ability to survive acidic pH environments was measured. The inability to produce monounsaturated membrane fatty acids rendered the organism acid sensitive, reiterating the necessity of monounsaturated fatty acids for low-pH survival of S. mutans. Further physiological characterization of the fabM mutant strain demonstrated that altered membrane composition had significant effects on glycolysis, phosphotransferase (PTS) activity, membrane permeability, and F1F0 ATPase activity. Thus, altering membrane fatty acid composition appears to have a significant impact on multiple physiological characteristics and enzymatic activities.
(This work was conducted in partial fulfillment of the Ph.D. requirement of the University of Rochester for E.M.F.)
|
|
|---|
Escherichia coli was maintained on Luria-Bertani agar and supplemented when needed with the following antibiotics: erythromycin, 500 µg ml1; kanamycin, 50 µg ml1; tetracycline, 10 µg ml1; and ampicillin, 100 µg ml1 (Sigma).
DNA manipulations. Chromosomal DNA was isolated from S. mutans as previously described (34). Small-scale DNA preparations were also utilized (15). Plasmid DNA from E. coli was isolated by rapid plasmid preps (11) or with the QIAprep Spin Miniprep kit (QIAGEN, Chatsworth, Calif.). PCR was carried out with Vent DNA polymerase (New England Biolabs). PCR products were isolated and purified via gel electrophoresis as previously described (22). Restriction and DNA-modifiying enzymes were purchased from Invitrogen (Gaithersburg, Md.). E. coli DH10B was transformed by electroporation (22); S. mutans UA159 was transformed by the method of Murchison (29). Colony hybridization of E. coli was performed by standard techniques (34). Southern analysis was performed as previously described (34).
Generation of recombinant S. mutans. Primers were designed to amplify the predicted fabM coding sequence (792 bases) plus additional flanking regions from the UA159 genome (2). Splice-overlap extension PCR (20) was performed to insert a unique BglII site at position +396 of the predicted coding region to allow for insertion of an antibiotic marker. PCR primers (Invitrogen) were designed as follows to amplify the 5' 530-bp portion of the coding region and contained restriction sites as underlined to aid in cloning: NsiFwd (5' ATAAAATGTATGCATTGGAACTTTGATTTTCAAAC 3') and BglRev (5' CATTCACAAAGGCTTGAATAAGATCTGTTTTGTCAC 3'). A 605-bp PCR product containing the carboxyl terminal of the coding sequence and flanking region was generated with the following primers: BglFwd (5' GTGACAAAACAGATCTTATTCAAGCCTTTGTGAATG 3') and EcoRev (5' CACCCACAAAATAGAATTCAATTTATAAGATTACGTA 3'). The two PCR products from the above reaction mixtures were combined (10 ng each), and using the primers NsiFwd and EcoRev, a 1,135-bp amplicon was generated. This resulting product contained a unique BglII site at position +591 (position +396 in the predicted fabM coding sequence). The fabM PCR product was digested with EcoRI and NsiI and cloned into the compatible EcoRI and PstI sites of pBR322, replacing part of the ampicillin cassette (37). E. coli DH10B was transformed with the ligation mix, and transformants were selected by their ability to grow on tetracycline-containing medium. Positive clones were confirmed by sequencing at the Functional Genomics Center at the University of Rochester Medical Center. The resulting plasmid, pBRB3, was linearized with BglII and ligated to an erythromycin cassette from pTS19E (4) containing compatible BamHI ends. This new construct, pBRBErm 4, was used to transform E. coli, and transformants were selected by their ability to grow on erythromycin-containing medium and confirmed by restriction digestion.
(i) fabM mutant generation. UA159 was transformed with pBRBErm 4, and transformants were selected on BHI medium containing erythromycin. Putative mutant strains were confirmed by Southern hybridization. One such strain was designated as S. mutans UR117.
(ii) Complementation of fabM mutant. To confirm that the observed phenotype was due to disruption of fabM and not due to downstream polar effects, a fabM complement strain was generated. A 1,290-bp PCR product was amplified from wild-type UA159 genomic DNA containing 430 bases upstream of the predicted start codon and an additional 68 bases downstream of the predicted stop codon for fabM. Primers were designed as follows and contained SmaI sites as underlined: FabMSmaFwd (5' GATTATTTTGACCCGGGTTTATCGGGAG 3') and FabMSmaRev (5' GCACAATAAAAACCCGGGACATTTTTGTCCC 3'). The resulting PCR product was cloned into the unique SmaI site of pBGK, an S. mutans vector that integrates into the gtfA locus (39). E. coli DH10B was transformed with this ligation mix, and transformants were selected on Luria-Bertani medium contain kanamycin. Positive clones were identified by colony hybridization (34) and subsequent SmaI digestions. Nucleotide sequencing was performed to verify the clone, and the resulting plasmid was designated pMC4-10. S. mutans UR117 was transformed with pMC4-10, and transformants were selected on kanamycin-containing medium. Southern hybridization was performed to confirm integration of pMC4-10 (39), and one such strain was designated as UR119.
Membrane fatty acid determination. The membrane fatty acid content of the cultures was determined by Avanti Polar Lipids, Inc. (Alabaster, Ala.) as previously described (19, 33). Briefly, 100 ml of cultures was grown overnight in TY supplemented with 1% glucose, the appropriate antibiotic, and 10 µg of the indicated fatty acid ml1. Cultures were harvested in the morning by centrifugation. The cells were washed with 25 ml of deionized water and recollected by centrifugation, and pellets were stored at 80°C prior to fatty acid analysis. Two independent cultures per strain or growth condition were assayed.
Total lipids (approximately 5 mg obtained per sample) were extracted by the method of Bligh and Dyer (12). Fatty acid esters were prepared through the addition of 0.2 ml of toluene and 0.4 ml 1% H2SO4 in methanol and heated for 30 min. Fatty acids were extracted via the addition of 1 ml of hexane and 1 ml of H2O. The hexane phase containing the fatty acid esters was evaporated under nitrogen gas. The fatty acid methyl esters were reconstituted in hexane, and gas chromatography was performed, using nitrogen as a carrier gas. Nu-Chek Prep standard 68A was used to determine retention times and then used to determine the identity of fatty acids derived from the strains.
Acid survival. An established acid sensitivity assay (5, 19) was utilized to determine whether the inability to produce monounsaturated membrane fatty acids affected the low-pH survival capabilities of S. mutans. Overnight cultures of S. mutans UA159, UR117, and UR117 supplemented with 10 µg of either cis-vaccenic acid (C18:1) or cis-eicosenoic acid (C20:1) ml1 and UR119 were harvested by centrifugation at 2,500 x g for 10 min. Cell pellets were resuspended in 3 ml of 0.1 M glycine-HCl (pH 2.5) and were continuously stirred for 1 h at room temperature. Aliquots (0.1 ml) of the cell suspension were removed at 0, 15, 30, and 60 min; serially diluted into BHI medium (Difco); and plated in duplicate on BHI agar. UA159 and UR119 plates were incubated 48 h at 37°C, 5% CO2-95% air. All UR117 plates were incubated for 72 h at 37°C in 5%CO2-95% air. Viable cell counts were enumerated and used to calculate log (N/N0).
Proton permeability.
Proton permeabilities were determined by a previously established protocol (9, 23). Briefly, 200-ml cultures of S. mutans UA159, UR119, UR117, and UR117 supplemented with either 10 µg of cis-vaccenic acid (C18:1) or cis-eicosenoic acid (C20:1) ml1 were grown overnight in TY broth with 1% glucose and were harvested by centrifugation for 10 min at 9,000 x g at 4°C. The cells were washed once with 50 ml of 5 mM MgCl2. Cells were suspended at 5 mg ml1 in 20 mM potassium phosphate buffer (pH 7.2)-50 mM KCl-1 mM MgCl2 and incubated for 2 h at 37°C in 5%CO2-95% air. Cells were harvested by centrifugation following this starvation period and resuspended to 20 mg ml1. A 1-ml aliquot of each suspension was titrated to pH 4.7 with either 100 mM HCl-50 mM KCl or 10 mM HCl-50 mM KCl, depending on the pH of the cell suspension. The pH of the cells was then quickly lowered by approximately 0.2 pH units by addition of 10 mM HCl-50 mM KCl. pH values were recorded over time. After 50 min, butanol was added to 10% (vol/vol) to disrupt the cell membranes and allow for equilibrium between the external and cytoplasmic pHs. pH equilibrium was reached 80 min after the start of the experiment. Using the recorded pH values, an estimate of
pH over time could be determined by calculating the pH difference between the time of interest and the 80-min end point. The
pH at 50 min (immediately before butanol addition) is reported in the text. The experiment was done in duplicate with two independent cultures from each strain or growth condition.
Permeabilization of cells. Two-hundred-milliliter cultures were grown overnight in TY with 1% glucose plus the appropriate antibiotic and 10 µg of the indicated fatty acid ml1. The strains were permeabilized as described previously (22) with the following modifications. Briefly, the strains were divided into two 100-ml aliquots and harvested by centrifugation. One aliquot was used to determine dry weight; the other was washed once in membrane buffer (75 mM Tris, pH 7, 10 mM MgSO4). These cells were resuspended in 4 ml of membrane buffer and treated with a 1% final volume of toluene. The suspensions were vortexed for 30 s, placed on ice for 5 min, and subjected to 2 rounds of freeze-thaw. The permeabilized cells were collected by centrifugation, resuspended in 4 ml of membrane buffer, and stored as 100-µl aliquots at 80°C for up to 1 month.
Glycolytic pH drop experiments. Glycolytic minima were determined as described previously (6, 16) with the following modifications. Briefly, overnight cultures were harvested by centrifugation and washed twice with a 50 mM KCl-1 mM MgCl2 salt solution. The cells were resuspended in the salt solution to a final concentration of 10 mg ml1. Aliquots (5 ml) were titrated to a pH of 7.2 by addition of 0.5 M KOH. Glucose was added to a final concentration of 1% (wt/vol), and the pH was monitored continuously for 2 h. After the pH stabilized, approximately 2 h after the addition of glucose, the minimal glycolytic pH was recorded. The results of these experiments represent three independent overnight cultures, each assayed in triplicate.
PEP-dependent PTS assays. Glucose-specific PTS assay conditions were as stated previously (6, 23). Fifty microliters of permeabilized cells was incubated at 37°C for 10 min in 100 mM Tris-maleate (pH 7), 20 mM MgCl2, 40 mM glucose, and 1 mM NaF. Reactions were initiated by the addition of 100 µl of 50 mM phosphoenolpyruvate (PEP). At 0 and 30 min postaddition of PEP, 500-µl aliquots were chilled on ice to stop the reaction. The suspensions were cleared, and the supernatants were assayed for pyruvate content. Two hundred microliters of cleared supernatant was added to 300 µl of double-distilled H2O-500 µl of NADH solution (0.21-mg/ml NADH, 1.5 M Tris, pH 7, 0.021% NaN3). The A350 was recorded. Lactate dehydrogenase (LDH) at 3 µl (3 U/µl) was added, and the mixture was incubated for 5 min. A340 decreases due to the utilization of NADH by LDH. The change in A340 of the 30-min sample versus the zero time point reflects the amount of pyruvate produced and thus the amount of glucose phosphorylated. The data are presented as millimoles of pyruvate produced per minute per milligram of cell dry weight. Results of these experiments reflect data from three independent overnight cultures assayed three times each in triplicate.
ATPase experiments. A previously described ATPase assay (31) was used to measure the release of inorganic phosphate from ATP in permeabilized cells. Thirty microliters of permeabilized cells was incubated with 50 mM Tris-maleate (pH 6)-10 mM MgSO4 for 20 min. ATP was added to final concentration of 5 µM. Released phosphate was measured by the method of Bencini (7, 8) and is expressed as millimoles of Pi per minute per milligram of cell dry weight.
Statistical treatment of data. Student's t test was used to evaluate data in the experiments involving proton-permeability, PTS assays, and ATPase assays.
Nucleotide sequence accession numbers. Nucleotide sequence data reported are available in the Third Party Annotation Section of the DDBJ/EMBL/GenBank databases under the accession number TPA: BK005411.
|
|
|---|
![]() View larger version (76K): [in a new window] |
FIG. 1. (A) ClustalW alignment of predicted sequence of S. mutans UR159 PhaB/FabM with the sequence of S. pneumoniae FabM. (B) Genomic organization of the fatty acid biosynthesis gene cluster of S. mutans. The website used to generate the map was http://www.oralgen.lanl.gov/. The insertion site of the erythromycin resistance cassette into the fabM coding region is indicated. The numbers refer to the nucleotides in the coding region of each gene.
|
|
View this table: [in a new window] |
TABLE 1. Doubling time of S. mutans strains
|
|
View this table: [in a new window] |
TABLE 2. Total membrane fatty acid analysis of wild-type and mutant strains of S. mutans
|
In response to acid challenge, wild-type cells were still viable 60 min after treatment with 0.1 M glycine-HCl, pH 2.5 (Fig. 2). However, UR117, which did not produce detectable levels of monounsaturated membrane fatty acids, yielded no colonies beyond 15 min of treatment. When UR117 was supplemented with either cis-vaccenic acid (C18:1) or cis-eicosenoic acid (C20:1), survivors were observed after 60 min of low-pH treatment. UR119, which had a membrane composition similar to UA159 (Table 2), was also viable after acid challenge. Thus, UR117, which did not produce monounsaturated membrane fatty acids, was more susceptible to extreme acidification than the wild-type organism, and this acid-sensitive phenotype could be relieved through growth of the strain in the presence of exogenous monounsaturated fatty acids or by complementation.
![]() View larger version (14K): [in a new window] |
FIG. 2. fabM mutant strain UR117 does not survive extreme acidification of its environment. Cultures were grown as described in Materials and Methods and treated as described. Shown are averages ± standard deviations of two separate cultures, each performed in duplicate. , wild-type S. mutans UA159; , S. mutans fabM mutant UR117; , UR117 with 10 µg of cis-vaccenic acid ml1; , UR117 with 10 µg of cis-eicosenoic acid ml1; X, S. mutans UR119.
|
The wild-type strain (UA159) and UR119, the complementation strain, lowered the pH of the medium to an approximate value of 3.7 30 min after the addition of glucose (Fig. 3). UR117, at the same time point, had only lowered the pH of the medium to a value of 4.8. However, if UR117 cultures were grown in the presence of exogenous monounsaturated fatty acids, the organism reached a pH value of 4.1 after 30 min, lower than that of the UR117 cultures grown without the addition of monounsaturated fatty acids.
![]() View larger version (17K): [in a new window] |
FIG. 3. Glycolytic profiles of UA159, UR117, UR119, and nutritionally supplemented UR117. Glycolytic pH drops were performed as stated in Materials and Methods. Each strain was grown three separate times, and each overnight culture was assayed in triplicate. The averages ± standard deviations of an overnight culture read in triplicate are shown. , S. mutans UA159; , S. mutans fabM mutant UR117; , UR117 with 10 µg of cis-vaccenic acid ml1; , UR117 with 10 µg of cis-eicosenoic acid ml1; X, S. mutans UR119.
|
Membrane fatty acid composition alters PTS activity. Growth of S. mutans in the presence of exogenously supplied fatty acids has been shown to impact glucose-specific PTS activity (23). This observation was likely due to the incorporation of the exogenous fatty acids into the membrane leading to altered membrane compositions (38), which have, consequently, affected the activities of membrane-bound proteins. The altered membrane composition of UR117 may also have led to changes in glucose-specific PTS activity, which could have impacted the ability of the organism to perform glycolysis under low-pH conditions. In order to address this possibility, we examined the effect of the fabM mutation on glucose-specific PTS activity by using overnight cultures grown in the presence of glucose and 10 µg of either cis-vaccenic acid or cis-eicosenoic acid ml1 (Materials and Methods).
Surprisingly, despite the absence of monounsaturated membrane fatty acids in S. mutans UR117, glucose-PTS activity in this strain was higher than that observed in UA159 or UR119 (Table 3). The activity observed in UR117 was 2.4-fold-higher than that seen in UA159. Supplementing cultures of UR117 with exogenously-supplied fatty acids led to various degrees of activity; UR117 grown in the presence of cis-vaccenic acid (C18:1) had roughly 1.4-fold-higher activity than UA159. When grown in cis-eicosenoic acid (C20:1), UR117 had glucose-specific PTS activity approximately twofold higher than that observed in the wild type. These results suggested that the altered membrane fatty acid composition did not decrease the ability of UR117 to take up glucose and that glucose uptake was not likely responsible for the inability of UR117 to perform glycolysis at pH values as low as those observed for the wild type.
|
View this table: [in a new window] |
TABLE 3. PTS activity of S. mutans strains
|
pH across its membrane, it could account for the observed acid sensitivity phenotype.
We measured the proton permeabilities of cultures of S. mutans strains UA159, UR119, UR117, and UR117 grown in the presence of 10 µg of cis-vaccenic acid or cis-eicosenoic acid ml1 (Materials and Methods). The rise in external pH of UR117 was not as sharp as that seen in UA159 (Fig. 4); thus, the membrane of the mutant was more impermeable to protons. However, when the cells were permeabilized by the addition of 10% butanol at 50 min, UR117 did not reach as high a final pH value as the wild type. UR117 maintained an estimated
pH at 50 min of 0.5 ± 0.04, whereas
pH of UA159 was 0.8 ± 0.01 (statistically different at P < 0.0001). Thus, it appears that the
pH of the mutant strain was not as great as in the wild-type strain.
![]() View larger version (13K): [in a new window] |
FIG. 4. Different proton permeabilities between the fabM mutant strain and the wild type. Proton permeability assays were performed as stated in Materials and Methods. At 50 min, butanol was added to a final concentration of 10% to permeablize the cells and allow for pH to reach equilibrium. The average values ± standard deviations are shown from two independent cultures assayed in duplicate. , wild-type S. mutans UA159; , fabM S. mutans UR117; , UR117 with 10 µg of cis-vaccenic acid ml1; , UR117 with 10 µg of cis-eicosenoic acid ml1; X, S. mutans UR119.
|
pH at 50 min was 0.7 ± 0.03, statistically different (P < 0.0009) from that observed with UR117 grown without supplementation (Fig. 4). However, when grown in the presence of cis-eicosenoic acid (C20:1), the permeability profile of UR117 was similar to that of unsupplemented cultures of UR117, with a very slow rise in the external pH. Likewise, the
pH of UR117 grown in the presence of cis-eicosenoic acid was not as large as seen with UA159; the supplemented strain at 50 min had a
pH of 0.6 ± 0.2, smaller than that observed with UA159.
The rise in the pH of the complement, UR119, was similar to that seen in UA159. However, the
pH at 50 min was only 0.6 ± 0.02, which was smaller than that observed with the wild type. It appears that despite genetic complementation of the mutant, there do exist some differences between the measured proton permeabilities of UR119 and UA159, which may be due to slight alterations in membrane fatty acid composition.
F1F0 ATPase activity levels are influenced by the presence of monounsaturated membrane fatty acids.
One complication involved with measuring proton permeabilities is that the assay does not separate the proton-pumping activity of the F1F0 ATPase from the diffusion of protons across the membrane. The
pH of S. mutans is maintained through the activity of this enzyme (9, 35). Thus, the observed altered proton permeability and
pH of the mutant may be due to differences in the ATPase activity levels.
We found that the ATPase activity levels in UA159 and UR119 were comparable and not statistically different (Table 4). The mutant strain UR117, however, showed significant differences in ATPase activity as compared to the wild type, with the fabM strain having approximately twofold-higher levels of activity. Supplementing UR117 with exogenous monounsaturated fatty acids led to lower ATPase activity levels in comparison to those in unsupplemented cultures, although they were above the wild-type levels. Thus, the altered membrane fatty composition of UR117 did affect the activity of F1F0 ATPase.
|
View this table: [in a new window] |
TABLE 4. ATPase activity of S. mutans strains
|
|
|
|---|
Using results from a recent, elegant study in which the biochemical activity of FabM in S. pneumoniae was examined (24), we were able to identify and disrupt the homologue in S. mutans UA159. The resultant mutant strain was extremely acid sensitive, but the mechanism by which monounsaturated fatty acids protect against acid is not yet understood. It may be possible that unsaturated bonds serve as a sink for protons; this, in conjunction with the activity of the F1F0 ATPase, could serve to protect the cytoplasmic contents from damage during growth under low-pH conditions.
S. mutans must survive low-pH environments because it produces acid via its metabolism of carbohydrates. The inability of the UR117 strain to metabolize glucose at pH values as low as those observed for UA159 may prevent the organism from acid adapting as fully as the wild type; thus, this may render the mutant strain more sensitive to extreme acidification. The simple addition of monounsaturated fatty acids to the growth medium of UR117 increased its ability to carry out glycolysis at low pH levels, most likely due to the incorporation of the fatty acids into the membrane.
Differences in glucose-specific PTS activity were expected, as it has been shown that the presence of exogenously supplied fatty acids can alter the PTS activity of S. mutans (23). Enzyme IIC components of PTS are in the membrane; thus, shifting membrane composition could alter protein interactions and, consequently, affect activity. Despite increased glucose-specific PTS activity in UR117, these cultures were unable to perform glycolysis at pH values as low as UA159. The decreased glycolytic ability of UR117 is likely due to other enzymes further downstream of glucose transport.
The enhanced ATPase activity observed in UR117 was unexpected. The activity of F1F0 ATPase was higher in cells grown under low-pH conditions, where the membrane composition would have larger amounts of monounsaturated fatty acids (5, 19, 33). In addition, we and others have shown evidence of transcriptional regulation of F-ATPase in streptococci during growth at low pH (21, 26). It is possible that the effect of a narrower
pH in UR117 had led to disregulation of the F-ATPase operon. We are currently investigating this possibility.
Differences in the membrane fatty acid composition may have additional effects on the phospholipid composition, peptidoglycan production, and other forms of membrane modifications. In addition, the effects of incorporation of exogenous fatty acids (in nutritionally supplemented strains) on other membrane components and the impact of this on de novo fatty acid biosynthesis, as well as other metabolic activities, are not completely understood. The presence of a putative transcriptional regulator, Smu1592 (2), immediately upstream of fabH leads to speculation of possible fatty acid biosynthesis regulation, which may occur when the organism is grown in an environment rich in fatty acids. Thus, many questions regarding the regulation of fatty acid biosynthesis and how membrane composition alterations may affect other membrane constituents need to be explored further to completely understand our observations.
Currently, our database searches as well as those done previously (24) have indicated that FabM homologues exist only in streptococcal and staphylococcal species, with the exception of a homologue found in the gram-negative bacterium Fusobacterium nucleatum (data not shown). Several recent articles have suggested the development of antibiotics to target fatty acid biosynthesis (13, 25, 30, 32). Bacterial fatty acid biosynthesis is classified as type II, in that each reaction is carried out by a separate enzyme. The fatty acid biosynthesis of eukaryotes, however, is classified as type I, in that all the reactions are carried out by a large enzyme complex (18, 25). The differences between the two fatty acid biosynthesis systems might be exploited, in that new drugs could be designed to target FabM enzymes (i.e., bacterial) that would probably not affect the enzymes used in eukaryotic cells. Thus, there is potential use in developing therapies that target ACP-isomerases, such as FabM.
This work was supported by grants from the NIH, National Institute for Dental and Craniofacial Research DE-11549 and DE-01627. E.M.F. was supported by the Rochester Training Program in Oral Infectious Diseases, T32-DE07165.
|
|
|---|
5 desaturase of Bacillus subtilis. J. Bacteriol. 181:7028-7033.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»