Previous Article | Next Article ![]()
Journal of Bacteriology, August 2004, p. 5202-5209, Vol. 186, No. 16
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.16.5202-5209.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Department of Biology, University of Central Oklahoma, Edmond, Oklahoma 73034,1 Program in Molecular, Cell and Developmental Biology, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma 731042
Received 11 February 2004/ Accepted 5 May 2004
|
|
|---|
|
|
|---|
We report here that the type IV secretion system encoded by the F plasmid can render F+ cells sensitive to certain anionic detergents, including bile salts and sodium dodecyl sulfate (SDS). Type IV secretion systems of gram-negative bacteria are broadly distributed, versatile, macromolecular transporters (9, 10, 12, 29). One subclass of these systems mediates conjugal DNA transfer among bacterial cells or between bacterial and eukaryotic cells. This subclass is distinguished by a requirement for conjugative pili, which are extended surface filaments that mediate the initial cell-cell contact stages of DNA transfer (42).
The type IV secretion system encoded by F is the archetype of one class of conjugal DNA transfer systems (18, 20, 29). Of the 26 F-encoded Tra proteins, 19 localize or are predicted to localize to the cell envelope (inner membrane, outer membrane, or periplasm). Of these, 15 are required for the assembly of functional F pili or to regulate F pilus number and length distributions (18). A 16th gene, traC, is also required for F pilus assembly as a peripheral inner membrane protein (45). A working hypothesis is that these proteins assemble and function in concert at the cell surface to mediate the formation and function of F pili, and presumably DNA transfer as well (24, 46). Such assemblies are probably common to all type IV secretion systems (10, 12), and their composition, structure, and function(s) are of considerable interest.
Previous studies have hinted that the presence of F or F-like R factors sensitizes Escherichia coli to anionic detergents, such as bile salts or SDS, among other compounds (2, 53). In this report, we confirm and extend these observations. We show that F+ strains of E. coli are sensitive to bile salts at concentrations that do not affect isogenic F strains. By genetic criteria, we show that sensitivity can be attributed to genes required for the elaboration of functional F pili. We propose that sensitivity occurs when F pilin secretion transiently opens the cell envelope to the surrounding medium, allowing entry of the anionic detergents. Elsewhere, we have identified the Tra proteins primarily responsible for this activity and have proposed additional features of their structure and function (P. M. Silverman et al., unpublished data).
|
|
|---|
To construct the traB::cat allele used in these studies, the entire traB gene was amplified from strain RD17/pOX38 (tra+) using primers CCTGCCAGCCAAGCTTACTGGCAGG (tra nucleotides [nt] 4175 to 4197) and CATACCGGGCGGGATCCCTGGCACGCC (tra nt 5708 to 5686) (tra nucleotide numbering is from reference 20). HindIII and BamHI sites were introduced into the respective primers. Amplified DNA was digested with both enzymes and cloned into pUC19 also digested with both enzymes. Most of traB was removed from pUCtraB by digestion with NaeI and SphI. Ends were blunted by digestion with mung bean nuclease. The 875-bp cat fragment was isolated from pBR325 (7), digested with TaqI, and blunt ended with Klenow fragment. After ligation, Camr Ampr transformants of AE2086 were isolated and the structure of pUCtraB::cat plasmids was confirmed by restriction digestion and DNA sequence analyses. To cross the traB::cat allele onto F, AE2086/pUCtraB::cat (optical density at 600 nm [OD600] = 0.5) and an equal volume of JC3272/JCFL0 at the same density were incubated together for 60 min at 37°C. One OD unit of AE2248 (thr-34::Tn10) was then added, and incubation continued for an additional 60 min. Tetr Camr Amps Lac+ transconjugants were isolated and tested for complementation by a traB+ plasmid. DNA sequence analysis confirmed the cat insertion in traB, Western blotting failed to detect material cross-reacting with anti-TraB antibodies (24), and donor functions were substantially restored by transformation with a traB+ plasmid.
Bacteria were routinely grown in Luria-Bertani (LB) medium supplemented with antibiotics where appropriate. Cultures were incubated at 37°C in 5 ml of medium using a New Brunswick TC-6 roller drum set at maximum speed. Solid media were prepared with 1.5% agar.
Assays for bile salt and SDS sensitivity. Difco bile salts no. 3 (Becton-Dickinson and Co., Sparks, Md.) and individual bile salts (Sigma Chemical Co., St. Louis, Mo.) were prepared in water as 10 or 25% solutions (wt/vol) and filter sterilized. SDS (10%, wt/vol) was prepared the same way. Appropriate dilutions (2.5 ml) were distributed in test tubes with an equal volume of 2x LB medium. Overnight cultures were diluted to about 104 cells/ml, and 0.1 ml was added to each tube. Cultures were incubated for 18 h before the OD600 was read. In some figures, data were normalized to the OD of the culture incubated without bile salts or SDS.
To compare plating efficiencies, overnight cultures were diluted and 0.1-ml aliquots of the appropriate dilutions were spread on agar plates containing bile salts no. 3 at the levels indicated for individual experiments.
Antibiotic sensitivity. Overnight cultures were used to prepare agar overlays, as for a bacteriophage assay. Antibiotic disks (BD-BBL, obtained from Fisher Scientific Corp.) were placed on the surface, and the plates were incubated for 18 h at 37°C.
ß-Lactamase leakage. Leakage was estimated by cross-protection and serial dilution assays (6). Cross-protection was determined by transforming appropriate strains with pUC18 DNA and selecting for ampicillin-resistant (100 µg of ampicillin/ml) transformants. Areas around transformant colonies were inspected for satellite colonies of sensitive cells. Relative ß-lactamase activity in culture supernatants was estimated on lawns of ampicillin-sensitive bacteria (JC3272). Disks containing 10 µg of ampicillin were deposited on agar overlays of JC3272 bacteria. Immediately thereafter, dilutions of culture supernatants (30 µl) were deposited on the disks. After overnight incubation at 37°C, the plates were inspected to determine the highest dilution that gave complete resistance. The transition from resistance to sensitivity occurred over a twofold dilution of a given sample.
|
|
|---|
In the course of these experiments, we noticed that as the bile salt concentration was increased, the colony size of uninfected HfrH became smaller. We did not observe the same effect of bile salts no. 3 on the F strain. These observations suggested that F itself might sensitize cells to bile salts independently of filamentous DNA bacteriophage infection. Yoshida et al. (53) earlier reported that cells with an R factor were more sensitive to cholate than R cells.
Differential effect of bile salts no. 3 on F+ and F strains of E. coli. We first tested F strain JC3272 and the same strain carrying JCFL0, an F' lac plasmid. Both the strain and the plasmid were used in the earliest genetic studies of F tra genes (1, 26, 52) and in many other studies since. We observed that, whereas the plating efficiency and colony size of JC3272 were unaltered as a function of bile salt concentration up to at least 2.5%, the plating efficiency of the same strain with JCFL0 diminished drastically with increasing bile salt levels (Fig. 1). At 2% bile salts no. 3, the plating efficiency was reduced 4 orders of magnitude, comparable to that of M13-infected HfrH.
![]() View larger version (17K): [in a new window] |
FIG. 1. Plating efficiencies of E. coli F strain JC3272 ( ) and the F' lac+ tra+ strain JC3272/JCFL0 ( ) as a function of bile salts no. 3 concentration.
|
0.5% (Fig. 2). Note, however, that the sensitivity of this assay is only about 100-fold, whereas plating efficiency can detect much greater differences (Fig. 1).
![]() View larger version (14K): [in a new window] |
FIG. 2. M13 infection and F independently sensitize E. coli JC3272 to bile salts no. 3 in liquid culture. , JC3272; , AE2086/M13K07; , JC3272/JCFL0.
|
The differential effects of bile salts no. 3 on strains with and without F or F-like R factors depended upon both the strain and the plasmid. We first tested F and JCFL0 derivatives of the strain CC118 (34) by the liquid growth assay. CC118/JCFL0 responded to increasing bile salt concentrations much like JC3272/JCFL0 (data not shown). However, CC118 itself grew poorly at bile salt concentrations of >0.75%. Consequently, the differential effects of bile salts no. 3 were not as dramatic as with JC3272. We note that some E. coli K-12 strains have accumulated mutations in efflux pumps that would alter their resistance to agents such as bile salts (43). This might also be true of CC118, though we have not explored this possibility further.
We also tested strain AE2086 with the F-like R factor R100 and its derepressed derivative, R100drd1 (4). The R100 derivative was as resistant to bile salts no. 3 as AE2086 itself over the range of 0 to 2%. The R100drd1 derivative was more sensitive, but only to about 50% growth inhibition at 0.75% bile salts (Fig. 3). At higher levels, the effect of bile salts no. 3 on the R100drd1 strain paralleled that on the R100 strain. These data suggest population heterogeneity, perhaps owing to loss of R100drd1 in the absence of antibiotics to select for plasmid retention during incubation in bile salts no. 3. Yoshida et al. (53) reported that Hfr derivatives of several R+ strains were more sensitive to cholate than the same strains with the R factors as autonomous plasmids, also suggesting that bile salts strongly selected for cells that had lost the R factor.
![]() View larger version (14K): [in a new window] |
FIG. 3. Effect of bile salts no. 3 on strain AE2086 with R100 or the derepressed mutant R100drd1 in liquid culture. , AE2086/R100; , AE2086/R100drd1.
|
|
View this table: [in a new window] |
TABLE 1. Effect of tra mutations on sensitivity to bile salt mix
|
Assay by growth in liquid (data not shown) largely confirmed the data obtained based on plating efficiency, except the traE mutant was more sensitive in liquid than would be expected from its plating efficiency. In any case, the sensitivity of F+ strains to bile salts no. 3 can be attributed to the expression of the F tra genes required for F pilus formation or function, including traA, the F pilin structural gene.
To determine if tra genes directly involved in the later stages of DNA transfer are also required for bile salt sensitivity, we tested the effect of plasmid pTG801. This plasmid contains all the tra genes required for F pilus formation but lacks nearly all the tra genes required for the later stages of DNA transfer (21). Consequently, pTG801 cells are Tra but elaborate F pili visible by electron microscopy and are sensitive to bacteriophage that adsorb to F pili (21). In strain M1174, pTG801 caused a dramatic increase in bile salt sensitivity compared with M1174 itself. The saturation OD of M1174 grown in LB medium containing 2% bile salts no. 3 was 85% of that when the cells were grown without bile salts (OD600 = 1.34 and 1.63, respectively), similar to results with the JC3272 parent strain. In contrast, M1174 containing pTG801 grew to a saturation OD of 0.71 in the absence of bile salts but failed to grow (OD600 < 0.01) in the presence of 0.25% (or higher) bile salts no. 3. We conclude that the bile salt sensitivity of tra+ strains does not require donor activities specifically related to DNA transfer, all of which cells with pTG801 lack (21), but instead reflects the function of the F-encoded type IV secretion system specifically as it relates to the F pilus assembly pathway.
Bile salt specificity. The preceding experiments all utilized a commercial bile salt mixture (see Materials and Methods). We therefore separately tested the unconjugated bile salts cholate and deoxycholate and the conjugated salts glycocholate and taurocholate. In addition to JC3272 and JC3272/JCFL0, we tested E. coli K-12 strains A529 (tolA529) and D21f2 (rfa-1 rfa-3). tolA is part of the tolQRA cluster at 17 min on the E. coli genetic map (50). A mutation in any of the tolQRA/tolB/pal genes of E. coli leads to profound functional defects in the outer membrane, manifested by hypersensitivity to bile salts, among other agents, and leakage of periplasmic proteins into the medium (38, 50). In addition, the TolA protein acts as a secondary receptor for filamentous DNA bacteriophages that bind initially to the tips of F pili, are drawn to the cell surface as the filaments retract, and there interact with the TolA protein via the bacteriophage pIII protein before infection can be completed (13, 16, 17, 27, 30). Conceivably, F-encoded Tra proteins might also interact with TolA, even in the absence of bacteriophage, in such a way as to render cells partial TolA phenocopies. If so, any bile salt selectivity should be similar for the tolA mutant and JCFL0 cells.
Strain D21f2 is a deep rough mutant whose lipopolysaccharide (LPS) lacks heptose and other LPS oligosaccharides that require heptose for their addition (40). Deep rough mutants are sensitive to various hydrophobic compounds, including bile salts, to which E. coli is normally resistant (40).
Both JC3272/JCFL0 and A529 cells failed to grow in liquid medium at 0.4% deoxycholate (Fig. 4A). However, with the other three bile salts, the sensitivities of the two strains diverged. With cholate and especially with taurocholate and glycocholate, JC3272/JCFL0 cells were more resistant than A529, whereas there was little difference in taurocholate and glycocholate sensitivities between the F and F+ strains except at the highest bile salt concentration used, 1.6% (Fig. 4B to D). These data argue against the hypothesis that F+ strains are simply TolA phenocopies.
![]() View larger version (27K): [in a new window] |
FIG. 4. Effects of different bile salts on F, F+, and tolA mutant cells in liquid culture. , JC3272 (F); , JC3272/JCFL0; , A529 (tolA529). (For deoxycholate sensitivity, the data points for the JC3272/JCFL0 and A529 strains overlap.).
|
|
View this table: [in a new window] |
TABLE 2. Bile salt selectivity of the traW546 mutant
|
![]() View larger version (16K): [in a new window] |
FIG. 5. Effects of different bile salts on the deep rough strain D21f2 in liquid culture. , cholate; , glycocholate; , taurocholate. Under the same conditions, D21, the rfa+ parent strain of D21f2, was inhibited 13, 28, and 42% at 1.6% taurocholate, glycocholate, and cholate, respectively.
|
![]() View larger version (11K): [in a new window] |
FIG. 6. F' lac sensitizes cells to the anionic detergent SDS. , JC3272 (F); , JC3272/JCFL0.
|
We also compared JC3272/JCFL0 and A529 for leakage of periplasmic enzymes by cross-protection and by a semiquantitative ß-lactamase assay (6). The two strains and JC3272 itself were transformed with pUC19 and plated on LB containing ampicillin (100 µg/ml). Under these conditions, leakage of periplasmic ß-lactamase, encoded by pUC19, hydrolyzes ampicillin in the vicinity of the transformant, allowing nearby sensitive cells to grow. The result is the formation of satellite colonies. Such colonies clearly surrounded A529 transformants but neither JC3272 nor JC3272/JCFL0 transformants (Fig. 7). We also estimated the relative amounts of ß-lactamase in cell-free supernatants by the serial dilution assay described in Materials and Methods. The amounts of enzyme accumulated in cultures of JC3272 and JC3272/JCFL0 were indistinguishable from each other and at least fourfold less than the amount in cultures of A529.
![]() View larger version (106K): [in a new window] |
FIG. 7. Leakage of ß-lactamase by cross-protection. Cells were transformed with pUC19, and ampicillin-resistant transformants were selected as described in Materials and Methods. (A) JC3272; (B) JC3272/JCFL0; (C) A529 (tolA529). Note the ampicillin-sensitive satellite colonies around the A529 transformants but neither the JC3272 nor the JC3272/JCFL0 transformants.
|
|
|
|---|
The bile salt sensitivity of F+ strains cannot be attributed to one or a few Tra proteins. Though cells overproducing bacteriophage f1 gene III protein are bile salt sensitive (6), F pilin is the only Tra protein sufficiently abundant to have comparable effects (41). In fact, the traA1 mutant, which contains no F pilin, was bile salt resistant. However, mutations in tra genes required for the assembly of F pili, or affecting F pilus number or length distributions, also reduced bile salt sensitivity. Several of these tra mutants were shown in previous studies to contain apparently normal membrane F pilin levels (37). Based on these data, we attribute the bile salt sensitivity of F+ strains to the functioning of the multicomponent type IV secretion system encoded by F. Moreover, the sensitivity of cells containing pTG801, which elaborate functional F pili but lack tra genes required for late stages of conjugal DNA transfer (21), indicates that sensitivity is related to F pilin secretion and not to DNA transfer itself.
Other macromolecular secretion systems may, under certain conditions, similarly alter the permeability of gram-negative bacteria. Daugelavicius et al. (15) reported that cells overexpressing plasmid RP4 genes roughly comparable to the F genes required for F pilus formation were more permeable than RP4 cells or cells with a complete RP4 conjugative transfer system expressed at normal levels. They attributed the permeability differences to active cell surface complexes of RP4 proteins, of which their cells contained about 80 each. F-encoded Tra proteins are also organized into surface complexes (24), though fewer than the corresponding RP4 proteins (Silverman et al., unpublished). More recently, Chen et al. (11) described a mutation in the Neisseria spp. pilQ gene that permeabilized mutant cells to several compounds, including heme, hydrophobic antibiotics, and nonionic detergents. PilQ is a member of the secretin superfamily required as an outer membrane complex for type IV pilus formation.
If, as we argue, the bile salt sensitivity of F+ strains requires active F pilin secretion, filament formation itself may not be essential. The traW546[Am] mutant, which was hypersensitive to cholate relative to a tra+ control, essentially lacked F pili visible by electron microscopy (33). While traW546 cells might still produce very short F pili (4), this in itself is not sufficient for bile salt sensitivity. Other mutants, such as those with the traH80 or traF13 alleles, may also produce very short filaments (4) but in the present study were nearly as resistant to bile salts as F cells. Wild-type F pilin when overproduced (22) or certain mutant F pilins (32) do appear in the medium in forms other than filaments, suggesting that F pilin secretion might occur in the absence of filament formation.
Our data suggest a mechanism for F pilin secretion formally similar to the two-stage mechanisms proposed for bacterial type I secretion systems (47) and tripartite efflux pumps (28, 54, 56). Specifically, we propose that F pilus assembly occurs at Tra protein complexes that form a channel through the cell envelope. In our hypothesis, the channel would normally be closed to the exterior, opening transiently only in the presence of F pilin. This could occur during F pilus assembly from inner membrane F pilin or during F pilus disassembly (retraction). In either case, the open state would allow molecules of suitable size and chemistry to enter from the outside, thereby bypassing the otherwise intact outer membrane permeability barrier.
In this model, the TraW protein might mediate channel dynamics. In the absence of TraW, the channel would remain open longer than normal, accounting for the hypersensitivity of the traW mutant to cholate. Additionally, the failure to close at normal intervals (or at all) could limit the rate at which the channel complex delivered inner membrane F pilin for F pilus assembly, or it could favor F pilus retraction over assembly. Either effect would account for the drastically reduced length of F pili on traW mutant cells (4, 33).
This implies that the outer membrane permeability barrier of F+ strains should be largely intact. The similar effects of both hydrophobic and hydrophilic antibiotics on isogenic F+ and F cells as well as measurements of ß-lactamase leakage indicate that this is so. Moreover, the effects of different bile salts on F+ strains could be distinguished from their effects on D21f2, a deep rough LPS mutant whose sensitivity to lipophilic compounds is expected to reflect the ability of such compounds to pass through biological membranes (39, 40). We showed that D21f2 sensitivity was directly related to bile salt pKa and hence to the fraction of uncharged bile salt at neutral pH. This was not the case for F+ strains, which were similarly resistant to both glycocholate (pKa = 4.4) and taurocholate (pKa = 1.4). One possibility is that the larger sizes of the conjugated bile salts relative to cholate contribute to the differential effects of individual bile salts on F+ strains. Based on the crystal structures of the bile salts (3, 25, 31, 49), and not considering cations or bound water, a channel with a diameter of
6 to 8 Å could exclude taurocholate and glycocholate, or retard their passage, but allow entry of cholate. F pili themselves are hollow cylinders with a cationic lumen of
20 Å (19, 42) and are therefore unlikely to discriminate by size alone among the bile salts tested. Rather, bile salts and perhaps similar compounds may be useful as probes to investigate the structure and function of the type IV secretion apparatus encoded by F.
This work was supported by National Science Foundation grant MCB-212365, the Oklahoma EPSCoR Infrastructure Improvement Award, and the Research Office of the University of Central Oklahoma. P.M.S. acknowledges support from the Marjorie Nichlos Chair in Medical Research.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»