This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freede, P.
Right arrow Articles by Brantl, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freede, P.
Right arrow Articles by Brantl, S.

 Previous Article  |  Next Article 

Journal of Bacteriology, September 2004, p. 6254-6264, Vol. 186, No. 18
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.18.6254-6264.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Transcriptional Repressor CopR: Use of SELEX To Study the copR Operator Indicates that Evolution Was Directed at Maximal Binding Affinity

Peggy Freede and Sabine Brantl*

Biologisch-Pharmazeutische Fakultät, AG Bakteriengenetik, Friedrich-Schiller-Universität Jena, Jena, Germany

Received 27 April 2004/ Accepted 18 June 2004


arrow
ABSTRACT
 
CopR is one of the two copy number control elements of the streptococcal plasmid pIP501. It represses transcription of the repR mRNA encoding the essential replication initiator protein about 10- to 20-fold by binding to its operator region upstream of the repR promoter pII. CopR binds at two consecutive sites in the major groove of the DNA that share the consensus motif 5'-CGTG. Previously, the minimal operator was narrowed down to 17 bp, and equilibrium dissociation constants for DNA binding and dimerization were determined to be 0.4 nM and 1.4 µM, respectively. In this work, we used a SELEX procedure to study copR operator sequences of different lengths in combination with electrophoretic mobility shift assays of mutated copR operators as well as copy number determinations to assess the sequence requirements for CopR binding. The results suggest that in vivo evolution was directed at maximal binding affinity. Three simultaneous nucleotide exchanges outside the bases directly contacted by CopR only slightly affected CopR binding in vitro or copy numbers in vivo. Furthermore, the optimal spacer sequence was found to comprise 7 bp, to be AT rich, and to need an A/T and a T at the 3' positions, whereas broad variations in the sequences flanking the minimal 17-bp operator were well tolerated.


arrow
INTRODUCTION
 
Replication of the streptococcal plasmid pIP501 is regulated by two components that act in concert: the transcriptional repressor CopR (10.6 kDa) and the antisense RNA RNAIII (136 nucleotides [nt]) (5). Whereas RNAIII exerts its inhibitory effect by premature termination (attenuation) of the essential repR mRNA (6, 8), CopR has a dual function. On the one hand, it represses transcription from the essential repR promoter pII about 10- to 20-fold (7); on the other hand, it prevents convergent transcription from pII and pIII (antisense promoter), thereby indirectly increasing transcription initiation at pIII (9). Previously, it was found that CopR contacts the DNA asymmetrically at two consecutive major grooves that share the consensus motif 5'-CGTG (28). Thus, the outermost G residues were found to be most important for CopR binding, whereas exchanges of nucleotides adjacent (3') to the CGTG motif only slightly altered DNA binding. The operator sequence was narrowed down to 17 bp. Furthermore, it was found that CopR binds exclusively as a dimer, and the equilibrium dissociation constants for the CopR dimers and the CopR-DNA complex were calculated to be 0.4 nM and 1.4 µM, respectively (29). A three-dimensional model of the N-terminal 63 amino acids of CopR was built and was used to identify amino acids involved in DNA binding and dimerization (30, 31, 32). By this means, it was found that amino acids R29 and R34, located in the recognition helix (helix III) of the helix-turn-helix motif, make specific contacts to the DNA at G240 (binding site I) and G254 (binding site II) or G242/T243 (site I) and G251 (site II), respectively. Water-mediated contacts were suggested for E35 interacting with the outermost C residues in both binding sites. Unspecific DNA contacts via the sugar-phosphate backbone were proposed for K10 in {alpha}-helix I and S28 in the recognition helix (30). Furthermore, it was established that the structured acidic C terminus of CopR that forms a ß-strand is necessary for stabilization of the protein (22, 23). A fluorescence energy study revealed that CopR bends the operator DNA slightly (20 to 25°) upon binding, and it was proposed that two pyrimidine-purine dinucleotide steps in the operator sequence that are separated by one helical turn are required for bendability (33). With all these data on hand, we asked whether the copR operator found in nature (on plasmid pIP501) was optimized for strong DNA binding or whether it would be possible to find an operator that is bound more efficiently by CopR and, if so, how such an operator would function in copy number control in vivo.

In 1990, the SELEX procedure was developed independently by two laboratories (13, 36). This procedure uses randomized sequences (DNA or RNA) to select for different criteria, like binding of certain proteins or small metabolites or the ability to perform enzymatic reactions, followed by PCR amplification and further rounds of selection. SELEX not only yielded impressive results that supported the RNA world hypothesis, e.g., selection of RNA molecules that were able to carry out templated RNA polymerization (21) or amino acylation of tRNAs (24) or selection of high-affinity RNA ligands to parasite target molecules (18), but was also employed successfully to study a broad variety of protein-DNA interactions. Examples of the uses of SELEX include the in vitro selection of binding sites for the Escherichia coli trp repressor (12), methionine repressor MetJ (19), integration host factor (IHF) (17), a response regulator of Bradyrhizobium japonicum (14), and bacteriophage Ff gene 5 protein, a single-strand binding protein (37). Consensus sequences for a UP element for bacterial promoters (15) or for embryonic heat shock factor 2 (25) were defined. Furthermore, sequence requirements for efficient termination of conjugation in the oriT gene of E. coli plasmid R1162 were determined (2), and the promoter discrimination between {sigma}s and {sigma}70 RNA polymerases of E. coli was investigated (16). SELEX revealed an unusual DNA binding mode for TRF1, a key player of telomere length regulation (3). In the case of proteins that do not seem to recognize strongly defined consensus sequences, like topoisomerase II, in vitro evolution identified preferred DNA cleavage sites (10). Additionally, SELEX was used for applicative purposes like the selection of DNA aptamers against human immunodeficiency virus type 1 RNase H that display in vitro antiviral activity (1). All these examples demonstrate the power of in vitro selection for the analysis of DNA-protein interactions.

To answer the questions mentioned above, we applied the SELEX procedure with copR operator sequences of different lengths in combination with electrophoretic mobility shift assays (EMSAs) with mutated operator fragments, copy number determinations, and in vitro transcription. Our results demonstrate that in vivo evolution of the copR operator sequence was directed at maximal binding affinity. Furthermore, we defined sequence and length requirements for the spacer and regions adjacent to the two binding sites.


arrow
MATERIALS AND METHODS
 
DNA preparation, manipulation, and copy number determination. Plasmid DNA was isolated from Bacillus subtilis as reported previously (5). DNA manipulations such as restriction enzyme cleavage and ligation were carried out under the conditions specified by the manufacturer or according to standard protocols (26). A PCR kit from Roche was used for PCR amplifications. DNA sequencing was performed according to the dideoxy chain termination method (27) with a Sequenase kit from Amersham Bioscience. Copy numbers of pIP501 derivatives in B. subtilis were determined as described previously (5), except that gel photographs were scanned and band intensities were quantified with the PCBAS 2.0 program.

Construction of E. coli-B. subtilis shuttle vectors containing mutations in the copR operator. Plasmid pPRC333 containing the wild-type copR operator region was constructed as follows. First, a PstI site was created at position 582 (4) to facilitate the subsequent construction of mutations in the leader region; a BamHI/PstI fragment spanning nt 160 to 582 was obtained by PCR on pPR1 as a template by using the primer combinations shown below and inserted into the pUC19 BamHI/PstI vector, resulting in plasmid pUC333. The BamHI/PstI fragment of plasmid pUC333 and the PstI/EcoRI fragment of plasmid pUCR3 (20) were jointly cloned into the pPR4 BamHI/EcoRI vector (5), yielding plasmid pPRP333. Subsequently, the copR gene was inserted as a 549-bp EcoRI fragment derived from plasmid pCOP1B2 (7) into the unique EcoRI site of plasmid pPRP333, and the plasmid containing copR in the same direction as the repR gene was designated pPRC333. All PCR-generated fragments were confirmed by sequencing.

Mutated operator sequences were constructed by the same procedure using the following primers in combination with primer SB214 (5'-TAG AAG CTA CGA TCA AAG TTG AA): pPRC333-SB333 (5'-AATTGGATCCGATTTCGTGTGAATAATGCA), pPRC334-SB334 (5'-AATTGGATCCGATTTCGTGCGAATAATGCACGAAATCATT), pPRC221-SB221 (5'-AATTGGATCCAAAAGCAATGATTTCGTGTCCCCCCCGCACGAAATCATTGCTTAT), pPRC222-SB222(5'-AATTGGATCCAAAAGCAATGATTTCGTGTGAAAAAAAGCACGAAATCATTGCTTAT), pPRC227-SB227 (5'-AATTGGATCCGATTTCGTGTGAAAAATGCACGAAATCATTGCTTAT), pPRC228-SB228 (5'-AATTGGATCCGATTTCGTGTGAATTAATGCACGAAATCATTGCTT), pPRC292-SB292 (5'-AATTGGATCCGATTTCGTGTGGGGGGGCACGAAATCATTGCTTAT), pPRC294-SB294 (5'-AATTGGATCCGATTTCGTGTGAATAATACACGAAATCATTGCTTA), and pPRC416-SB416 (5'-AATTGGATCCGATTTTGTGCATGTATTGGACGAAATCATTGCTTATTTT).

Construction of lacZ fusion vectors and determination of ß-galactosidase activity. Plasmids pUC333 (wild type), pUC334 (symmetric operator), and pUC221 (spacer with 7C) were used for the isolation of EcoRI/HindIII blunt fragments comprising promoter pII with the upstream copR operator region, promoter pIII, attenuator, and 130 bp downstream (Table 1). These fragments were inserted into the EcoRI/BamHI blunt vector pAC6 (34) to generate transcriptional fusions with the promoterless lacZ gene. The resulting vectors, pAC333, pAC334, and pAC221, were linearized with ScaI, and the corresponding lacZ fusions were integrated into the amyE locus of the B. subtilis chromosome of strain DB104 by double crossover. To provide CopR in trans, the corresponding integrant strains were transformed with plasmid pCOP9 (5), and Cmr Pmr transformants were selected. These strains were used for the determination of ß-galactosidase activity as described previously (7).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Plasmids used in this study

Construction of vector pBTYC11 for overexpression and purification of native CopR. A promoterless copR gene generated by PCR with primers SB203 (5'-GGT GGT TGC TCT TCC AAC ATG GAA CT GCA TTT AGA GAA) and C-951-30 (5'-GAA TTC CTG CAG TCA CAC GAA ATC ATT GCT) on plasmid pCOP7C as a template and subsequently digested with SapI and PstI was inserted into vector pTYB11 (New England Biolabs) digested with the same pair of enzymes. E. coli strain TG1 was used for transformation of the ligation mixture, and Ampr transformants were screened for the presence of recombinant pTYB11. The resulting vector was designated pTYBC11, and the inserted copR gene was confirmed by sequencing. In pTYBC11, the N-terminal codons of CopR are fused to the intein tag and hence the C-terminal codons of the chitin binding domain. Expression strain ER2566 (IMPACT-CN protein purification system; New England Biolabs) was transformed with pTYBC11 and used for the overexpression of native CopR.

Preparation of labeled wild-type and mutant CopR targets. Oligodeoxyribonucleotides listed in Table 6 were 5' end labeled with [{gamma}-32P]ATP (26) and purified from 8% denaturing polyacrylamide gels. Double-stranded CopR targets were generated in a Klenow reaction with oligodeoxyribonucleotide SB176 (5'-CCC CTT AAA AAA ATA AGC) and, in the case of SB414, SB417, and SB418, oligodeoxyribonucleotide SB415 (5'-TCGCTGAACATTCGATCTA) as primers.


View this table:
[in this window]
[in a new window]
 
TABLE 6. Oligodeoxyribonucleotides used in the gel shift analyses

Overexpression and purification of His6 CopR and native CopR. Plasmid pQEC1 was used for overexpression and purification of His6 CopR as described previously (28, 29). For the preparation of native CopR, strain ER2566 (pTYBC11) was used. After induction with IPTG (isopropyl-ß-D-thiogalactopyranoside) at an optical density at 560 nm of 1.0, the strain was grown at 12°C overnight until an optical density at 560 nm of 1.8 to 1.9 was reached, to prevent the accumulation of insoluble protein. Afterwards, cells were pelleted and sonicated. The supernatant was centrifuged at 4°C for 10 min at 13,000 rpm in a Beckman J2-21M centrifuge, bound with chitin for 40 min at 4°C with constant stirring, and subsequently filled into a column. After two washing steps, self-cleavage of the fusion proteins by the intein domain was induced by the addition of 50 mM dithiothreitol in a buffer containing 500 mM NaCl and 20 mM Tris-HCl (pH 9.0) and incubation at room temperature for 16 h. Afterwards, the native CopR protein was eluted with 500 mM NaCl and 20 mM Tris-HCl (pH 8.0), and the first two 250-µl fractions containing native CopR were stored with glycerol (final concentration, 50%) at –20°C.

CopR-DNA binding reaction and band shift assay. Binding reactions were performed in a final volume of 20 µl containing 0.5x Tris-borate-EDTA (TBE) buffer (pH 8.0), 0.9 nM of end-labeled DNA fragment, and 3 to 150 nM His6 CopR. Herring sperm DNA (0.1 µg/µl) was added as a nonspecific competitor. After incubation at 30°C for 30 min, the reaction mixtures were separated on 8% native polyacrylamide gel runs at room temperature for 1.5 h (16 V/cm) in 0.5x TBE buffer. Visualization and quantification of the bands were performed on a Fuji PhosphorImager. In some cases, 75 mM NaCl was included in the reaction mixture, the gel, and the electrophoresis buffer.

In vitro selection (SELEX) procedure. To generate double-stranded templates for SELEX I, SELEX II, and SELEX IV, between 8 and 333 pmol of the following 61-bp oligodeoxyribonucleotides containing random sequences flanked by fixed regions were used as templates in a primer extension reaction employing an 18-bp primer, SB179 (5' GAT GCA TGG ATC CAT GAT), complementary to the 3' end of randomized DNA pools: SB206 (I) [5'-ACAGGAAACAGCTATGACCATGATTACGCCGATGGAATTCAAGCTTAATGATTTCGTGT(N7)GCACGAAATCATGGATCCATGCATCACTGGCCGTCGTTTTACAACGTC-GTGACTG], SB265 (II) [5'-ACAGGAAACAGCTATGACCATGATTACGCCGATGGAATTCAAGCTTAATGATTT(N17)AAATCATGGATCCATGCATCACTGGCCGTCGTTTTACAACGTCGTGACTG], SB369 (III) [5'-TACGGTAACTGGACTGCATAACGATGCATTTGACTCATTCAAGCTTCATCCATA(N30)TAGTCGTGGATCCTTGACATGACAGGTATGTAGTCATAAGCACTTAGCAA], and SB330 (IV) [5'-ACAGGAAACAGCTATGACCATGATTACGCCGATGGAATTCAAGCTTAAT(N5)CGTGTGAATAATGCACG(N5)ATGGATCCATGCATCACTGGCCGTCGTTTTACAACGTC-GTGACTG].

For construction of the double-stranded randomized DNA pool for SELEX III, instead of SB179, primer SB370 (5'-ATG TCA AGG ATC CAC GAC) was used. Subsequently, the DNA pools were amplified by PCR with primers SB223 (5'-CAG TCA CGA CGT TGT AAA ACG ACG GCC AGT GAT GCA TGG ATC CAT GAT) and SB224 (5'-ACA GGA AAC AGC TAT GAC CAT GAT TAC GCC GAT GGA ATT CAA GCT TAA TG) in the cases of SELEX I, II, and IV and primers SB371 (5'-TAC GGT AAC TGG ACT GCA TAA CGA TGC ATT TGA CTC ATT CAA GCT TCAT C) and SB372 (5'-TTG CTA AGT GCT TAT GAC TAC ATA CCT GTC ATG TCA AGG ATC CAC GAC) in the case of SELEX III. Primers carry an overhang to obtain longer PCR products (121 bp for SELEX I, II, and IV and 134 bp for SELEX III). After phenol-chloroform extractions and ethanol precipitation, the PCR products were 5' end labeled with 10 µCi of [{gamma}-32P]ATP. The radioactively labeled DNA fragments were purified from 8% native polyacrylamide gels, visualized by phosphorimaging, excised, eluted two times in elution buffer containing 1 mM EDTA (pH 8.0), 500 mM NaAc, 10 mM MgAc, and 0.1% sodium dodecyl sulfate for 1 h at 50°C, and precipitated with ethanol afterwards.

Binding reactions were performed in a final volume of 20 µl containing the labeled DNA fragment and 84 nM His6 CopR in 0.5x TBE buffer. In all cases, incubation without His6 CopR was used for comparison. As a reference for the excision of the shifted CopR target, which was not visible in the first round of selection with SELEX II and III, primers with wild-type operator sequence but that were the same length as the SELEX primer were used in each SELEX experiment and treated in the same way (Klenow reaction, PCR amplification, labeling, and EMSA). After round 3 of each SELEX procedure, a 0.6 µM wild-type DNA fragment (KS1) (28), which has no binding sites for amplification primers, was added as a competitor in each binding reaction to promote selection towards a high-affinity and high-specificity pool. After 30 min at 30°C, bound and unbound DNA species were separated on 8% native polyacrylamide gels at 230 V. Band shifts were detected by phosphorimaging. The bound species were excised and eluted in elution buffer (see above) followed by phenol-chloroform extractions to remove the CopR protein and ethanol precipitation.

The recovered bound ligand sequences were dissolved in water and subsequently PCR amplified by using primers SB225 (5'-CAG TCA CGA CGT TGT AAA) and SB226 (5'-ACA GGA AAC AGC TAT GAC) for SELEX I, SELEX II, and SELEX IV products and primers SB372 (5'-TAC GGT AAC TGG ACT GCA) and SB374 (5'-TTG CTA AGT GCT TAT GAC) for SELEX III products. Twenty cycles of PCR amplification were performed for 30 s each at 95, 52, and 72°C. PCR products were phenol-chloroform extracted and precipitated with ethanol followed by 5' labeling as described above. These steps were repeated 10 times. After the 10th round of SELEX, amplification products were digested with BamHI and HindIII and inserted into the pUC19 BamHI/HindIII vector. After transformation of E. coli strain TG1, the DNA of individual white transformants was sequenced.

In vitro transcription with B. subtilis RNA polymerase. Linear templates for in vitro transcription were generated by PCR from the corresponding pUC derivatives pUC333, pUC334, pUC294, pUC292, pUC221, and pUC228 with primer SB214 and the universal sequencing primer and gel purified. In vitro transcription assays were performed in a final volume of 20 µl containing 60 mM Tris HCl (pH 7.8), 12 mM MgCl2, 1 mM dithiothreitol, and 1 ng of different linear DNA templates as well as 200 µM (each) ATP, GTP, and CTP; 20 µM UTP; 5 µCi of [{alpha}-32P]UTP; and 240 ng of native CopR. After incubation at 30°C for 15 min, 0.5 µl of B. subtilis RNA polymerase (0.24 µg) was added, and the incubation continued at 30°C for 30 min. Transcription was stopped by phenol-chloroform extraction and ethanol precipitation, and the products were dissolved in water and 50% formamide loading dye, heat denatured for 5 min at 95°C, and separated on a 6% denaturing polyacrylamide gel. Dried gels were analyzed and quantitated in a Fuji PhosphorImager.


arrow
RESULTS AND DISCUSSION
 
Use of SELEX to study the spacer region reveals two consensus positions at the 3' end. To answer the question of whether there are any sequence preferences in the spacer region between the two CopR binding sites, in a first SELEX approach (SELEX I), an operator sequence that was randomized at the 7-bp spacer region but that contained wild-type binding sites I and II was used. The SELEX experiment was started with 8 pmol of the randomized sequence, which corresponds to {approx}2.9 x 109 copies of every possible sequence, and this pool was amplified by PCR prior to labeling as described in Materials and Methods. As expected, a shifted band was already visible in round 1 (Fig. 1). After round 10, the selected DNA fragments were amplified by PCR, digested with BamHI and HindIII, and inserted into the pUC19 vector. Twenty-eight clones were sequenced, and the results are shown in Table 2. In all but one case, spacers were found with an A or T at position 6, and in all but two cases, a T in position 7 flanked by otherwise random sequences in positions 1 to 5 was found. However, all spacers were AT rich, with only three of them having more than two G or C residues.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 1. In vitro selection (SELEX) with four different randomized sequences. Autoradiograms of the EMSAs in the 10th round of in vitro selection are shown for all four randomized targets used in the SELEX I to IV experiments. Bound DNA fragments were excised and, after removal of CopR, were PCR amplified and subcloned into pUC19 to obtain individual operator fragments for sequencing as described in Materials and Methods.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Sequences selected with SELEX I (N7)

The results of SELEX I show that an optimal spacer region should comprise 7 bp, be AT rich, and contain preferably an A or a T in position 6 and a T in position 7. This is in agreement with a previous fluorescence resonance energy transfer study which revealed a slight (20 to 25°) bend of the copR operator region upon binding of the CopR protein (33). We argued that two pyrimidine-purine steps one helical turn apart might be required for flexibility and hence bendability. SELEX I seems to confirm this argument; one of these pyrimidine-purine steps is at the boundary between the spacer and binding site II and requires the T in position 7 of the spacer which indeed was also found with SELEX II (see below) and found to be a T or C in 9 of 14 sequenced clones by SELEX III (see below). The other pyrimidine-purine step is provided by T241 and G242 in binding site I, which was not found to be altered in any SELEX-derived sequence.

Use of SELEX to study a randomized 17-mer sequence selects both the asymmetric wild-type operator sequence and an operator sequence with perfect symmetry. To find out whether binding sites that are bound more efficiently by CopR than by the wild-type operator exist, a randomized sequence of 17 bp, the minimal wild-type operator length, was used in the SELEX II experiment. This SELEX II experiment was started with 20 pmol of the randomized sequence, corresponding to {approx}700 copies of every possible sequence, which was PCR amplified and labeled prior to selection (see above). Selection was performed for the first three rounds without a competitor, and after a shifted band emerged in round 3 (Fig. 1), the nonlabeled wild-type operator was added as a competitor and seven additional rounds of selection were performed. After 10 rounds, selected fragments were cloned into the pUC19 vector as described above, and 24 independent clones were sequenced. The results (Table 3) show that all selected sequences contained wild-type binding sites I and II. Furthermore, the 3' nucleotide of binding site I, which is a T in the wild-type site, was in 17 of 24 sequences replaced by a C, making both binding sites perfectly symmetric. Such a perfectly symmetric operator sequence with T243C (Fig. 2), termed KS9, had been analyzed previously (28) and was found to be bound at least as efficiently as the wild-type sequence. Our three-dimensional model of the N-terminal 63 amino acids of CopR (30) predicts that this nucleotide position in binding site I is contacted by R34 of the recognition helix (Fig. 2) and that the contact would be stronger with a C instead of a T.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Sequences selected with SELEX II (N17)



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 2. Wild-type copR operator sequence. Binding sites I and II are boxed, and the consensus binding motif 5'-CGTG is highlighted in boldface type. The –35 box and the –10 box of the repR promoter pII are shown in italics. Arrows indicate nucleotides contacted specifically by the corresponding amino acids (shown in the one-letter code) of the recognition helix of CopR. Dashed lines indicate water-mediated contacts. The minimal operator sequence comprises 17 bp, i.e., binding sites I and II with their spacer regions.

Interestingly, the spacer regions of all 24 clones were AT rich (in 22 of 24 cases, ≤2 G's or C's were found) and contained a T in position 7 and, in 18 cases, an A in position 6. The latter data are in agreement with the results described above.

Use of SELEX to study a 30-mer sequence selects the symmetric and the asymmetric wild-type operator sequence and a novel sequence with three nucleotide exchanges. Since in vitro selection of a 17-bp randomized sequence neither allows extended spacer lengths to be found nor is able to obtain any information on the variability of the flanking sequences, a randomized 30-mer sequence was used in a third SELEX (SELEX III) experiment. This experiment was started with 333 pmol (8 µg) of randomized oligodeoxyribonucleotide SB369, which was PCR amplified and labeled prior to selection. Here, in round 4, a bound fraction appeared, and the next rounds were again performed in the presence of a competitor sequence. After 10 rounds, 14 independent clones were sequenced as described above. Table 4 presents the results. Interestingly, whereas the asymmetric wild-type binding sites in two cases (numbers 1 and 4) and the symmetric binding sites in one case (number 13) were found to be similar to those in SELEX II, the other 11 clones contained binding sites with one (number 5), two (numbers 2 and 3), three (numbers 6, 7, 8, 10, 11, 12, and 14), or even four (number 9) nucleotide exchanges. One of these exchanges was the C in position 243 found in the symmetric wild-type operator by SELEX II. However, the other exchanges were within the consensus binding motif 5'-CGTG (Fig. 2). In binding site I, the C in wild-type position 239 was replaced by a T, and in binding site II, the C in wild-type position 252 was altered to a G (Fig. 3). Additionally, in one case (number 9), the G in position 255 was replaced by an A. These results were surprising, since previous mutations in binding sites I and II seemed to suggest that the four positions of the consensus motif (5'-CGTG) cannot be altered without significant loss of binding affinity (28; unpublished data).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Sequences selected with SELEX III (N30)a



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 3. Comparison of binding sites of all SELEX III sequences to those of the wild type. Nucleotide positions different from those of the wild type (shown in boldface type) are underlined. See Table 4 for sequences determined by SELEX III. sy, symmetric operator sequence; WT, wild-type sequence on complementary strand.

Although several other operators in addition to the symmetric and the asymmetric wild-type operator with two, three, or even four nucleotide exchanges were found, these exchanges did not affect nucleotides for which direct covalent contacts with amino acids in the recognition helix of the CopR proteins were proposed (Fig. 2).

With regard to the selected spacer sequences, the results of SELEX I and II for an AT-rich spacer and the necessity of T in position 6 were confirmed, whereas in position 7, a C was found in five cases. Interestingly, no alterations of the spacer length were selected; i.e., neither an 8-bp nor a 6-bp spacer emerged. The flanking sequences could not be analyzed in sufficient detail, since the binding sites were found in the 5' portion in some cases and in the 3' portion of the randomized 30-mer sequence in other cases.

The 5' and 3' flanking sequences of binding sites I and II can vary widely. In order to obtain information on the sequences flanking binding sites I and II, a fourth SELEX (SELEX IV) experiment was performed using a 17-bp wild-type operator with a randomized 5-bp spacer region on either side. This SELEX was started with 200 pmol of randomized sequence, corresponding to {approx}115 x 106 copies of every sequence variant which were PCR amplified and labeled prior to selection. As expected, a shifted band was visible from SELEX round 1, and after 10 rounds of selection (rounds 4 to 10 with a wild-type competitor), fragments were cloned and 14 clones were analyzed by sequencing. Table 5 shows clearly that no specific sequences are preferred either 5' or 3' of binding sites I and II, respectively. Even the AT content does not seem to play a role in these regions.


View this table:
[in this window]
[in a new window]
 
TABLE 5. Sequences selected with SELEX IV (N5-5)a

Binding curves of mutated copR operators confirmed the SELEX results. Four independent SELEX experiments yielded a set of data concerning binding sites, the spacer region, and surrounding regions of the copR operator. However, no information was obtained about the ability of an 8-bp spacer to bind CopR or about the importance of the pyrimidine-purine dinucleotide steps within the operator regions for efficient binding. In this context, binding efficiencies for spacers comprising exclusively A or T residues or, on the other hand, only G or C residues were of interest, even when such spacers were not selected in vitro. Furthermore, the exchange of single nucleotides such as those found in the mutated operator selected with the SELEX III experiment within the consensus regions and their effects on binding of CopR should be investigated. A comparison of binding curves of operators found with SELEX II and SELEX III should enable us to estimate whether CopR complexes with the selected operator sequences indeed had the same or even lower equilibrium dissociation rate constants as those with the wild-type operator, i.e., if an operator sequence was selected that is bound more tightly by the repressor.

For this purpose, gel shift assays were performed with the mutated operator sequences listed in Table 6. The corresponding binding curves are shown in Fig. 4, and the calculated Kd values for the CopR operator complexes are shown in Table 7.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 4. Binding curves with mutated operator sequences. (A) Autoradiograms of the EMSAs with the wild type and the indicated mutated targets are shown. Below each autoradiogram, the lowest and highest concentrations of purified His6-tagged CopR used in the experiments are indicated. In the case of SB189, SB198, and SB199, the protein was added to the DNA, complex formation was allowed for 30 min, and the complexes were subsequently loaded onto the gel at different time points (0, 20, and 30 min). Consequently, the autoradiograms show the complexes after 40, 20, and 10 min (left, center, and right, respectively) of migration through the native polyacrylamide gel. A significant portion of the protein-DNA complexes dissociate during gel electrophoresis, indicating unstable complex formation. (B) Binding curves of the wild type and mutated targets. These binding curves were used for the calculation of the Kd values of the CopR-DNA complexes (as described in reference 29) shown in Table 7.


View this table:
[in this window]
[in a new window]
 
TABLE 7. Equilibrium dissociation rate constants of mutated copR operators

With regard to the spacer region, three important results were obtained. First, an 8-bp spacer sequence did not prevent CopR binding; however, only unstable complexes were formed (Fig. 4A). On the other hand, a 6-bp spacer did not allow CopR binding (data not shown). Second, the alteration of a pyrimidine-purine step within the spacer did not affect binding. Third, spacers composed of only A's or T's were bound equally well and comparable to those of the wild-type. In contrast, spacers comprising only C's or G's were bound with significantly lower efficiency (10- to 15-fold lower). These results are in correlation with the SELEX I experiment, where AT-rich spacers were selected, and in correlation with SELEX III, where only 7-bp spacers were found.

A comparison of binding constants of asymmetric and symmetric operators as selected with SELEX II demonstrated that the Kd value of the latter one (former KS9) (28) was twofold lower than that of the asymmetric wild-type operator; i.e., this operator was bound slightly more efficiently than the wild-type operator. This is most probably the reason why the symmetric operator was selected with SELEX II in the majority of the cases. The mutated operator selected with SELEX III (SB414) yielded a Kd value that was threefold higher than that of the asymmetric wild-type operator. A mutated operator containing only one of the two mutations within the 5'-CGTG motif (SB417) bound CopR almost as efficiently as the wild-type with a Kd of 0.6 nM.

Exchanges of other single nucleotides in binding site I or II impaired or prevented CopR binding or led to unstable complexes that dissociated during electrophoretic separation, as was found for SB198 and SB199 containing nucleotide exchanges in positions 241 and 242 of binding site I, respectively (Fig. 4A). Such exchanges were not found with SELEX II or III. The importance of the G's in positions 240 and 254 had been demonstrated before (28). G-to-A exchanges at these two positions abolished binding or decreased the binding affinity drastically.

Copy numbers of pIP501 derivatives demonstrated that selection in vivo (evolution) was directed at maximal binding efficiency. A set of pIP501 derivatives was constructed to evaluate the effects of mutated operator sequences on copy number control in vivo. The corresponding plasmids were introduced into B. subtilis strain DB104 by transformation, and copy numbers were determined (Fig. 5 and Table 8).



View larger version (58K):
[in this window]
[in a new window]
 
FIG. 5. Copy number determination of pIP501 derivatives with mutated operator sequences. BamHI-linearized aliquots of undiluted plasmid DNAs separated on 1% agarose gels were prepared from 1-ml culture volumes of B. subtilis strains containing wild-type or mutant pIP501 derivatives grown to the same optical density in late logarithmic phase. In all cases, four to six transformants grown in parallel were used for plasmid preparations. Gel photos were scanned and quantified by using PCBAS 2.0 software. The results are shown in Table 8.


View this table:
[in this window]
[in a new window]
 
TABLE 8. Comparison of copy numbers of wild-type and mutant pIP501 derivatives in B. subtilis

A comparison of the copy numbers of plasmids pPRC333 (wild type) and pPRC334 (T243C symmetric operator) shows that in vivo, a symmetric and an asymmetric operator are equally efficient in regulation and that the slight differences (twofold) in the Kd values do not result in significant effects. In contrast, the copy number of pPRC416 carrying three mutations, the T243C and 1-bp exchanges in binding sites I and II, was about threefold higher, which was in correlation with the Kd value that was threefold higher than that of the asymmetric wild-type and a Kd value even sixfold higher than that of the symmetric wild-type operator, and hence, CopR binding was slightly impaired. From these data, it can be concluded that evolution in vivo was directed at maximal binding. A direct correlation between binding and regulation was also apparent from the analysis of the other symmetric operator variant and supported the importance of G251 in binding site II; the 3- to 4-fold-higher Kd value of KS3 was accompanied by a 2.8-fold-higher copy number of pPRC294, i.e., impaired regulation in vivo.

Some of the pIP501 derivatives that carried mutations in the spacer region showed somewhat unexpected results. Whereas pPRC228 that has an 8-bp spacer, for which unstable binding was observed, replicated at a 1.5-fold-higher copy number than pPRC333, and pPRC derivatives with only A or T residues in the spacer behaved like those of the wild type, pPRC292 carrying only G residues and pPRC221 carrying only C residues replicated at even lower copy numbers than did the wild type, which was in strong contrast to the calculated 16- or 10-fold-higher Kd values that indicated significantly impaired binding. Stacking effects within the spacer region or supercoiling effects (see below) might be responsible for this unexpected behavior.

In vitro transcription with B. subtilis RNA polymerase confirmed the in vivo data. In order to find out whether the unexpected results of the copy number determinations with only G or C spacers were due to interaction effects with RNA polymerase, in vitro transcription experiments were performed with B. subtilis RNA polymerase in the presence or absence of purified native CopR. Figure 6 demonstrates that repression was performed equally well for the wild type and the T243C mutation (KS9), which coincides with the results of the EMSAs and in vivo copy number determinations (Table 8). For G251A (KS3), a four- to five-fold-lower repression effect was found, which again was in correlation with the results of the EMSA (Kd fourfold higher than that for the wild-type) and copy number determination ({approx}2.8-fold-higher copy numbers) (Table 8). On the other hand, an operator with only C in the spacer region behaved like the wild type with only 7% transcriptional read-through upon CopR binding. This coincides with the copy number regulation, which was also like that of the wild type. Here, factors other than simple binding apparently play a role, since the 10-fold-higher Kd value indicates that binding of CopR is significantly impaired. The same holds true for the operator with the spacer with G only, which is only 2-fold worse in repression in the in vitro transcription assay and even shows an approximately 2-fold-lower copy number than that of the wild type but has a 16-fold-higher Kd value significantly impaired in CopR binding. As the reasons for these discrepancies, supercoiling effects cannot be excluded, which are not considered in EMSA or SELEX, where linear templates are used. The operator with an 8-bp spacer showed about a fourfold decrease in repression, in line with the formation of an unstable complex in the EMSA (Fig. 4A).



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 6. In vitro transcription with DNA fragments containing mutated copR operators. In vitro transcription in the presence or absence of native CopR was performed with B. subtilis RNA polymerase as described in Materials and Methods. Above the lanes, the mutations in the operator sequences are indicated. RNAIIF, full-length RNAII (to the end of the used DNA template fragment), RNAIIT, terminated RNAII terminated at the attenuator. Bands were quantitated after phosphorimaging with the PCBAS 2.0 program, and the percentage of read-through in the presence of CopR was calculated (shown below the gel). WT, wild type; M, marker.

LacZ fusions indicate that discrepancies between Kd values and copy numbers are due to supercoiling effects. To analyze the role of supercoiling for repression in vivo versus that of repression in vitro (EMSA, SELEX, and in vitro transcription), transcriptional lacZ fusions of the repR promoter pII containing either wild-type or mutated operators were constructed and integrated into the amyE locus of the B. subtilis chromosome. Resulting B. subtilis integrant strains DB104::pAC333 (wild type), DB104::pAC334 (T243C, symmetric operator), and DB104::pAC221 (7C spacer) were transformed with plasmid pCOP9 to provide CopR in trans, and ß-galactosidase activities were determined as described previously (7). The results are shown in Table 9. A comparison of ß-galactosidase activities determined in the absence and presence of CopR revealed different degrees of repression. In the wild-type case (pAC333), about 17-fold repression was observed, whereas the repression effect was slightly higher (23-fold) in the case of pAC334 containing the symmetric operator which was selected with SELEX II. This result is in agreement with the calculated copy numbers, which were identical in both cases, and indicates that the twofold difference in the Kd values determined with linear templates is overcome by the supercoiling effect on a circular template in vivo. For pAC221 comprising the 7C spacer region, lacZ values in the absence of CopR were about 2.5-fold lower than those of pAC333 and pAC334. This finding suggests that the C-rich spacer region upstream of the –35 box of pII might lower the transcription efficiency by the RNA polymerase. On the other hand, the four- to sixfold-lower repression effect compared to those of the wild-type and symmetric operator was in accordance with the calculated 10-fold-higher Kd value for this operator determined with EMSA. Apparently, supercoiling effects are responsible for the decrease of the expected (from the Kd values) difference in repression. With these data, the surprising discrepancies between Kd values and copy numbers for the 7C spacer variant could be explained. The results of the lacZ measurements indicate that efficient binding in vivo is affected by supercoiling and that the copy numbers are influenced by both the Kd value and supercoiling effects.


View this table:
[in this window]
[in a new window]
 
TABLE 9. ß-Galactosidase activities of chromosomal lacZ fusionsa

Evolutionary considerations. One instrument to adjust the copy number of pIP501 is the Kd value of the CopR operator complex. Evolution of the copR operator in vivo apparently resulted in a low copy number of the corresponding plasmid pIP501 (approximately 5 copies). This copy number, however, is not the lowest that can be obtained, as shown with pPRC221 and pPRC292. However, in these two cases, copy numbers are lower than those of the wild-type, since the mutated pII promoters with C- or G-rich upstream regions are less efficient than the wild-type promoter per se (see above), and the reduced repression effect on these weak promoters due to high Kd values of the mutated Cop operator complexes is, in a supercoiled context, still sufficient to decrease replication efficiency slightly below the wild-type level.

As demonstrated previously with a series of pIP501 derivatives, there seems to be both an upper and a lower limit for copy numbers found in vivo since no derivative could be constructed that replicated at more than 50 to 100 copies/cell with B. subtilis as one of its gram-positive hosts (5). When pIP501 evolved in its original host, Streptococcus agalactiae, which was living under certain physiological conditions, selection was apparently for low, but not the lowest possible, copy number, which proved to be optimal under the environmental conditions encountered by this host. This finding is supported by the independent in vivo selection of three different (but identical in the binding sites) operators of the three representatives of the inc18 family of streptococcal plasmids that replicate via the theta mechanism in a broad range of gram-positive bacteria (4): pIP501, pSM19035, and pAMß1. These plasmids are 97% identical on the nucleotide level, and their replication regions reveal the same modular structure: 5' cop gene, rep gene, and origin. The cop genes (copR [pIP501], copF [pAMß1], and copS [pSM19035]) encode almost identical proteins that differ only in a few amino acids in the C terminus. Furthermore, the cop operators contain identical binding sites I and II (11, 35). The only differences between the copR and copS operators are found in the spacer region (G244A and T247A) and between the copR and copF operators in the regions flanking the binding sites (T236G and A260G). These data suggest that during evolution, identical Cop binding sites emerged in three independent plasmids. The results of SELEX I, EMSAs with spacer mutations, and copy number determinations with pPRC227 (T247A) confirmed that the two positions in the spacer region that are different in the copS operator are not required for efficient binding or regulation in vivo. Additionally, the results of SELEX IV demonstrated that the sequences of the flanking regions of the cop operator can vary widely so that the differences between copR and copF operator are negligible, too.

In summary, in vitro selection of the copR operator proved to result in the same sequences as those found with in vivo selection and demonstrated that evolution was directed at maximal binding affinity. From our experience, SELEX may be, at least in the case of simple transcriptional repressors, a powerful method to answer evolutionary questions.


arrow
ACKNOWLEDGMENTS
 
We thank E. Birch-Hirschfeld (Institut für Virologie, Jena) for synthesizing the oligodeoxyribonucleotides; Margarita Salas, Madrid, Spain, for kindly providing us with purified B. subtilis RNA polymerase; and Nadja Heidrich (AG Bakteriengentik) for the purification of native CopR.

This work was supported by grants BR1552/4-2 and BR1552/4-3 from the Deutsche Forschungsgemeinschaft (to S.B.).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Friedrich-Schiller-Universität Jena, Biologisch-Pharmazeutische Fakultät, AG Bakteriengenetik, Hans-Knoll-Str. 2, Jena D-07745, Germany. Phone 49-3641-657507. Fax: 49-3641-657520. E-mail: Sabine.Brantl{at}rz.uni-jena.de. Back


arrow
REFERENCES
 
    1
  1. Andreola, M.-L., F. Pileur, C. Calmels, M. Ventura, L. Tarrago-Litvak, J.-J. Toulmé, and S. Litvak. 2001. DNA aptamers selected against the HIV-1 RNase H display in vitro antiviral activity. Biochemistry 40:10087-10094.[CrossRef][Medline]
  2. 2
  3. Becker, E. C., and R. J. Meyer. 2000. Recognition of oriT for DNA processing at termination of a round of conjugal transfer. J. Mol. Biol. 30:1067-1077.
  4. 3
  5. Bianchi, A., R. M. Stansel, L. Fairall, J. D. Griffith, D. Rhodes, and T. de Lange. 1999. TRF1 binds a bipartite telomeric site with extreme spatial flexibility. EMBO J. 18:5735-5744.[CrossRef][Medline]
  6. 4
  7. Brantl, S., D. Behnke, and J. C. Alonso. 1990. Molecular analysis of the replication region of the conjugative Streptococcus agalactiae plasmid pIP501 in Bacillus subtilis. Comparison with plasmids pAMß1 and pSM19035. Nucleic Acids Res. 18:4783-4790.[Abstract/Free Full Text]
  8. 5
  9. Brantl, S., and D. Behnke. 1992. Copy number control of the streptococcal plasmid pIP501 occurs at three levels. Nucleic Acids Res. 20:395-400.[Abstract/Free Full Text]
  10. 6
  11. Brantl, S., E. Birch-Hirschfeld, and D. Behnke. 1993. RepR protein expression on plasmid pIP501 is controlled by an antisense RNA-mediated transcription attenuation mechanism. J. Bacteriol. 175:4052-4061.[Abstract/Free Full Text]
  12. 7
  13. Brantl, S. 1994. The CopR protein of plasmid pIP501 acts as transcriptional repressor at the essential repR promoter. Mol. Microbiol. 14:473-483.[Medline]
  14. 8
  15. Brantl, S., and E. G. H. Wagner. 1994. Antisense RNA-mediated transcriptional attenuation occurs faster than stable antisense/target RNA pairing: an in vitro study of plasmid pIP501. EMBO J. 13:3599-3607.[Medline]
  16. 9
  17. Brantl, S., and E. G. H. Wagner. 1997. Dual function of the copR gene product of plasmid pIP501. J. Bacteriol. 179:7016-7024.[Abstract/Free Full Text]
  18. 10
  19. Burden, A. D., and N. Osheroff. 1999. In vitro evolution of preferred topoisomerase II DNA cleavage sites. J. Biol. Chem. 274:5227-5235.[Abstract/Free Full Text]
  20. 11
  21. Ceglowski, P., R. Lurz, and J. C. Alonso. 1993. Functional analysis of pSM19035-derived replicons in Bacillus subtilis. FEMS Microbiol. Lett. 109:145-150.[CrossRef][Medline]
  22. 12
  23. Czernik, P. J., D. S. Shin, and B. K. Hurlburt. 1994. Functional selection and characterization of DNA binding sites for trp repressor of Escherichia coli. J. Biol. Chem. 269:27869-27875.[Abstract/Free Full Text]
  24. 13
  25. Ellington, A. D., and J. W. Szostak. 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346:818-822.[CrossRef][Medline]
  26. 14
  27. Emmerich, R., P. Strehler, H. Hennecke, and H.-M. Fischer. 2000. An imperfect inverted repeat is critical for DNA binding of the response regulator RegR of Bradyrhizobium japonicum. Nucleic Acids Res. 28:4166-4171.[Abstract/Free Full Text]
  28. 15
  29. Estrem, S. T., T. Gaal, W. Ross, and R. L. Gourse. 1998. Identification of an UP element consensus sequence for bacterial promoters. Biochemistry 95:9761-9766.
  30. 16
  31. Gaal, T., W. Ross, S. T. Estrem, L. H. Nguyen, R. R. Burgess, and R. L. Gourse. 2001. Promoter recognition and discrimination by E{sigma}S RNA polymerase. Mol. Microbiol. 42:939-954.[CrossRef][Medline]
  32. 17
  33. Goodman, S. D., N. J. Velten, Q. Gao, S. Robinson, and A. M. Segall. 1999. In vitro selection of integration host factor binding sites. J. Bacteriol. 181:3246-3255.[Abstract/Free Full Text]
  34. 18
  35. Göringer, H. U., M. Homann, and M. Lorger. 2003. In vitro selection of high-affinity nucleic acid ligands to parasite target molecules. Int. J. Parsitol. 33:1309-1317.
  36. 19
  37. He, Y.-Y., P. G. Stockley, and L. Gold. 1996. In vitro evolution of the DNA binding sites of Escherichia coli methionine repressor, MetJ. J. Mol. Biol. 255:55-66.[CrossRef][Medline]
  38. 20
  39. Heidrich, N., and S. Brantl. 2003. Antisense-RNA mediated transcriptional attenuation: importance of a U-turn loop structure in the target RNA of plasmid pIP501 for efficient inhibition by the antisense-RNA. J. Mol. Biol. 333:917-929.[CrossRef][Medline]
  40. 21
  41. Johnston, W. K., P. J. Unrau, M. S. Lawrence, M. E. Glasner, and D. P. Bartel. 2001. RNA-catalyzed RNA polymerization: accurate and general RNA-templated primer extension. Science 292:1319-1325.[Abstract/Free Full Text]
  42. 22
  43. Kuhn, K., K. Steinmetzer, and S. Brantl. 2000. Transcriptional repressor CopR: the structured acidic C terminus is important for protein stability. J. Mol. Biol. 300:1021-1031.[CrossRef][Medline]
  44. 23
  45. Kuhn, K., K. Steinmetzer, and S. Brantl. 2001. Transcriptional repressor CopR: dissection of stabilizing motifs within the C terminus. Microbiology 147:3387-3392.[Abstract/Free Full Text]
  46. 24
  47. Lee, N., Y. Bessho, K. Wei, J. W. Szostak, and H. Suga. 2000. Ribozyme-catalyzed tRNA aminoacylation. Nat. Struct. Biol. 7:28-33.[CrossRef][Medline]
  48. 25
  49. Manuel, M., M. Rallu, M.-T. Loones, V. Zimarino, V. Mezger, and M. Morange. 2002. Determination of the consensus binding sequence for the purified embryonic heat shock factor 2. Eur. J. Biochem. 269:2527-2537.[Medline]
  50. 26
  51. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  52. 27
  53. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.[Abstract/Free Full Text]
  54. 28
  55. Steinmetzer, K., and S. Brantl. 1997. Plasmid pIP501 encoded transcriptional repressor CopR binds asymmetrically at two consecutive major grooves of the DNA. J. Mol. Biol. 269:684-693.[CrossRef][Medline]
  56. 29
  57. Steinmetzer, K., J. Behlke, and S. Brantl. 1998. Plasmid pIP501 encoded transcriptional repressor CopR binds to its target DNA as a dimer. J. Mol. Biol. 283:595-603.[CrossRef][Medline]
  58. 30
  59. Steinmetzer, K., A. Hillisch, J. Behlke, and S. Brantl. 2000. Transcriptional repressor CopR: structure model-based localization of the deoxyribonucleic acid binding motif. Proteins Struct. Funct. Genet. 38:393-406.[CrossRef][Medline]
  60. 31
  61. Steinmetzer, K., A. Hillisch, J. Behlke, and S. Brantl. 2000. Transcriptional repressor CopR: amino acids involved in forming the dimeric interface. Proteins Struct. Funct. Genet. 39:408-416.[CrossRef][Medline]
  62. 32
  63. Steinmetzer, K., K. Kuhn, J. Behlke, R. Golbik, and S. Brantl. 2002. Transcriptional repressor CopR: single amino acids involved in dimerization are also important for folding of the monomer. Plasmid 47:201-209.[CrossRef][Medline]
  64. 33
  65. Steinmetzer, K., J. Behlke, S. Brantl, and M. Lorenz. 2002. CopR binds and bends its target DNA: a footprinting and fluorescence resonance energy transfer study. Nucleic Acids Res. 30:2052-2060.[Abstract/Free Full Text]
  66. 34
  67. Stülke, J., I. Martin-Verstraete, M. Zagorec, M. Rose, A. Klier, and G. Rapoport. 1997. Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator, GlcT. Mol. Microbiol. 25:65-78.[CrossRef][Medline]
  68. 35
  69. Swinfield, T. J., J. D. Oultram, D. E. Thompson, J. K. Brehm, and N. P. Minton. 1990. Physical characterisation of the replication region of the Streptococcus faecalis plasmid pAMß1. Gene 87:79-90.[Medline]
  70. 36
  71. Tuerk, C., and L. Gold. 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:505-510.[Abstract/Free Full Text]
  72. 37
  73. Wen, J.-D., C. W. Gray, and D. M. Gray. 2001. SELEX selection of high-affinity oligonucleotides for bacteriophage Ff gene 5 protein. Biochemistry 40:9300-9310.[CrossRef][Medline]


Journal of Bacteriology, September 2004, p. 6254-6264, Vol. 186, No. 18
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.18.6254-6264.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Jerg, B., Gerischer, U. (2008). Relevance of nucleotides of the PcaU binding site from Acinetobacter baylyi. Microbiology 154: 756-766 [Abstract] [Full Text]  
  • Bai, G., McCue, L. A., McDonough, K. A. (2005). Characterization of Mycobacterium tuberculosis Rv3676 (CRPMt), a Cyclic AMP Receptor Protein-Like DNA Binding Protein. J. Bacteriol. 187: 7795-7804 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freede, P.
Right arrow Articles by Brantl, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freede, P.
Right arrow Articles by Brantl, S.