Previous Article | Next Article 
Journal of Bacteriology, October 2004, p. 6367-6373, Vol. 186, No. 19
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.19.6367-6373.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
PchC Thioesterase Optimizes Nonribosomal Biosynthesis of the Peptide Siderophore Pyochelin in Pseudomonas aeruginosa
Cornelia Reimmann,1* Hiten M. Patel,2 Christopher T. Walsh,2 and Dieter Haas1
Département de Microbiologie Fondamentale, Université de Lausanne, Lausanne, Switzerland,1
Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts2
Received 6 May 2004/
Accepted 28 June 2004

ABSTRACT
In
Pseudomonas aeruginosa, the antibiotic dihydroaeruginoate
(Dha) and the siderophore pyochelin are produced from salicylate
and cysteine by a thiotemplate mechanism involving the peptide
synthetases PchE and PchF. A thioesterase encoded by the
pchC gene was found to be necessary for maximal production of both
Dha and pyochelin, but it was not required for Dha release from
PchE and could not replace the thioesterase function specified
by the C-terminal domain of PchF. In vitro, 2-aminobutyrate,
a cysteine analog, was adenylated by purified PchE and PchF
proteins. In vivo, this analog strongly interfered with Dha
and pyochelin formation in a
pchC deletion mutant but affected
production of these metabolites only slightly in the wild type.
Exogenously supplied cysteine overcame the negative effect of
a
pchC mutation to a large extent, whereas addition of salicylate
did not. These data are in agreement with a role for PchC as
an editing enzyme that removes wrongly charged molecules from
the peptidyl carrier protein domains of PchE and PchF.

INTRODUCTION
Under iron-limiting growth conditions, aerobic bacteria produce
siderophores which form complexes with Fe
3+ in the environment
and deliver it, via specific outer membrane receptors, to the
bacterial cytoplasm. The two major siderophores made by
Pseudomonas aeruginosa are pyoverdin (
10,
23) and pyochelin (
8,
34), both
of which contribute to the virulence of this opportunistic human
pathogen (
9,
24,
43). The biosynthetic genes of the aryl-peptide
pyochelin (
32,
33,
39,
40) are clustered with the pyochelin
receptor gene
fptA (
1) and the regulatory gene
pchR (
21) on
the
P. aeruginosa chromosome. The biosynthetic genes are organized
in two divergent operons,
pchDCBA and
pchEFGHI. In the presence
of iron,
pchDCBA,
pchEFGHI, and
fptA are repressed by the Fur
protein (
1,
32,
40). During iron limitation, the biosynthesis
of pyochelin and its receptor protein is induced by a positive
feedback loop involving pyochelin and the transcriptional regulator
PchR (
17,
21,
32).
Pyochelin is made from salicylate and two molecules of cysteine by a thiotemplate mechanism on a four-protein, 12-domain assembly line (11, 27) (Fig. 1). The salicylate moiety is generated from chorismate by PchA (isochorismate synthase) (15) and PchB (isochorismate pyruvate-lyase) (14, 39) and is subsequently adenylated by PchD (31). Adenylation of L-cysteine is catalyzed by the nonribosomal peptide synthetase PchE, which then covalently links both activated substrates, as thioesters, to two posttranslationally added 4'-phosphopantetheine prosthetic groups on PchE. Condensation, epimerization, and cyclization reactions, also catalyzed by PchE, generate the enzyme-bound intermediate hydroxyphenyl-thiazoline (HPT), which can be released by slow hydrolysis of the thioester bond, to produce dihydroaeruginoate (Dha) (28, 31). This metabolite is found in small amounts in culture supernatants of P. aeruginosa (40). The 4'-phosphopantetheinylated (primed) form of the peptide synthetase PchF adenylates a second molecule of L-cysteine and, like PchE, links it covalently via a thioester. PchF subsequently catalyzes the condensation of the PchE-bound intermediate HPT with cysteinyl-PchF and thereby generates the second thiazoline ring, which is reduced by the PchG reductase and N-methylated by a tailoring domain of PchF. Hydrolysis of the remaining thioester bond finally releases pyochelin from PchF (27, 33).
The
pch gene cluster encodes two thioesterases. One of these
thioesterases resides in the C-terminal thioesterase domain
of PchF (internal thioesterase) (Fig.
1) and releases pyochelin
from PchF (
31). The other, a type II thioesterase (external
thioesterase), is encoded by the
pchC gene (
40), and its function
has not been studied previously. Thioesterases carry two conserved
sequences: GXSXG, a motif also present in the active sites of
serine proteases, lipases, and acyltransferases; and GXHF, which
is located approximately 140 amino acids further downstream
and whose His residue is essential for catalytic activity (
29,
36,
48). Both motifs occur in the thioesterase domain of PchF
(GYCSGX
176GGHF [
31]) and in PchC (GHSLGX
126GGHF [
40]). Mutations
in the first, integrated thioesterase motif of PchF prevent
pyochelin release from PchF in vitro (
31). The purpose of the
present study was to examine the role of the second, external
thioesterase, PchC.
In prokaryotic polyketide or nonribosomal peptide syntheses, it is common to find a distinct, external type II thioesterase. Mutational loss of the external thioesterase generally results in a reduced amount of product, and it has been suggested that such enzymes could either assist in product release from the thiotemplate or play a role as editing enzymes that remove wrongly charged substrates or aberrant intermediates from the enzyme complex (19, 36, 37). In vitro, type II thioesterases can regenerate misacylated peptide synthetases resulting from erroneous priming or from loading of an amino acid which cannot be processed (37, 51). Here we provide evidence for such a proofreading role for the type II PchC thioesterase of P. aeruginosa in vivo, which results in optimized Dha and pyochelin production.

MATERIALS AND METHODS
Bacterial strains and culture conditions.
Bacterial strains used in this study are listed in Table
1.
Bacteria were usually grown on nutrient agar and in nutrient
yeast broth (
42) at 37°C. To quantify salicylate, Dha, and
pyochelin in culture supernatants of
P. aeruginosa, strains
were grown in GGP medium (
6). Antibiotics, when required, were
added to the growth media at the following concentrations: tetracycline,
25 µg/ml for
Escherichia coli and 100 µg/ml for
P. aeruginosa; ampicillin, 100 µg/ml for
E. coli; carbenicillin,
250 µg/ml for
P. aeruginosa; kanamycin, 25 µg/ml
for
E. coli; and gentamicin, 10 µg/ml for
E. coli and
P. aeruginosa. To counterselect
E. coli donor cells in matings
with
P. aeruginosa, chloramphenicol was used at a concentration
of 10 µg/ml. 2-Aminobutyrate was purchased from Acros
Organics.
Construction of plasmids and gene replacement mutants.
All plasmids used in this study are listed in Table
1. The suicide
plasmid pME6815 used to create an in-frame deletion in the chromosomal
pchC gene was constructed as follows. A 0.9-kb XmaI-ScaI fragment
carrying most of the
pchC gene and the 5' part of
pchB was cloned
into pBluescript (pBLS II KS) between XmaI and EcoRV sites.
This plasmid was used as a template in an inverse PCR performed
with PchC1 (5'-CTGA
CCCGGGCCTCGCACATCCCGAC; XmaI site underlined)
and PchC2 (5'-GAAGCGGTCCTCGCGA
CCCGGG; XmaI site underlined)
as the primers to amplify a 3.3-kb fragment. The PCR product
was cleaved with XmaI and religated. From the resulting plasmid,
a 0.32-kb XmaI-HindIII fragment was excised, ligated to a 0.65-kb
fragment carrying the 5' part of
pchC (upstream of the XmaI
site) and part of the flanking
pchD gene, and cloned into the
suicide vector pME3087 between BamHI and HindIII sites. The
resulting suicide plasmid, pME6815, carried the flanking regions
of
pchC and a mutated
pchC gene which lacked codons 53 to 218.
For construction of chromosomal
pchC deletions in
P. aeruginosa PAO1, PALS128, and PALS128-6, pME6815 was mobilized from
E. coli S17-1 to the recipient
P. aeruginosa strains and chromosomally
integrated with selection for tetracycline resistance. Excision
of the vector via a second crossing over was accomplished by
enrichment for tetracycline-sensitive cells as described previously
(
50). The resulting
pchC mutants, PAO6339, PAO6342, and PAO6357,
were checked by Southern blot analysis (data not shown). To
generate the same mutation in the P
lac-
entDpchDBA expression
plasmid pME6852, the 671-bp XmaI-EcoRV fragment of pME6178 was
replaced by the corresponding XmaI-EcoRV fragment of pME6815
(173 bp) carrying the
pchC deletion.
The thioesterase motif in the pchC gene of plasmid pME7538 was mutated by overlap extension (25) as follows. Two 0.3-kb fragments, fragments A and B, were amplified by PCR from chromosomal DNA of PAO1 by using primer PchCmut1 (5'-CTGCGCGAGCGCCTGCGCCGCGAGC) plus primer PchCmut6 (5'-CAGCGCCGCGCCGAGGGCGTGGCCGAACAG) and primer PchCmut5 (5'-GCGCTGTTCGGCCACGCCCTCGGCGCGGCG) plusprimer PchCmut4 (5'-GACTTCCTCGTCGTGCTCGCCGAGG), respectively. PchCmut6 and PchCmut5 are complementary to each other to a large extent and specify a serine-to-alanine mutation in codon 90 (underlined). Equimolar amounts of PCR fragments A and B served as templates for the subsequent PCR amplification with primers PchCmut1 and PchCmut4. From the 0.6-kb PCR product obtained, an internal 0.3-kb XmaI-XhoI fragment was excised and used to replace the corresponding wild-type fragment in pME6831, resulting in the Plac-pchDCS90A expression plasmid pME7538.
Plasmid pME6886, which expresses pchEFC1606A/S1607AG under Pkan control and carries a mutation in the PchF thioesterase motif, was constructed by replacing the 311-bp SalI-NotI fragment of pME6488 with the corresponding fragment from pPchFTE. All constructs carrying pchC in-frame deletions or point mutations in pchC or pchF were verified by sequence analysis.
DNA manipulation and cloning procedures.
DNA manipulations were carried out as described by Sambrook et al. (35). Small-scale preparation of plasmid DNA was carried out by the cetyltrimethylammonium bromide method (12), and large-scale preparation was performed by using JetStar-Tips (Genomed, Basel, Switzerland). Chromosomal DNA was prepared by the method of Gamper et al. (16). DNA fragments were purified from agarose gels with a Gene Clean DNA extraction kit (Bio 101, La Jolla, Calif.). Transformation of E. coli and P. aeruginosa was carried out by electroporation (13). Nucleotide sequences were determined with a Big Dye terminator cycle sequencing kit and an ABI-PRISM 373 automatic sequencer (Applied Biosystems). Nucleotide sequences were analyzed with programs of the University of Wisconsin Genetics Computer Group package (version 9.1).
Identification of salicylate, Dha, and pyochelin in culture supernatants of P. aeruginosa.
P. aeruginosa strains were grown in GGP medium for the time indicated. For high-pressure liquid chromatography (HPLC) analysis, ethyl acetate extracts of acidified culture supernatants were dried by evaporation, dissolved in 60% (vol/vol) methanol-10 mM H3PO4, and injected into an HPLC system as described previously (32). Compounds were identified by their retention times and UV spectra. Dha and salicylate were quantified at 256 and 237 nm, respectively. Pyochelin, which exists as a mixture of two interconvertible isomers, pyochelin I and pyochelin II (34), was quantified at 258 and 254 nm, respectively.
ATP-32PPi exchange reactions.
PchE and PchF proteins used in the assays were overexpressed and purified in E. coli and were converted to their phosphopantetheinyl holoforms as described previously (30, 31). ATP-PPi exchange reactions were performed by using previously described procedures (31); the reaction mixtures contained 100 nM PchE and 100 nM PchF, respectively, and the amino acid tested at a concentration of 1 mM. Incubation was at 30°C for 20 min.

RESULTS
Inactivation of the PchC thioesterase decreases production of
Dha and pyochelin in
P. aeruginosa. To study the role of PchC,
we constructed a chromosomal in-frame deletion in its gene and
evaluated the impact of this on the production of Dha and pyochelin.
As shown in Table
2, the production of both metabolites was
significantly reduced in the
pchC mutant PAO6339 compared to
the production in the wild-type strain, PAO1, and as a consequence,
large amounts of the precursor salicylate accumulated. When
the PAO6339 mutant was complemented with plasmid pME6831 carrying
pchDC, production of Dha and pyochelin was restored to the wild-type
level. By contrast, plasmid pME7538, which is identical to pME6831
except for a point mutation (Cys90Ala) destroying the essential
thioesterase motif of PchC, did not complement the PchC-negative
phenotype of PAO6339 (Table
2). Note that, as reported previously,
expression of
pchC requires the presence of the upstream
pchD gene in
cis (
40);
pchD was therefore included in these plasmids.
View this table:
[in this window]
[in a new window]
|
TABLE 2. Effects of a pchC mutation on the concentrations of salicylate, Dha, and pyochelin in culture supernatants of P. aeruginosaa
|
PchC cannot release pyochelin from its thiotemplate, PchF, and is not essential for Dha formation.
Since pyochelin is required for full transcriptional expression
of the
pchDCBA and
pchEFGHI operons by positive autoregulation
(
32), it is important to express both operons under the control
of constitutive promoters when the roles of individual genes
in the pyochelin biosynthetic pathway are assessed. We therefore
used a two-plasmid system described previously (
32) with the
deletion mutant PAO6331 lacking
pchDCBA,
pchR, and
pchEFGHI.
The
E. coli entD gene encoding a phosphopantetheinyl transferase
with relaxed specificity was coexpressed with the
pchDCBA operon
to ensure constitutive conversion of PchE and PchF to their
phosphopantetheinyl holoforms (
33). In this system
pchDCBA and
pchEFG are sufficient for pyochelin biosynthesis (
33), but the
amounts of pyochelin and Dha produced under these conditions
are two- to threefold lower than the amounts in PAO1, probably
because the kanamycin promoter used to drive
pchEFG expression
on pME6488 is weaker than the natural, pyochelin-inducible promoter
of the
pchEFGHI operon. As a consequence, salicylate is not
quantitatively incorporated into Dha and pyochelin and accumulates
to some extent in PAO6331 carrying pME6178 (
entD pchDCBA) and
pME6488 (
pchEFG) (
33) (Table
3). Pyochelin and Dha formation
in PAO6331 carrying pME6852 (
entD pchDBA) and pME6488 (
pchEFG)
was reduced threefold compared to the formation in PAO6331 carrying
pME6178 and pME6488, confirming that
pchC is important, but
not essential, for Dha and pyochelin formation in
P. aeruginosa.
Increased amounts of salicylate accumulated in culture supernatants
as a result of reduced incorporation into Dha and pyochelin.
View this table:
[in this window]
[in a new window]
|
TABLE 3. Impact of thioesterases encoded by pchC and pchF on salicylate, Dha, and pyochelin formation in P. aeruginosaa
|
To investigate a potential role of PchC in the release of pyochelin
from PchF, we tested whether the
pchC gene was able to functionally
complement a double point mutation (Cys1606Ala/Ser1607Ala) blocking
the thioesterase function of
pchF (
31). As illustrated in Table
3, strain PAO6331 carrying pME6852 (
entD pchDBA) and pME6886
(
pchEFC1606A/S1607AG) was unable to produce pyochelin because
of a lack of both thioesterases. When the
entD pchDCBA construct
pME6178 was used instead of pME6852, pyochelin was not produced
either, indicating that PchC could not substitute for the mutated
thioesterase function of PchF. Small amounts of Dha were detected
in culture supernatants of the wild-type strain, PAO1, as well
as in the recombinant strain lacking both thioesterases, probably
as a result of nonspecific hydrolysis of the PchE-HPT thioester
bond (
31).
The recombinant strain lacking the pchF-encoded thioesterase (PAO6331 with pME6178 and pME6886) produced more Dha than the pyochelin-producing pchF+ strain (PAO6331 carrying pME6178 and pME6488) produced (Table 3). Similarly, PAO6331 expressing entD pchDCBA and pchE produces more Dha than its pyochelin-producing counterpart produces (33). It seems that nonspecific hydrolysis of the PchE-HPT thioester bond increases when the pyochelin assembly line is interrupted because of mutations in pchF. The fact that more Dha was excreted in the presence of PchC than in the absence of PchC may be explained by a positive effect of PchC on the catalytic efficiency of PchE (see below). In conclusion, PchC does not seem to be essential for releasing Dha from its thiotemplate, PchE.
The PchC-negative phenotype is suppressed by addition of cysteine.
We next evaluated a potential role of PchC as an editing enzyme in case of mischarging of PchE and/or PchF during Dha and pyochelin production. Two sources of mischarging were considered: (i) PchD could activate endogenous or exogenously added salicylate analogs and deliver these molecules to the aryl carrier protein domain of PchE; (ii) PchE and PchF could adenylate and subsequently load amino acids other than L-cysteine onto their peptidyl carrier protein (PCP) domains. In both cases, correct assembly of Dha and pyochelin would be hampered, and thus the role of PchC could be to recognize and eliminate wrongly charged molecules by thioester cleavage. The first hypothesis was tested by measuring the influence of PchC on pyochelin formation in a salicylate-requiring mutant to which salicylate was added at different concentrations (10 µM to 1 mM) together with a large excess of various salicylate analogs, such as p-aminosalicylate, benzoate, p-hydroxybenzoate, p-aminobenzoate, or anthranilate. Pyochelin formation was measured semiquantitatively on CAS agar, which allows the production of siderophores to be visualized by the formation of an orange halo around the colonies (38). Since the siderophore pyoverdin would interfere in this assay, we used a pvdB (pyoverdin-negative) pchA strain, PALS128-6, and its
pchC derivative PAO6357. None of the salicylate analogs tested reduced the diameter of the halo around the bacterial colonies, regardless of the presence of pchC, suggesting that pyochelin formation was not inhibited (data not shown). If the role of PchC were indeed to remove an endogenous mischarged salicylate analog from the aryl carrier protein domain of PchE, then an excess of salicylate should competitively inhibit mischarging and thereby suppress the negative effect of a pchC mutation. We therefore tested whether the PchC-negative phenotype could be suppressed by salicylate addition. Whereas pyochelin production was stimulated somewhat in the PchC-positive strain PALS128, this was not the case in the pchC mutant PAO6357 (Fig. 2). Pyochelin formation in the corresponding pchA mutants depended on salicylate addition, confirming that salicylate was readily taken up (Fig. 2). In the salicylate-requiring pchC mutant PAO6357 the concentration of pyochelin formed remained below 200 µM, even when the culture medium was amended with 1 mM salicylate. Taken together, these results do not support the first hypothesis.
To evaluate the second hypothesis, we tested whether the PchC-negative
phenotype could be suppressed by addition of
L-cysteine to GGP
medium, which is rich in amino acids except for
L-cysteine (
15).
As illustrated in Fig.
3, addition of 2 mM
L-cysteine to a medium
containing salicylate at concentrations between 400 and 850
µM enabled strain PAO6357 (
pvdB pchA pchC) to produce
almost the same amounts of pyochelin as its
pchC+ parent PALS128-6
produced. By contrast, we confirmed that in the absence of
L-cysteine,
the
pchC-negative mutant produced significantly less siderophore
than the
pchC-positive strain produced. Similar results were
obtained when the growth medium was amended with 5 mM
L-cysteine
(data not shown). These data are in agreement with a role of
PchC in the removal of wrongly charged substrates from the PCP
domains of PchE and/or PchF.
Which amino acid might be misloaded onto these enzymes in vivo?
ATP-PP
i exchange assays were performed to test whether purified
PchE and PchF could adenylate amino acids other than
L-cysteine.
Both enzymes were highly specific for
L-cysteine; of all the
natural amino acids tested, only
L-serine was activated by PchE
and PchF at levels above background levels (Fig.
4). PchE was
found to load radiolabeled
L-serine instead of
L-cysteine onto
the PCP1 domain in vitro, but no subsequent condensation products
could be detected (data not shown).
2-Aminobutyrate strongly inhibits Dha and pyochelin formation in a pchC mutant.
In the ATP-PP
i exchange assays for PchE and PchF, the cysteine
analog 2-aminobutyrate was activated with good efficiency (Fig.
4). Previously, 2-aminobutyrate had been shown to be activated
and loaded instead of
L-cysteine onto the PCP domain of HMWP1
(high-molecular-weight protein 1), a PchE-like nonribosomal
peptide synthetase involved in the biosynthesis of the siderophore
yersiniabactin in
Yersinia pestis (
22). We therefore tested
whether this analog interfered with Dha and pyochelin formation
by
P. aeruginosa in vivo. When 2-aminobutyrate was added to
the growth medium at a final concentration of 5 mM, pyochelin
formation was very strongly decreased in
pchC mutant PAO6339,
and no Dha was detected (Table
4). In the absence of pyochelin,
the expression of the
pchDCBA and
pchEFG genes required for
salicylate, Dha, and pyochelin formation is low because the
positive feedback regulation operating in this biosynthetic
pathway is disrupted (
32). It is therefore not surprising that
addition of 2-aminobutyrate to the
pchC mutant also reduced
the production of salicylate (Table
4) as the amount of pyochelin
produced under these conditions was not sufficient to allow
high-level expression of the
pch biosynthetic genes. By contrast,
addition of 5 mM 2-aminobutyrate to a culture of the wild-type
strain, PAO1, had only a modest effect on the production of
pyochelin and Dha (Table
4), supporting the hypothesis that
the PchC type II thioesterase is able to remove 2-aminobutyrate
from PchE and PchF.

DISCUSSION
In this study, we demonstrated that PchC, an external type II
thioesterase encoded by the pyochelin gene cluster, is important
for optimal production of the siderophore pyochelin and of its
precursor, the antibiotic Dha. Type II thioesterase genes have
been identified in many gene clusters specifying the biosynthesis
of nonribosomal peptides (
3,
7,
26,
40) and polyketides (
5,
18,
49). Mutational loss of these genes generally results in
a decreased amount of product formed, and in vitro, type II
thioesterases can regenerate misacylated thiol groups of the
4'-phosphopantetheine cofactors attached to the PCP domains
of nonribosomal peptide synthetases (
37). In vivo, misacylated
enzymes may be formed either when a wrong amino acid is activated
and loaded onto the PCP domain or when the 4'-phosphopantetheinyl
transferase uses acyl coenzyme A instead of free coenzyme A
as the 4'-phosphopantetheine donor (
37). Similarly, during polyketide
biosynthesis, type II thioesterases are thought to be responsible
for hydrolyzing aberrant cofactor-bound acyl groups (
19).
Our data support such a proofreading role for PchC in P. aeruginosa. The production of Dha and pyochelin was strongly decreased in the pchC-negative mutant but not in the wild type, especially when the growth medium was amended with 2-aminobutyrate (Table 4). This cysteine analog was found to be activated by both PchE and PchF and thus could compete with cysteine for loading onto the PCP domains of these nonribosomal peptide synthetases. If 2-aminobutyrate instead of L-cysteine were attached to PchE and PchF, the formation of thiazoline rings would not occur and Dha and pyochelin assembly would be prevented. In the wild type, the most likely function of the PchC enzyme is to remove the wrongly charged substrate, thereby regenerating peptide synthetase activity. To our knowledge, this is the first evidence for a proofreading role of a type II thioesterase in vivo.
There are two indications that a wrong substrate loaded onto PchE causes the enzyme to stall rather than to form aberrant products. (i) Under the conditions used in this study, strain PAO1 converted salicylate quantitatively to Dha and pyochelin. In the pchC mutant, however, which produced less Dha and pyochelin, large amounts of salicylate accumulated (Tables 2 to 4), indicating that little, if any, salicylate is coupled to substrates other than L-cysteine by PchE. (ii) Although PchE was able to load L-serine instead of L-cysteine onto the PCP1 domain, no subsequent condensation products were observed in vitro. In addition, HPLC analysis of culture supernatants of the pchC mutant (Tables 2 to 4) did not reveal aberrant condensation products of salicylate.
The role of PchC in removing wrongly charged molecules from the PCP domain of PchE and possibly the PCP domain of PchF is corroborated by the fact that addition of L-cysteine to the growth medium largely suppressed the adverse effect of a pchC mutation, probably by ensuring that L-cysteine rather than its potential natural competitors (e.g., L-serine) is charged on PchE (and PchF). A stimulating effect of L-cysteine on pyochelin biosynthesis has been noticed previously (2, 15) and may also be important in the wild type when the amount of salicylate available is greater than the amount of L-cysteine. In the experiments shown in Fig. 2 and 3, the amount of salicylate was controlled by exogenous salicylate added to a salicylate-requiring mutant.
Given the fact that in vitro some type II thioesterases hydrolyze PCP-bound peptides (37), we considered the possibility that PchC might detach the biosynthetic intermediate Dha and/or participate in the release of the final product, pyochelin, from the thiotemplate. Whereas it is clear from the results shown in Table 3 that PchC does not cleave the pyochelin-PchF thioester bond, we cannot entirely rule out involvement of PchC in Dha release from PchE since the production of this antibiotic compound was greater in a pchC-positive background than in the absence of pchC. However, it seems more likely that the editing function of PchC accounts for this effect, as some Dha was formed even in the absence of thioesterase activities encoded by both pchC and pchF (Table 3).
In conclusion, we showed that the PchC thioesterase is not essential for the release of Dha from PchE and does not participate in the release of pyochelin from PchF. Our data are consistent with PchC having a quality control function in pyochelin biosynthesis by removing wrongly charged molecules from the PCP domains of PchE and PchF. Further support for this conclusion comes from a recent study (51) which demonstrated that a type II thioesterase removes misloaded amino acids from tyrocidine synthetase prior to peptide bond formation and thereby restores the activity of enzyme modules stalled with unprocessed aminoacyl intermediates.

ACKNOWLEDGMENTS
We thank Thomas A. Keating for providing pPchFTE, Jean-Pierre
Rey for technical assistance, Patrick Michaux for help with
HPLC analyses, and GlaxoSmithKline for a generous gift of carbenicillin.
This work was supported by the Swiss National Foundation for Scientific Research (projects 31-56608.99 and 31-102174).

FOOTNOTES
* Corresponding author. Mailing address: Département de Microbiologie Fondamentale, BÂtiment de Biologie, Université de Lausanne, CH-1015 Lausanne Dorigny, Switzerland. Phone: 41 21 6925632. Fax: 41 21 6925635. E-mail:
Cornelia.Reimmann{at}imf.unil.ch.


REFERENCES
1 - Ankenbauer, R. G., and H. N. Quan. 1994. FptA, the Fe(III)-pyochelin receptor of Pseudomonas aeruginosa: a phenolate siderophore receptor homologous to hydroxamate siderophore receptors. J. Bacteriol. 176:307-319.[Abstract/Free Full Text]
2 - Audenaert, K., T. Pattery, P. Cornelis, and M. Höfte. 2002. Induction of systemic resistance to Botrytis cinerea in tomato by Pseudomonas aeruginosa 7NSK2: role of salicylic acid, pyochelin, and pyocyanin. Mol. Plant-Microbe Interact. 15:1147-1156.[Medline]
3 - Bearden, S. W., J. D. Fetherston, and R. D. Perry. 1997. Genetic organization of the yersiniabactin biosynthetic region and construction of avirulent mutants in Yersinia pestis. Infect. Immun. 65:1659-1668.[Abstract]
4 - Blumer, C., S. Heeb, G. Pessi, and D. Haas. 1999. Global GacA-steered control of cyanide and exoprotease production in Pseudomonas fluorescens involves specific ribosome binding sites. Proc. Natl. Acad. Sci. USA 96:14073-14078.[Abstract/Free Full Text]
5 - Butler, A. R., N. Bate, and E. Cundliffe. 1999. Impact of thioesterase activity on tylosin biosynthesis in Streptomyces fradiae. Chem. Biol. 6:287-292.[CrossRef][Medline]
6 - Carmi, R., S. Carmeli, E. Levy, and F. J. Gough. 1994. (+)-(S)-Dihydro-aeruginoic acid, an inhibitor of Septoria tritici and other phytopathogenic fungi and bacteria, produced by Pseudomonas fluorescens. J. Nat. Prod. 57:1200-1205.[CrossRef][Medline]
7 - Cosmina, P., F. Rodriguez, F. de Ferra, G. Grandi, M. Perego, G. Venema, and G. van Sinderen. 1993. Sequence and analysis of the genetic locus responsible for surfactin synthesis in Bacillus subtilis. Mol. Microbiol. 8:821-831.[CrossRef][Medline]
8 - Cox, C. D. 1980. Iron uptake with ferripyochelin and ferric citrate by Pseudomonas aeruginosa. J. Bacteriol. 142:581-587.[Abstract/Free Full Text]
9 - Cox, C. D. 1982. Effect of pyochelin on the virulence of Pseudomonas aeruginosa. Infect. Immun. 36:17-23.[Abstract/Free Full Text]
10 - Cox, C. D., and P. Adams. 1985. Siderophore activity of pyoverdin in Pseudomonas aeruginosa. Infect. Immun. 48:130-138.[Abstract/Free Full Text]
11 - Crosa, J. H., and C. T. Walsh. 2002. Genetics and assembly line enzymology of siderophore biosynthesis in bacteria. Microbiol. Mol. Biol. Rev. 66:223-249.[Abstract/Free Full Text]
12 - Del Sal, G., G. Manfioletti, and C. Schneider. 1988. A one-tube plasmid DNA mini-preparation suitable for sequencing. Nucleic Acids Res. 16:9878.[Free Full Text]
13 - Farinha, M. A., and A. M. Kropinski. 1990. High efficiency electroporation of Pseudomonas aeruginosa using frozen cell suspensions. FEMS Microbiol. Lett. 58:221-225.[Medline]
14 - Gaille, C., P. Kast, and D. Haas. 2002. Salicylate biosynthesis in Pseudomonas aeruginosa. Purification and characterization of PchB, a novel bifunctional enzyme displaying isochorismate pyruvate-lyase and chorismate mutase activities. J. Biol. Chem. 277:21768-21775.[Abstract/Free Full Text]
15 - Gaille, C., C. Reimmann, and D. Haas. 2003. Isochorismate synthase (PchA), the first and rate-limiting enzyme in salicylate biosynthesis of Pseudomonas aeruginosa. J. Biol. Chem. 278:16893-16898.[Abstract/Free Full Text]
16 - Gamper, M., B. Ganter, M. Polito, and D. Haas. 1992. RNA processing modulates the expression of the arcDABC operon in Pseudomonas aeruginosa. J. Mol. Biol. 226:943-957.[CrossRef][Medline]
17 - Gensberg, K., K. Hughes, and A. W. Smith. 1992. Siderophore-specific induction of iron uptake in Pseudomonas aeruginosa. J. Gen. Microbiol. 138:2381-2387.[Abstract/Free Full Text]
18 - Haydock, S. F., J. A. Dowson, N. Dhillon, G. A. Roberts, J. Cortes, and P. F. Leadlay. 1991. Cloning and sequence analysis of genes involved in erythromycin biosynthesis in Saccharopolyspora erythraea: sequence similarities between EryG and a family of S-adenosylmethionine-dependent methyltransferases. Mol. Gen. Genet. 230:120-128.[CrossRef][Medline]
19 - Heathcote, M. L., J. Staunton, and P. F. Leadlay. 2001. Role of type II thioesterases: evidence for removal of short acyl chains produced by aberrant decarboxylation of chain extender units. Chem. Biol. 8:207-220.[CrossRef][Medline]
20 - Heeb, S., Y. Itoh, T. Nishijyo, U. Schnider, C. Keel, J. Wade, U. Walsh, F. O'Gara, and D. Haas. 2000. Small, stable shuttle vectors based on the minimal pVS1 replicon for use in Gram-negative, plant-associated bacteria. Mol. Plant-Microbe Interact. 13:232-237.[Medline]
21 - Heinrichs, D. E., and K. Poole. 1993. Cloning and sequence analysis of a gene (pchR) encoding an AraC family activator of pyochelin and ferripyochelin receptor synthesis in Pseudomonas aeruginosa. J. Bacteriol. 175:5882-5889.[Abstract/Free Full Text]
22 - Keating, T. A., Z. Suo, D. E. Ehmann, and C. T. Walsh. 2000. Selectivity of the yersiniabactin synthetase adenylation domain in the two-step process of amino acid activation and transfer to a holo-carrier protein domain. Biochemistry 39:2297-2306.[CrossRef][Medline]
23 - Meyer, J. M., and M. A. Abdallah. 1978. The fluorescent pigment of Pseudomonas fluorescens: biosynthesis, purification and physicochemical properties. J. Gen. Microbiol. 107:319-328.
24 - Meyer, J. M., A. Neely, A. Stintzi, C. Georges, and I. A. Holder. 1996. Pyoverdin is essential for virulence of Pseudomonas aeruginosa. Infect. Immun. 64:518-523.[Abstract]
25 - Mikaelian, I., and A. Sergeant. 1996. Modification of the overlap extension method for extensive mutagenesis on the same template. Methods Mol. Biol. 57:193-202.[Medline]
26 - Mootz, H. D., and M. A. Marahiel. 1997. The tyrocidine biosynthesis operon of Bacillus brevis: complete nucleotide sequence and biochemical characterization of functional internal adenylation domains. J. Bacteriol. 179:6843-6850.[Abstract/Free Full Text]
27 - Patel, H., and C. T. Walsh. 2001. In vitro reconstitution of the Pseudomonas aeruginosa nonribosomal peptide synthesis of pyochelin: characterization of backbone tailoring thiazoline reductase and N-methyltransferase activities. Biochemistry 40:9023-9031.[CrossRef][Medline]
28 - Patel, H. M., J. Tao, and C. T. Walsh. 2003. Epimerization of an L-cysteinyl to a D-cysteinyl residue during thiazoline ring formation in siderophore chain elongation by pyochelin synthetase from Pseudomonas aeruginosa. Biochemistry 42:10514-10527.[CrossRef][Medline]
29 - Pazirandeh, M., S. S. Chirala, and S. J. Wakil. 1991. Site-directed mutagenesis studies on the recombinant thioesterase domain of chicken fatty acid synthase expressed in Escherichia coli. J. Biol. Chem. 266:20946-20952.[Abstract/Free Full Text]
30 - Quadri, L. E. N., P. H. Weinreb, M. Lei, M. M. Nakano, P. Zuber, and C. T. Walsh. 1998. Characterization of Sfp, a Bacillus subtilis phosphopantetheinyl transferase for peptidyl carrier protein domains in peptide synthetases. Biochemistry 37:1585-1595.[CrossRef][Medline]
31 - Quadri, L. E. N., T. A. Keating, H. M. Patel, and C. T. Walsh. 1999. Assembly of the Pseudomonas aeruginosa nonribosomal peptide siderophore pyochelin: in vitro reconstitution of aryl-4,2-bisthiazoline synthetase activity from PchD, PchE, and PchF. Biochemistry 38:14941-14954.[CrossRef][Medline]
32 - Reimmann, C., L. Serino, M. Beyeler, and D. Haas. 1998. Dihydroaeruginoic acid synthetase and pyochelin synthetase, products of the pchEF genes, are induced by extracellular pyochelin in Pseudomonas aeruginosa. Microbiology 144:3135-3148.[Abstract/Free Full Text]
33 - Reimmann, C., H. M. Patel, L. Serino, M. Barone, C. T. Walsh, and D. Haas. 2001. Essential PchG-dependent reduction in pyochelin biosynthesis of Pseudomonas aeruginosa. J. Bacteriol. 183:813-820.[Abstract/Free Full Text]
34 - Rinehart, K. L., A. L. Staley, S. R. Wilson, R. G. Ankenbauer, and C. D. Cox. 1995. Stereochemical assignment of the pyochelins. J. Org. Chem. 60:2786-2791.[CrossRef]
35 - Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
36 - Schneider, A., and M. A. Marahiel. 1998. Genetic evidence for a role of thioesterase domains, integrated in or associated with peptide synthetases, in non-ribosomal peptide biosynthesis in Bacillus subtilis. Arch. Microbiol. 169:404-410.[CrossRef][Medline]
37 - Schwarzer, D., H. D. Mootz, U. Linne, and M. A. Marahiel. 2002. Regeneration of misprimed nonribosomal peptide synthetases by type II thioesterases. Proc. Natl. Acad. Sci. USA 99:14083-14088.[Abstract/Free Full Text]
38 - Schwyn, B., and J. B. Neilands. 1987. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 160:47-56.[CrossRef][Medline]
39 - Serino, L., C. Reimmann, B. Baur, M. Beyeler, P. Visca, and D. Haas. 1995. Structural genes for salicylate biosynthesis from chorismate in Pseudomonas aeruginosa. Mol. Gen. Genet. 249:217-228.[CrossRef][Medline]
40 - Serino, L., C. Reimmann, P. Visca, M. Beyeler, V. Della Chiesa, and D. Haas. 1997. Biosynthesis of pyochelin and dihydroaeruginoic acid requires the iron-regulated pchDCBA operon in Pseudomonas aeruginosa. J. Bacteriol. 179:248-257.[Abstract/Free Full Text]
41 - Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vitro genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1:784-790.[CrossRef]
42 - Stanisich, V. A., and B. W. Holloway. 1972. A mutant sex factor of Pseudomonas aeruginosa. Genet. Res. Camb. 19:91-108.[Medline]
43 - Takase, H., H. Nitanai, K. Hoshino, and T. Otani. 2000. Impact of siderophore production on Pseudomonas aeruginosa infections in immunosuppressed mice. Infect. Immun. 68:1834-1839.[Abstract/Free Full Text]
44 - Vieira, J., and J. Messing. 1991. New pUC-derived cloning vectors with different selectable markers and DNA replication origins. Gene 100:189-194.[CrossRef][Medline]
45 - Visca, P., L. Serino, and N. Orsi. 1992. Isolation and characterization of Pseudomonas aeruginosa mutants blocked in the synthesis of pyoverdin. J. Bacteriol. 174:5727-5731.[Abstract/Free Full Text]
46 - Voisard, C., C. T. Bull, C. Keel, J. Laville, M. Maurhofer, U. Schnider, G. Défago, and D. Haas. 1994. Biocontrol of root diseases by Pseudomonas fluorescens CHA0: current concepts and experimental approaches, p. 67-89. In F. O'Gara, D. Dowling, and B. Boesten (ed.), Molecular ecology of rhizosphere microorganisms. VCH Publishers, Weinheim, Germany.
47 - Watson, A., R. A. Alm, and J. S. Mattick. 1996. Construction of improved vectors for protein production in Pseudomonas aeruginosa. Gene 172:163-164.[CrossRef][Medline]
48 - Witkowski, A., H. E. Witkowski, and S. Smith. 1994. Reengineering the specificity of a serine active-site enzyme. Two active-site mutations convert a hydrolase to a transferase. J. Biol. Chem. 269:379-383.[Abstract/Free Full Text]
49 - Xue, Y., L. Zhao, H.-W. Liu, and D. H. Sherman. 1998. A gene cluster for macrolide antibiotic biosynthesis in Streptomyces venezuelae: architecture of metabolic diversity. Proc. Natl. Acad. Sci. USA 95:12111-12116.[Abstract/Free Full Text]
50 - Ye, R. W., D. Haas, J. O. Ka, V. Krishnapillai, A. Zimmermann, C. Baird, and J. M. Tiedje. 1995. Anaerobic activation of the entire denitrification pathway in Pseudomonas aeruginosa requires Anr, an anolog of Fnr. J. Bacteriol. 177:3606-3609.[Abstract/Free Full Text]
51 - Yeh, E., R. M. Kohli, S. D. Bruner, and C. T. Walsh. Type II thioesterase restores activity of a NRPS module stalled with an aminoacyl-S-enzyme that cannot be elongated. Chembiochem, in press.
Journal of Bacteriology, October 2004, p. 6367-6373, Vol. 186, No. 19
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.19.6367-6373.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Claxton, H. B., Akey, D. L., Silver, M. K., Admiraal, S. J., Smith, J. L.
(2009). Structure and Functional Analysis of RifR, the Type II Thioesterase from the Rifamycin Biosynthetic Pathway. J. Biol. Chem.
284: 5021-5029
[Abstract]
[Full Text]
-
Leduc, D., Battesti, A., Bouveret, E.
(2007). The Hotdog Thioesterase EntH (YbdB) Plays a Role In Vivo in Optimal Enterobactin Biosynthesis by Interacting with the ArCP Domain of EntB. J. Bacteriol.
189: 7112-7126
[Abstract]
[Full Text]
-
Miethke, M., Marahiel, M. A.
(2007). Siderophore-Based Iron Acquisition and Pathogen Control. Microbiol. Mol. Biol. Rev.
71: 413-451
[Abstract]
[Full Text]
-
Bultreys, A., Gheysen, I., de Hoffmann, E.
(2006). Yersiniabactin Production by Pseudomonas syringae and Escherichia coli, and Description of a Second Yersiniabactin Locus Evolutionary Group.. Appl. Environ. Microbiol.
72: 3814-3825
[Abstract]
[Full Text]