The Caulobacter crescentus CgtAC Protein Cosediments with the Free 50S Ribosomal Subunit

The Obg family of GTPases is widely conserved and predictedto play an as-yet-unknown role in translation. Recent reportsprovide circumstantial evidence that both eukaryotic and prokaryoticObg proteins are associated with the large ribosomal subunit.Here we provide direct evidence that the Caulobacter crescentusCgtA_C protein is associated with the free large (50S) ribosomalsubunit but not with 70S monosomes or with translating ribosomes.In contrast to the Bacillus subtilis and Escherichia coli proteins,CgtA_C does not fractionate in a large complex by gel filtration,indicating a moderately weak association with the 50S subunit.Moreover, binding of CgtA_C to the 50S particle is sensitiveto salt concentration and buffer composition but not guaninenucleotide occupancy of CgtA_C. Assays of epitope-tagged wild-typeand mutant variants of CgtA_C indicate that the C terminus ofCgtA_C is critical for 50S association. Interestingly, the additionof a C-terminal epitope tag also affected the ability of variouscgtA_C alleles to function in vivo. Depletion of CgtA_C led toperturbations in the polysome profile, raising the possibilitythat CgtA_C is involved in ribosome assembly or stability.

INTRODUCTION

Top

Introduction

GTP-binding proteins play roles in diverse cellular processesranging from signal transduction to vesicle fusion. While muchattention has been focused on the role of the eukaryotic Ras-likeGTPases, less attention has been paid to a large number of GTPasesubfamilies that are conserved among all living organisms sequencedto date (4, 5, 27, 33). On the basis of the evolutionary relationshipsand emerging experimental data, it has been proposed that theserelatively widely conserved GTP-binding proteins act as translationfactors (27).

The Obg subfamily is a distinct group of monomeric GTP-bindingproteins that share a conserved GTP-binding domain. Bacteriaencode one Obg protein and Archaea typically encode two relatedObg proteins, whereas eukaryotes usually encode four Obg proteins,including three distinct protein types. The bacterial and theeukaryotic mitochondrial Obg proteins are likely to be homologous,as sequences flanking the GTP-binding domain are also conserved.The biochemical features of the Obg proteins are distinct fromthose of the well-characterized Ras-like proteins. For example,all bacterial Obg proteins examined thus far bind guanine nucleotideswith modest (in the micromolar range) affinity (28, 47, 52).More strikingly, the Caulobacter crescentus and the Escherichiacoli Obg proteins, CgtA_C and CgtA_E, respectively (CgtA_E is alsocalled Obg_E or YhbZ), have rapid GDP and GTP exchange rate constantsbut relatively slow GTP hydrolysis rates (28). To date, we andothers have favored models for Obg function that involve Obgacting as a sensor of intracellular GTP/GDP pools (28, 39).We further proposed that in vivo, rapid exchange of guaninenucleotides might be inhibited and that GTP hydrolysis may playa role in regulating the activation of the Obg proteins (30).The inhibition of guanine nucleotide exchange could be accomplishedby the association of Obg in a complex.

Accumulating evidence suggests that the Obg proteins are ribosomeassociated. The Bacillus subtilis Obg protein fractionates ina large cytoplasmic complex by gel filtration, coelutes withribosomal proteins, and interacts specifically with the 50Sribosome subunit protein L13 (42). Similarly, the E. coli CgtA_Eprotein also fractionates with a large RNA-containing complexby gel filtration and interacts with L13 (K. Pu and J. R. Maddock,unpublished data). CgtA_E has been shown genetically to interactwith RrmJ (FtsJ) (47), a methyltransferase that modifies the23S rRNA (3). Overexpression of CgtA_E suppresses both the growthdefect and the polysome profile defect of the ${Delta}$ rrmJ mutant, suggestingthat CgtA_E plays an active role in ribosome assembly or stability(47).

In this report we demonstrate that the C. crescentus CgtA_C proteinis associated with the 50S ribosomal subunit but not with the70S monosomes or with polyribosomes, indicating that CgtA_C isnot associated with translating ribosomes. The observed associationis dependent on both the salt concentration and the magnesiumcounter ion used in the assay. Moreover, the C-terminal aciddomain of CgtA_C, which is important for function, is also criticalfor 50S association, and the addition of a C-terminal epitopetag affects both function and ribosome association. Finally,the long-term effect of CgtA_C depletion is a reduction in 70Smonosomes and polyribosomes.

MATERIALS AND METHODS

Top

Materials and Methods

Bacterial strains and culture conditions. The bacterial strains used in this study are listed in Table1. E. coli was grown at 37°C in Luria-Bertani broth or onLuria-Bertani agar containing antibiotics as required (see below).C. crescentus strains were derived from CB15N and were grownin PYE medium at 30°C. All DNA manipulation was performedin E. coli strain DH5 ${alpha}$ . Plasmids were introduced into C. crescentusby conjugal transfer via the E. coli strain S17 (12). Antibioticswere used at the following concentrations: for C. crescentus,oxytetracycline (Tet) (concentration, 1 µg ml^-1), naladixicacid (20 µg ml^-1), ampicillin (Amp) (10 µg ml^-1),or kanamycin (Kan) (5 µg ml^-1); and for E. coli, tetracycline(12 µg ml^-1), Kan (30 µg ml^-1), or Amp (100 µgml^-1). The ability of cgtA_C alleles to function in C. crescentusstrain JM1108 was assayed on PYE agar plates containing 0.2%xylose (PYE+Xyl) or 0.2% glucose (PYE+Glu), Tet, and Kan. Noantibiotics were added in the final liquid culture for polyribosomepreparation.

View this table:
[in this window]
[in a new window]
TABLE 1. Bacterial strains and plasmids used in this study

Construction of epitope-tagged CgtA_C-3HA. Relevant plasmids used in this study are listed in Table 1.C-terminal deletion cgtA_C^1-347 was generated by PCR amplificationusing primers cgtA-NcoI (5'-GGACCCCATGGAATTCTTGGACCA) and cgtA-347delta(5'-TCTAGAGGATCCCCTCGTCGACGTGATCCT), whereas cgtA_C^1-334 wasgenerated using primers cgtA-NcoI and cgtA-334delta (5'-TCTAGAGGATCCCGAGATCACCGCGACGGAT).Through a series of subclones, a C-terminal BamHI-HindIII influenzavirus hemagglutinin tag (3HA tag) from pFA6a-3HA-TRP1 (31) wasadded to create the cgtA^1-347-3HA fusion construct (pJM2383).3HA-tagged mutant alleles (T192A and T193A) were generated bysubstitution of the NcoI-XhoI fragments from the appropriatemutant allele clones into pJM2383 (30). The cgtA^1-347 and thecgtA^1-347-3HA fusions were placed under the control of the cgtApromoter by replacement of the NcoI-HindIII fragment from pJM1759(a modified C. crescentus pMR20 plasmid that contains the cgtApromoter and cgtA with an engineered Nco1 site at the initiatingcodon) with cgtA^1-347 or cgtA^1-347-3HA. The full-length cgtA-3HAconstruct was generated by PCR amplification of cgtA_C throughthe use of CgtA-NcoI and C-PacIXbaI-CgtA (5' GCTCTAGATCTTAATTAACGGCGTCCAGCC),tagging with 3HA, and expression from the cgtA promoter in amanner analogous to that used for the cgtA^1-347 and cgtA^1-347-3HAfusion constructs. The final constructs of all 3HA-tagged cgtAalleles were verified by DNA sequencing of the cgtA gene, junctionregions of the PcgtA promoter, and the 3HA tag.

Affinity purification of CgtA_C antibody. Polyclonal rabbit anti-CgtA_C antibody was affinity purifiedfrom crude antiserum with Affi-Gel 15 (Bio-Rad) agarose beadscoupled with purified CgtA_C protein (28). All steps were performedat 4°C unless otherwise specified. Approximately 25 mg ofpurified CgtA_C protein was incubated with 1 ml of Affi-Gel 15beads in a final volume of 1.5 ml of HEPES buffer (100 mM, pH8) for 30 min. The coupling efficiency was at least 95%, asdetermined by a Bradford assay (Bio-Rad) (catalog no. 500-000).The remaining active sites on the Affi-Gel were subsequentlyblocked with 10 mM ethanolamine-HCl (1 M stock, pH 8) for 1h. The CgtA_C-coupled Affi-Gel (CgtA_C-Affi-Gel) was equilibratedwith phosphate-buffered saline (100 mM NaCl, 80 mM Na₂HPO₄,20 mM NaH₂PO₄, pH 7.5) containing 0.05% Tween 20 (PBST) and0.2% sodium azide.

For immunoaffinity purification of anti-CgtA_C antibody, approximately0.3 ml of CgtA_C-Affi-Gel beads was combined with 0.5 ml of crudeantiserum and brought to a final volume of 1 ml with PBST and10% bovine serum albumin (BSA). The mixture was incubated overnightwith gentle shaking. The beads were incubated on ice for 5 min,pelleted in a 1.75-ml microcentrifuge tube (with a small cut2 to 4 mm from the bottom) at 2,000 x g for 3 min, and thenwashed five times with 1 ml of PBST. Anti-CgtA_C was eluted frombeads three times with 0.1 ml of glycine-HCl (50 mM [pH 2.5]in 0.1% Tween 20), once with 0.1 ml of BSA (10% in PBST), andonce with 0.1 ml of Tris-HCl (1.5 M, pH 7.5) by centrifugationat 2,000 x g for 3 min. Eluted samples were combined and storedat -80°C in 10-µl aliquots. The specificity and titerof the purified anti-CgtA_C were tested by immunoblot analysis.

Immunoblot analysis. Proteins were separated by sodium dodecyl sulfate-12% polyacrylamidegel electrophoresis (SDS-12% PAGE) and electroblotted to polyvinylidenedifluoride membranes (NEN Life Science Products) with a Hoeffersemidry transfer apparatus as recommended by the manufacturer.The membranes were blocked with 10% skim milk in PBST, probedwith either a 1:2,000 dilution of affinity-purified polyclonalrabbit anti-CgtA or a 1:1,000 dilution of monoclonal mouse anti-HA(ascites fluid, clone 16B12; BAbCO), and washed with PBST; boundantibody was detected with a 1:20,000 dilution of horseradishperoxidase-conjugated goat anti-rabbit (Pierce) or rabbit anti-mouse(Sigma) antibody, respectively, and visualized by fluorographyusing ECL (Amersham Pharmacia Biotech) as recommended by themanufacturer.

Preparation of C. crescentus cell lysates. C. crescentus cell lysates were prepared according to Ohta etal. (38) and Flessel et al. (15) with the following modifications.Briefly, 500 ml of PYE cultures of C. crescentus cells was grownat 30°C to an optical density at 600 nm (OD₆₀₀) of 0.6 to0.8. Chloramphenicol was added to a final concentration of 100µg/ml 3 min prior to harvesting. Cells were immediatelychilled by pouring over an equal volume of crushed ice and harvestedby centrifugation (10,000 x g, 15 min). The cell pellet waswashed with 20 ml of ice-cold TE (100 mM Tris-HCl [pH 7.5],1 mM EDTA) and resuspended in 5 ml of SETS buffer (100 mM NaCl,1 mM EDTA, 100 mM Tris-HCl [pH 7.5], 17% sucrose) containing100 mg of lysozyme (Sigma)/ml and 100 µg of phenylmethylsulfonylfluoride (10 mg/ml of stock in ethanol)/ml. All subsequent operationswere performed at 4°C. After 30 min of lysozyme treatment,MgCl₂ (1 M stock) was added to restore the magnesium concentrationto 20 mM unless otherwise indicated. Spheroplasts were monitoredunder a phase-contrast microscope and centrifuged for 20 minat 10,000 x g. The pellet was resuspended in 2 ml of TM buffer(10 mM Tris-HCl [pH 7.5], 10 mM MgCl₂) containing 100 µgof chloramphenicol/ml, 100 µg of phenylmethylsulfonylfluoride/ml, and Complete EDTA-free protease inhibitor cocktail(Roche Molecular Biochemicals) (1 tablet/50 ml). The spheroplastswere disrupted by the addition of sodium deoxycholate (10% stock)and Brij 58 (10% stock) to achieve a final concentration of1% each. The crude lysate was frozen in liquid nitrogen andslowly thawed in an ice-water bath. After centrifugation at20,000 x g for 20 min, the clarified lysate was stored at -80°Cin 0.5-ml aliquots. UV absorbance of the cell lysate was determinedin a 1-ml quartz cuvette.

Polyribosome fractionation. Cell lysates (200 µl) at an OD₂₆₀ of approximately 20were subjected to ultracentrifugation in 10 ml of 15 to 45%sucrose (ARCOS) RNase- and DNase-free gradients for 3 h at 41,000rpm (210,000 x g) and 0°C in a Beckman SW41Ti rotor. Higher-resolutionseparation was performed using 20 to 40% sucrose gradients ata lower speed (84,000 x g) (Fig. 1B). Sucrose solutions contained100 mM NH₄Cl in TM buffer, and the gradients were prepared (10).The resulting polyribosomes were fractionated by a Brandel gradientfractionator (model BR-186) (2-mm-path-length flow cell) connectedto a syringe pump (model SYR-101). The syringe was filled with50% sucrose in distilled water, and the pump flow rate was setto 0.75 ml/min. The UV absorbance (280 nm) of the sample wasmonitored and recorded by an ISCO UA-5 detector. A total of10 µl from each fraction was analyzed by SDS-PAGE andimmunoblotting. In experiments examining the effects of excessguanine nucleotides on CgtA-ribosome association, the cell lysateswere preincubated with 10 mM GDP or GTP and sedimented througha sucrose gradient in standard buffer with additional 250 µMGDP or GTP, respectively. A parallel blank control (loaded with200 µl of 10 mM GDP on top of the sucrose gradient containing250 µM GDP) was used, and the resulting UV absorbanceprofile confirmed that the distribution of guanine nucleotidein the sucrose gradient after ultracentrifugation was unaltered(data not shown).

View larger version (21K):
[in this window]
[in a new window]
FIG. 1. CgtA_C cofractionates with the 50S ribosomal subunit by sucrose density centrifugation. CB15N cells were grown to logarithmic phase in PYE medium and harvested, and cell lysates were prepared and sedimented through a 15 to 45% sucrose gradient at 210,000 x g for 3 h (A) or a 20 to 40% sucrose gradient at 84,000 x g for 12 h (B). UV profiles were monitored at 280 nm. The positions of the 30S, 50S, and 70S monosome and polyribosome peaks relative to those of the fractions collected are indicated. Immunoblots of relevant fractions (10 µl of each 1-ml fraction) separated by SDS-12% PAGE and the levels of CgtA_C detected with anti-CgtA_C antibodies are shown below each polyribosome trace. S, 10 ng of purified CgtA_C; L, 1 µl of cell lysate (OD₂₆₀ of 0.1).

Gel filtration chromatography. C. crescentus cell lysates (0.5 ml) were loaded onto a 100-ml(1.5 by 70 cm) Toyopearl HW-55S column (TosoHaas) eluted (0.4ml/min) with TMA buffer (10 mM TrisHCl [pH 7.5], 10 mM MgCl₂,100 mM NH₄Cl) at 4°C. Fractions (1 ml) were collected fromelution volumes of between 20 and 100 ml. When indicated, thecell lysates were preincubated with 10 mM GDP or GTP for 30min on ice prior to loading and subsequently eluted with TMAbuffer containing 1 mM GTP or 1 mM GDP, respectively. Samples(20 µl) from alternate fractions were subjected to SDS-PAGEfollowed by immunoblot analysis. The column was calibrated witha 0.5-ml mixture of thyroglobulin (Sigma) (669 kDa, 0.25 mg),ß-amylase (Sigma) (200 kDa, 0.25 mg), BSA (Sigma)(66 kDa, 0.25 mg), and bovine carbonic anhydrase (Sigma) (29kDa, 0.25 mg) under the same elution conditions.

RESULTS

Top

Results

CgtA_C cosediments with free 50S ribosomal subunits. In B. subtilis, Obg fractionates as a large cytoplasmic complexcontaining ribosomal proteins and interacts with the 50S ribosomalsubunit protein L13, according to the results of an affinityblot assay (42). The E. coli CgtA_E protein also interacts withL13 and purifies in a large RNA-containing complex (Pu and Maddock,unpublished) but does not associate with the large ribosomalsubunit after sucrose density centrifugation (25). To examinethe relationship between the ribosome and C. crescentus CgtA_Cprotein, we separated cell lysates by ultracentrifugation througha sucrose gradient (10, 15, 38), monitored the polyribosomeprofile by UV absorbance, and detected the migration of CgtA_Cby immunoblot analysis (Fig. 1). As expected, the majority ofthe cellular proteins and small molecules were in the top ofthe gradient, followed by the peaks for the 30S and 50S subunitsand the 70S ribosomes and polyribosomes. CgtA_C was located infractions corresponding to the peak of free 50S ribosomal subunits(Fig. 1A). To examine whether CgtA_C cosedimented with ribosomalintermediate particles adjacent to the 50S peak (32, 40), theprofile of CgtA_C was examined after sucrose density centrifugationunder conditions that result in a greater separation of theribosomal subunits. Under these conditions, CgtA_C also coelutedwith the mature 50S subunit, although low levels of CgtA_C werefound in fractions preceding the 50S peak, perhaps due to thedissociation of CgtA_C from the 50S subunits during centrifugationor due to an interaction with the pre-50S subunits (Fig. 1B).

Salt dependence of the association of CgtA_C with 50S ribosomal subunits. Ammonium chloride (NH₄Cl) has been widely employed as a saltin buffers used for polyribosome profiles, although specificassay conditions differ widely among different reports (36).To test the effects of NH₄Cl concentration on CgtA_C-50S subunitassociation, lysates of C. crescentus were sedimented throughsucrose gradients containing 10 mM Tris-HCl (pH 7.5) supplementedwith 10 mM MgCl₂ and concentrations of NH₄Cl ranging from 0to 200 mM. No difference in gradient profile was observed regardlessof the concentration of NH₄Cl present (Fig. 2A). Moreover, whenseparated in the absence of NH₄Cl, CgtA_C was still found predominantlyin 50S fraction peaks with a trace amount of CgtA_C at the topof the gradient (Fig. 2A) and in fractions prior the 50S peak(data not shown). Thus, CgtA_C bound to free 50S ribosomal subunitsindependently of the NH₄Cl concentrations used.

View larger version (13K):
[in this window]
[in a new window]
FIG. 2. Salt dependence of the association of CgtA_C with free 50S ribosomal subunits. CB15N cell lysates (200 µl, OD₂₆₀ of 20) were sedimented through 15 to 45% sucrose gradients containing 0 to 200 mM NH₄Cl (as indicated) in 10-mM Tris-HCl (pH 7.5) buffer supplemented with either 10 mM MgCl₂ (A) or 10 mM MgSO₄ (B). Polyribosome profiles similar to that shown in Fig. 1 were obtained, and the fractions corresponding to the top (T) of the gradients and the 50S peaks (50S) were separated by SDS-12% PAGE. Each lane was loaded with 10 µl of a 1-ml fraction, and the levels of CgtA_C were detected by immunoblotting using anti-CgtA_C antibodies. S, 2 ng of purified CgtA_C.

Information regarding the source of the Mg²⁺ ion present insucrose gradient buffers also differs among different reports.To address whether the source of the Mg²⁺ ion was importantin the binding of CgtA_C to the 50S subunit, we examined theconsequences of the use of various levels of NH₄Cl in 10 mMTris-HCl (pH 7.5) supplemented with 10 mM MgSO₄. Under theseconditions, we observed an NH₄Cl concentration-dependent 50Sassociation of CgtA_C with the 50S peak. In buffers containinglow levels of NH₄Cl, CgtA_C did not bind to the 50S subunit andwas exclusively found at the top of the gradient (Fig. 2B).Some CgtA_C-50S cofractionation was observed in buffers containinghigher NH₄Cl concentrations; even in the presence of 200 mMNH₄Cl, however, a significant amount of CgtA_C was in the topof the gradient (Fig. 2B). Thus, the combination of the Mg²⁺counter ion used and NH₄Cl concentration is critical for theobserved association of CgtA_C with the 50S ribosomal subunit.

Inclusion of excess GTP or GDP does not affect the cosedimentation of CgtA_C with the 50S subunit. As a guanine nucleotide protein, CgtA_C undergoes conformationalchanges among the GTP-bound, GDP-bound, and apo states (30).It is therefore possible that the guanine nucleotide occupancyof CgtA_C could affect its association with free 50S subunits.To examine whether this is the case, C. crescentus cell lysatespreincubated with either 10 mM GDP or GTP were sedimented through15 to 45% sucrose gradients in standard buffers containing 250µM GDP or GTP, respectively. Because in vitro CgtA_C bindsguanine nucleotides with moderate affinity ( $~$ 1 µM) anddisplays a rapid guanine nucleotide exchange rate (28), we predictedthat under these conditions the majority of the CgtA_C proteinwould be nucleotide bound. As observed in the absence of guaninenucleotides (Fig. 2), the majority of CgtA_C cofractionated withthe 50S ribosomal subunit irrespective of the presence of eitherGDP or GTP (Fig. 3). Therefore, it appears that CgtA_C bindsto the free 50S ribosomal subunit independently of its nucleotideoccupancy state.

View larger version (20K):
[in this window]
[in a new window]
FIG. 3. The addition of excess guanine nucleotides does not affect the association of CgtA_C and free 50S ribosomal subunits. CB15N cell lysates (200 µl, OD₂₆₀ of 20) were preincubated on ice without (+None) or with 10 mM GDP (+GDP) or 10 mM GTP (+GTP) for 30 min prior to sedimentation through a 15 to 45% sucrose gradient supplemented with no nucleotide, 250 µM GDP, or 250 µM GTP, respectively. Polyribosome profiles similar to that shown in Fig. 1 were obtained, and the fractions corresponding to the top (T) of the gradients and the 50S peaks (50S) were separated by SDS-12% PAGE. Each lane was loaded with 10 µl of a 1-ml fraction, and the levels of CgtA_C were detected by immunoblotting using anti-CgtA_C antibodies. S, 2 ng of purified CgtA_C.

CgtA_C is not associated with the 50S particle by gel filtration. The bacterial 50S ribosomal subunit consists of an $~$ 1,000-kDa23S rRNA molecule, an $~$ 40-kDa 5S rRNA molecule, and over 31 ribosomalproteins with an average molecular mass of 15 kDa each (34).Thus, the overall size of the 50S subunit complex exceeds 1.4MDa. To examine whether the CgtA_C protein binds tightly to the50S particle, we examined the elution of CgtA_C from C. crescentuscell lysates separated by gel filtration on a 100-ml ToyopearlHW-55S gel filtration column (fractionation range of 1 to 10³kDa for globular proteins) (Fig. 4). The majority of CgtA_C elutedin fractions corresponding to 30 to 200 kDa, peaking at approximately50 kDa (Fig. 4), indicating that a significant amount of CgtA_Cfractionates as monomers or small complexes. To assay whetherthe guanine nucleotide binding state of CgtA_C affected its chromatographicmigration, cell lysates were preincubated with 10 mM GDP orGTP and eluted in buffer containing 1 mM GDP or 1 mM GTP, respectively.Under these conditions, no change in CgtA_C elution was detected(data not shown). Thus, we conclude that, regardless of itsnucleotide occupancy, CgtA_C does not bind tightly to the 50Sribosomal subunit.

View larger version (42K):
[in this window]
[in a new window]
FIG. 4. Gel filtration chromatography of a C. crescentus CB15N cell lysate reveals that the majority of CgtA_C elutes as a monomer or in a small complex. CB15N cell lysates (0.5 ml) were fractionated through a 100-ml (1.5 by 70 cm) Toyopearl HW-55S column (TosoHaas) at a flow rate of 0.4 ml/min in TMA buffer (10 mM Tris-HCl [pH 7.5], 10 mM MgCl₂, 100 mM NH₄Cl). (A) The elution of samples was monitored by UV absorbance at 280 nm, and 1-ml fractions were collected using elution volumes between 20 and 100 ml. The elution positions of control proteins are indicated. (B) The indicated fractions (10 µl each) were separated by SDS-12% PAGE. The levels of CgtA_C were detected by immunoblotting using anti-CgtA_C antibodies. S, 2 ng of CgtA.

C-terminally epitope-tagged CgtA_C variants are impaired for in vivo function. CgtA_C is 354-amino-acid tripartite protein possessing an N-terminalglycine-rich domain called the Obg-fold (amino acids 1 to 159)(2), a GTP-binding domain (amino acids 160 to 314), and a C-terminalacidic domain (EEEIDDDEDHVDE; amino acids 335 to 347). We havepreviously shown that the N-terminal Obg-fold is critical forCgtA_C function (29). To address whether the charged C terminusof CgtA_C is also important for function, we made C-terminaltruncation constructs and examined their ability to supportgrowth as the sole expressed source of CgtA_C. To do this, wetook advantage of a C. crescentus strain (JM1108) in which thechromosomal cgtA_C is under the control of the Pxyl promotersuch that expression of chromosomal cgtA_C is repressed by achange of carbon source from xylose (Xyl) to glucose (Glu).JM1108 cells containing a plasmid-borne cgtA_C allele grow inPYE+Glu (30) (Fig. 5). Episomal expression of cgtA_C lackingthe terminal 7 amino acids (cgtA_C^1-347) also supports growth(Fig. 5), whereas CgtA_C lacking the acidic domain (cgtA_C^1-334)does not (data not shown). Thus, modest C-terminal deletionsare not deleterious to CgtA_C function, whereas removal of theacidic domain results in a nonfunctional protein.

View larger version (57K):
[in this window]
[in a new window]
FIG. 5. Modification of the CgtA_C C terminus affects function. Serial dilutions of cultured JM1108 cells containing pMR20 plasmids expressing cgtA_C, no protein (None), cgtA_C-3HA, cgtA_C^1-347, or cgtA_C^1-347-3HA were spotted onto PYE+Xyl and PYE+Glu plates. The plates were incubated at 30°C for 2 days.

To examine whether CgtA_C^1-347 associates with the 50S ribosomalsubunit, we epitope-tagged full-length CgtA_C and cgtA_C^1-347so that they could be specifically identified in cell lysatesexpressing untagged chromosomal cgtA_C. The full-length protein,CgtA_C-3HA, supports growth of JM1108 on PYE+Glu, albeit at aslightly reduced rate compared to untagged CgtA_C (Fig. 5). Likewise,the cgtA_C^1-347-3HA allele supports growth but at a lower ratethan that with its untagged counterpart (Fig. 5). Moreover,whereas the growth rates of cells expressing CgtA_C or CgtA_C^1-347were indistinguishable, cells expressing the cgtA_C^1-347-3HAallele grew more slowly than those with the cgtA_C-3HA allele.Thus, it appears that the C-terminal addition of the 3HA tagresults in a partial loss of CgtA_C function and that the combinationof deletion of the seven C-terminal amino acids and additionof the 3HA tag further perturbs CgtA_C, underlining the importanceof the C-terminal acidic domain to CgtA_C function. To test whetherthe observed differences in in vivo function were caused bya variation in protein expression, JM1108 cells harboring 3HA-taggedcgtA_C alleles were grown in PYE+Xyl and analyzed by immunoblottingusing monoclonal anti-HA and/or affinity-purified anti-CgtA_Cantibodies. All 3HA-tagged proteins (including the T192A andT193A variants described below) containing full-size CgtA_C orC-terminally truncated CgtA_C^1-347 were expressed at similarlevels, confirming that the growth differences among strainsgrowing in glucose were not due to changes in steady-state proteinlevels (data not shown).

There are two conserved threonine residues within the GTP-bindingdomain of CgtA_C. The first, T192, is critical for CgtA_C function,whereas the adjacent threonine, T193, is not essential but exhibitsa minor defect in binding GDP and GTP (30). As expected, plasmid-encodedCgtA_CT192A-3HA does not support growth of JM1108 on PYE+Glu(Fig. 6). Interestingly, whereas plasmid-encoded CgtA_CT193Asupports growth of JM1108 in PYE+Glu (30), CgtA_CT193A-3HA doesnot (Fig. 6). We propose that the slight defect in guanine nucleotidebinding caused by the T193A mutation and the reduction in functioncaused by the addition of the C-terminal 3HA tag are negativelysynergetic.

View larger version (54K):
[in this window]
[in a new window]
FIG. 6. Growth of tagged CgtA_C GTP-binding domain mutants. Serial dilutions of cultured JM1108 cells containing pMR20 plasmids expressing cgtA_C, no protein (None), cgtA_C-3HA, cgtA_CT192A-3HA, or cgtA_CT193A-3HA were spotted onto PYE+Xyl and PYE+Glu plates. The plates were incubated at 30°C for 2 days.

To examine whether the tagged CgtA_C variants were associatedwith the 50S ribosome subunit in the context of wild-type CgtA_C,polyribosome profiles of JM1108 expressing the tagged CgtA_Cwere examined by immunoblot analysis. In JM1108 cells expressingplasmid-encoded CgtA_C-3HA, the chromosomally encoded CgtA_C wasfound in the 50S fractions (Fig. 7B) whereas the CgtA_C-3HA wasin the top of the gradient (Fig. 7A). Not surprisingly, theplasmid-encoded 3HA-tagged mutant CgtA_C proteins CgtA_C^1-347-3HA,CgtA_CT192-3HA, and CgtA_CT193A-3HA were also found in the topof the gradient in their respective cell lysates (Fig. 7). Thus,the 3HA-tagged proteins either were unable to bind the 50S subunits,were displaced during the sucrose density centrifugation, orcould not compete with wild-type CgtA in binding with 50S ribosomalsubunits.

View larger version (50K):
[in this window]
[in a new window]
FIG. 7. The C-terminally 3HA-tagged CgtA_C proteins failed to cosediment with free 50S ribosomal subunits in the cell lysates. C. crescentus JM1108 cells expressing cgtA_C^1-347-3HA (second and third lanes), cgtA_C-3HA (fourth and fifth lanes), cgtA_C^T192A-3HA (sixth and seventh lanes), and cgtA_C^T193A-3HA (eighth and ninth lanes) episomally from pMR20 were grown to logarithmic phase in PYE+Xyl medium and harvested. Cell lysates were independently sedimented through a 15 to 45% sucrose gradient prepared in 10 mM Tris-HCl (pH 7.5)-10 mM MgCl₂-100 mM NH₄Cl. A total of 10 µl of each 1-ml fraction from the top of the gradient (T) and the free 50S ribosomal subunit peak (50S) was separated by SDS-12% PAGE. The results of immunoblotting with duplicate gels prepared using monoclonal anti-HA antibody (A) and anti-CgtA_C (B) antibodies are shown. S, 2 ng of purified CgtA_C.

Depletion of CgtA_C in C. crescentus resulted in a modest reduction of 70S ribosomes and polyribosomes. To further investigate the relationship between ribosomes andthe function of CgtA_C, the effects of depleting CgtA_C on polyribosomeprofiles were examined. Wild-type cells (CB15N) and cells containingcgtA under the control of the Pxyl promoter (JM1108) were grownto mid-exponential phase in PYE+Xyl, washed with PYE, resuspendedat low density in either PYE+Xyl or PYE+Glu medium, and grownat 30°C for 6 h, a time when the vast majority of CgtA_Cprotein is depleted, cell viability decreases, and cell growthis slowed (30). Lysates were subjected to sedimentation througha sucrose gradient. In CB15N cells, a shift from PYE+Xyl toPYE+Glu had no effect on the resulting polyribosome profile(Fig. 8). JM1108 cells grown in PYE+Xyl had profiles similarto that of CB15N (Fig. 8). In contrast, JM1108 cells grown inPYE+Glu contained reduced levels of 70S monosomes and polyribosomeswhereas the levels of free 30S and 50S ribosomal subunits werenot affected (Fig. 8). These data demonstrate that a long-termconsequence of CgtA_C depletion (either direct or indirect) isa reduction in translating ribosomes. A minor 60S peak is observedin all of our preparations but is particularly visible in JM1108grown in glucose, due to the reduction of the 70S peak. A similarlysized peak has been reported previously (50), and is predictedto be due to alternate 30S-50S couples.

View larger version (16K):
[in this window]
[in a new window]
FIG. 8. Long-term depletion of CgtA_C reduces the levels of 70S ribosomes and polyribosomes. Wild-type C. crescentus cells (CB15N) and cells containing cgtA under the control of the Pxyl promoter (JM1108) were grown to mid-exponential phase in PYE+Xyl, washed with PYE, resuspended at low density in either PYE+Xyl or PYE+Glu medium, and grown at 30°C for 6 h. Cell lysates were sedimented through 15 to 45% sucrose gradients, and the resulting UV absorbance profiles were recorded.

DISCUSSION

Top

Discussion

Ribosome assembly occurs through the coordinated assembly ofspecific proteins on the nascent rRNA coupled with temporalrRNA processing and modification. In eukaryotes, there are approximately200 proteins required for the biogenesis and export of the ribosomalsubunits (see reference 49 for a review). Putative remodelingproteins such as helicases, AAA ATPases, and GTPases are includedin these ribosomal assembly factors. In E. coli, active smalland large ribosomal subunits can be spontaneously assembledin vitro without the need for ribosome assembly factors (8,20). This in vitro assembly, however, requires elevated temperatures,high Mg²⁺ levels, and extended incubation times, indicatingthat in vivo, additional factors are necessary for optimal ribosomalassembly.

GTP-binding proteins associated with ribosomal precursor particlesare likely candidates for such assembly factors. Interestingly,the eukaryotic Obg protein, Nog1p, copurifies with a wide rangeof pre-60S intermediates (1, 14, 18, 37) and is critical for60S assembly (22, 24). Therefore, it is possible that the Obgproteins in archaea and bacteria also play a role in large ribosomebiogenesis. In this study, we demonstrated that CgtA_C is associatedwith the free 50S ribosomal subunits but not with the mature70S monosomes or with polyribosomes. Since CgtA_C is not a proteinassociated with translating ribosomes but is exclusively associatedwith the free mature or pre-50S ribosomal subunits, it is astrong candidate for a bacterial ribosomal assembly factor.

The conditional dependence on NH₄Cl concentration for CgtA_Cbinding to the 50S subunit is of interest. In the presence of10 mM MgCl₂, CgtA_C cosediments with the 50S subunit at similarlevels over a wide range of NH₄Cl concentrations. In bufferscontaining 10 mM MgSO₄, however, the majority of CgtA_C remainedin top of the gradient and the amount of CgtA detected in thefractions of the 50S subunit increased in correspondence tothe addition of excess NH₄Cl. Recently, it was reported thatthe E. coli CgtA_E protein was not detected in ribosomal fractionswhen the cell lysates were prepared and sedimented in bufferscontaining 100 mM (NH₄)₂Ac and 15 mM MgAc (25). It is possiblethat divalent anions such as SO₄^2- or Ac^2- might inhibit CgtA_Cbinding to 50S subunits.

The total intracellular ionic concentration in bacterial cellsis estimated to be in the range of 150 to 550 mM, dependingon the osmolarity of the medium (7, 21, 46); therefore, thebuffers containing 100 mM NH₄Cl used in this study should representan ionic strength close to that of the intracellular ionic environment.In sucrose gradient sedimentation, the CgtA_C-50S ribosomal subunitcomplex withstands NH₄Cl concentrations ranging from 0 to 200mM, suggesting that CgtA_C binds free 50S ribosomal subunitsin vivo. In gel filtration experiments, however, CgtA_C fromcell lysates did not elute with the 50S ribosomal particle inbuffer containing 100 mM NH₄Cl. This paradox could be explainedby the equilibrium between the CgtA_C-50S subunit complexes andfree CgtA_C monomers. In single-phase solutions such as celllysates and sucrose gradients, CgtA_C would have access to the50S subunits and the binding equilibrium would favor the CgtA_C-50Scomplexes. In a multiphase environments such as gel filtration,however, dissociated 50S subunits and CgtA_C protein would beseparated into two mobile phases. The large 50S complex wouldelute in the void volumes, whereas the free CgtA_C would migrateslowly through the porous resin. Interestingly, the B. subtilisObg and E. coli CgtA_E proteins have been shown to fractionatein a large cytoplasmic complex by gel filtration (42) (Pu andMaddock, unpublished). Perhaps the use of low-salt buffers inthese studies increased the stability of the protein-50S complex.Alternatively, there may be species-specific differences inthe affinity of the Obg proteins with the 50S ribosomal subunits.

The addition of excess GDP or GTP to the cell lysates had nodetectable effects on the association of CgtA_C with 50S ribosomalparticles. CgtA_C has a moderate affinity for both GTP and GDPand rapidly exchanges its bound nucleotide in vitro (28). Therefore,in vivo, unless exchange is inhibited in the CgtA_C-50S complexthe occupancy state of CgtA_C should reflect that of the nucleotidepools. The results in this study suggest that the state of guaninenucleotide occupancy of CgtA_C does not affect its binding ordissociating free 50S ribosomal subunits. It will be of interestto examine the association of CgtA_C with 50S ribosomal subunitsin cells at the stationary phase, when the intracellular levelsof GDP should increase relative to that of GTP.

The details of CgtA_C association with the 50S ribosomal subunitare unknown. Since the B. subtilis and E. coli Obg proteinsassociate with L13 (42) (Pu and Maddock, unpublished), it islikely that interaction with L13 mediates at least part of thisinteraction. In addition, CgtA_E interacts with SpoT in a yeasttwo-hybrid screen (Pu and Maddock, unpublished); therefore,contacts with SpoT may also be critical for ribosome association.In this study, we uncovered a requirement for the C-terminalseven amino acids for both optimal CgtA_C function and for associationwith the 50S ribosomal particles. Interestingly, strains expressingfull-length or slightly truncated cgtA_C alleles epitope taggedwith 3HA grew more slowly than the cells expressing their untaggedcounterparts, indicating that the addition of the tag was alsodetrimental for protein function. Moreover, none of the CgtA_C-3HAproteins associated with the 50S ribosomal particle when coexpressedwith wild-type CgtA_C. Thus, either deletion of C-terminal sequencesor the addition of a C-terminal tag affects CgtA_C function and/orribosome association.

CgtA_C may play a role in ribosome assembly. The majority ofCgtA_C associates with a 50S particle but not with the 70S monoribosomesor with polyribosomes. The 50S peak is composed of newly synthesized50S ribosomal subunits, recycled 50S ribosomal subunits (i.e.,subunits dissociated from runoff mature ribosomes after transcription),and late pre-50S ribosomal precursors (23, 32, 35). The long-termeffect of CgtA_C depletion was a reduction in the level of mature70S ribosomes and polyribosomes, whereas the levels of bothfree 30S and 50S subunits were relatively unchanged. It is possiblethat CgtA_C acts at a late step in 50S subunit maturation. Sucha role would be consistent with the ability of the E. coli CgtA_Eprotein to act as a high-copy-number suppressor of both thegrowth and polysome defect of an rRNA methyltransferase mutant, ${Delta}$ rrmJ (47).

The bacterial Obg proteins clearly play a cellular role beyondthat of a translation factor. Obg proteins display essentialfunctions in a wide variety of distinct cellular processes,such as cell growth and differentiation (39, 48, 51), DNA replication(26), chromosome segregation, and cell division (9, 11, 25,43). In addition, the B. subtilis Obg protein is necessary foractivation of the general stress response transcription factor, ${sigma}$ ^B (41). Under conditions of environmental stress (i.e., heat,ethanol, salt, or acid treatment) or during energy depletion(i.e., decrease of cellular ATP concentration), ${sigma}$ ^B is activatedthrough the coordinate activities of the Rsb proteins and Obg.Obg in turn, interacts directly with RsbT, RsbW, and RsbX (42).A widespread role for Obg function in stress response, however,cannot be mediated through ${sigma}$ ^B, as most bacteria do not have a ${sigma}$ ^B-regulated stress response pathway. In E. coli, for example,this activity is primarily regulated by ${sigma}$ ^S, a sigma factor thatregulates many cellular responses that accompany entry intostationary phase, nutrient starvation (stringent condition),or shift to high osmolarity or low pH (for a review, see reference19). The activation of ${sigma}$ ^S is controlled, in part, by the alarmone(p)ppGpp (16). (p)ppGpp is synthesized by the ribosome-associatedsynthase, RelA. When cells enter into the stationary phase orare starved for one or more amino acids, RelA is activated andSpoT [a (p)ppGpp synthetase-hydrolase] is inactivated, resultingin increasing levels of (p)ppGpp (see reference 6 for a review).Intriguingly, the E. coli CgtA_E protein interacts directly withSpoT (Pu and Maddock, unpublished), raising the possibilitythat CgtA_E is also involved in stress response. One intriguingpossibility is that the Obg proteins are involved in coordinatingribosome assembly and stress response. Studies are in progressto directly test this possibility.

ACKNOWLEDGMENTS

We are particularly grateful to the members of the Maddock laband to Sue Sullivan for critical reading of the manuscript.

This work was supported by grant GM-55133 from the NationalInstitutes of Health.

FOOTNOTES

* Corresponding author. Mailing address: Department of Molecular, Cellular and Developmental Biology, University of Michigan, 830 North University, Ann Arbor, MI 48109-1048. Phone: (734) 936-8068. Fax: (734) 647-0884. E-mail: maddock{at}umich.edu.

Present address: NABI Biopharmaceuticals, Rockville, MD 20852.

REFERENCES

Top