This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Porat, I.
Right arrow Articles by Barak, Z.'e.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Porat, I.
Right arrow Articles by Barak, Z.'e.

 Previous Article  |  Next Article 

Journal of Bacteriology, January 2004, p. 570-574, Vol. 186, No. 2
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.2.570-574.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Cloning and Characterization of Acetohydroxyacid Synthase from Bacillus stearothermophilus

Iris Porat,1,{dagger} Michael Vinogradov,1 Maria Vyazmensky,1 Chung-Dar Lu,2 David M. Chipman,1 Ahmed T. Abdelal,3 and Ze'ev Barak1*

Department of Life Sciences, Ben-Gurion University of the Negev, Beer-Sheva, 84105 Israel,1 Biology Department, Northeastern University, Boston, Massachusetts 02115-5000,3 Department of Biology, Georgia State University, Atlanta, Georgia 303032

Received 20 June 2003/ Accepted 3 October 2003


arrow
ABSTRACT
 
Five genes from the ilv-leu operon from Bacillus stearothermophilus have been sequenced. Acetohydroxyacid synthase (AHAS) and its subunits were separately cloned, purified, and characterized. This thermophilic enzyme resembles AHAS III of Escherichia coli, and regulatory subunits of AHAS III complement the catalytic subunit of the AHAS of B. stearothermophilus, suggesting that AHAS III is functionally and evolutionally related to the single AHAS of gram-positive bacteria.


arrow
INTRODUCTION
 
The first step common to the biosynthesis of branched-chain amino acids, catalyzed by acetohydroxyacid synthase (AHAS) (EC 4.1.3.18), is the condensation of pyruvate with either 2-ketobutyrate (the precursor of isoleucine) or pyruvate (the precursor of valine) (4, 26). Bacterial AHASs are composed of large (60-kDa) catalytic and small (9- to 18-kDa) regulatory subunits. Isolated catalytic subunits have lower activity than the holoenzymes but are similar to them in their cofactor dependence and specificity towards the two different substrates (10, 27, 28). The sensitivity of AHAS to feedback inhibition is completely dependent on the small subunit.

Many bacteria and archaea apparently contain a single AHAS enzyme. In most gram-positive bacteria, the genes for the first two enzymes in the pathway are located in the same operon (ilvBNC) (5, 9, 13, 15, 30), often together with the leu genes (ilvBNC-leuACBD) (17, 25, 30). The enterobacteria contain three isozymes of AHAS, encoded by distinct and differently regulated operons (3, 4).

To investigate the AHAS of Bacillus stearothermophilus (AHASBst), we cloned the genes for this holoenzyme (ilvBN) and its large (ilvB) and small (ilvN) subunits to allow sequencing and overexpression. The screening for these genes was conducted with a genomic cosmid library for B. stearothermophilus ATCC 7954, created by H. Ewis (unpublished data), with a digitonin-labeled 1,100-bp probe that is highly conserved (50 to 75% amino acid identity) among AHASs (7) and only slightly conserved in other thiamine diphosphate (ThDP)-dependent enzymes, such as pyruvate oxidase (30%) and catabolic acetolactate synthase (25%) of Bacillus subtilis. This probe was amplified from the B. stearothermophilus ATCC 12980 genome by using two degenerate oligonucleotide primers: 5'(C/T/A)GGNACNGA(T/C)GCNTT(T/C)CA(A/G)GA and 5'T(C/G)(C/T)TGCCA(C/T)(T/G)NACCAT.

The gene order in the insert of the AHAS-positive cosmid, as determined by coding analysis of its sequence (Fig. 1), seems similar to that of the B. subtilis ilv-leu operon (16, 30). The 5' end of ilvB was absent in the cosmid-cloned fragment. This region was added to the clone, as shown in Fig. 1, from a PCR-amplified fragment obtained from the genome of B. stearothermophilus ATCC 7954 by using primers that were identical to the T-box element of the ilv-leu operon from B. subtilis (14) (GGGTGGTACCGCGG) and to a sequenced 3' region of ilvB from B. stearothermophilus (GGCGGATTTGCCAATGGTTCGGC).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 1. Restriction map and schematic representation of the insert of the AHAS-positive cosmid (upper-left diagram) and construction of plasmids. Plasmid pT7-6-ilvB-beg was constructed by ligating the DNA fragment of the beginning of ilvB (see text) (which was initially introduced into the pGEM-T Easy plasmid, creating pGEM-T Easy-beg-ilvB-777) into the SalI site of the pT7-6 expression vector. Plasmid pT7-6-ilvBNC-leuAdel was constructed by inserting the 4.0-kb EcoRI fragment, obtained from the cosmid containing the putative 3' end of the ilvB gene, into the EcoRI site of pT7-6-ilvB-beg. The pT7-6-ilvBN plasmid was constructed by deleting a 1,771-bp Ecl136II-Bst1107I DNA fragment from the pT7-6-ilvBNC-leuAdel plasmid and by a self-ligation of the rest of the plasmid. The pT7-6-ilvB plasmid was constructed by deleting a 2,561-bp Ecl136 II-SmaI fragment from pT7-6-ilvBNC-leuAdel and by a self-ligation of the remaining plasmid. The pT7-6-ilvN plasmid was constructed by deleting a 1,190-bp HindIII fragment from pT7-6-ilvBN and by a self-ligation of the rest of the plasmid. Genes and their directions of transcription are marked by black arrows. Overlapping genes are shown below the line for clarity. The order of the last two EcoRI fragments in the cosmid insert was not determined.

The DNA sequences of the ilv-leu operon of B. stearothermophilus (NCBI accession no. AY083837) and the deduced amino acid sequences of its encoded proteins show 67% and 68 to 74% identity, respectively, with those of B. subtilis for this region.

The purification of AHAS for biochemical characterization required the subcloning of its genes into the expression vector pT7-6 (Table 1), as illustrated in Fig. 1. In the purification of the holoenzyme [from E. coli HMS174(DE3)/pT7-6-ilvBN] and its separately expressed subunits [from HMS174(DE3)/pT7-6-ilvB or HMS174(DE3)/pT7-6-ilvN], we took advantage of the thermophilic properties of the enzyme and precipitated most of the mesophilic proteins of the host by heat denaturation in the first step of this process (Fig. 2; Table 2). After two further steps, we achieved more than 90% purity for the polypeptides (Fig. 2). The inferred molecular masses of the polypeptides encoded by the ilvB gene (63.3 kDa) and by ilvN (18.7 kDa) were confirmed. The N-terminal amino acid sequence of the putative large subunit (AKMNVEEQTKTKMSGSMM) also agrees with that deduced from the ilvB gene, when initiated from the fourth in-frame AUG triplet, after cleavage of the initial N-formylmethionine. The ilvN product showed no AHAS activity, as expected for the regulatory subunit, but was capable of activating the large subunit.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Bacterial strains and plasmids used in this work



View larger version (86K):
[in this window]
[in a new window]
 
FIG. 2. SDS-PAGE of AHASBst and its subunits. (A) Results for the steps of purification of the holoenzyme (lanes 1 to 4) as summarized in Table 2. Forty micrograms of protein was loaded in each lane. (B) Purified large subunit (lane 2) and small subunit (lane 3), 10 µg each. Protein size markers are in lane 1.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Purification of holoenzyme and large subunit of AHAS

AHASBst is the first thermophilic AHAS to be isolated and characterized. Its optimal temperature for activity is about 55°C. At 65°C, the enzyme loses its activity with a half time of 5 min, and at 70°C, it does so in less than a minute. Although none of the Escherichia coli AHAS isozymes is as thermostable as AHASBst, the latter is less thermophilic (Table 3) than one might expect for an enzyme from an organism whose optimal growth temperature is 55°C. Interestingly, the optimal temperature for AHAS activity is nearly 65°C in crude extracts of B. stearothermophilus ATCC 12980 (21), suggesting that interactions with other factors in the cytosol might contribute to the thermostability of this enzyme.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Comparison of catalytic activity of AHASBst (holoenzyme, isolated large subunit, and reconstituted enzyme) to that of AHAS III from E. colia

The specific activity and substrate affinity of AHASBst under optimal conditions are quite similar to those of E. coli AHAS III (Table 3), except that the former shows substrate inhibition at high pyruvate concentrations (Fig. 3). The enzyme has a moderately high preference for ketobutyrate over pyruvate as the second substrate (R = 22). AHASBst is more sensitive to the inhibitor sulfometuron methyl than is E. coli AHAS III (Table 3) but is less sensitive than the AHAS II of E. coli or plant enzymes (22, 24).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3. Pyruvate dependence of AHAS holoenzyme. The reaction was carried out at 60°C in 0.1 M Tricine, pH 8.0, with 5 mg of purified enzyme ml-1 in the presence of 0.1 mM ThDP, 10 mM Mg2+, and 0.025 mM FAD. Data were fitted to the empirical equation V = (vmax[Pyr])/(Km + [Pyr] + [Pyr]2/K2), where v is the measured reaction velocity, Vmax is the maximum velocity at substrate saturation, and Pyr is pyruvate.

The isolated large subunit has about one-third the activity of the holoenzyme, but it can be reconstituted to nearly complete activity by the addition of purified small subunits (Table 3; Fig. 4). It also shows a low apparent affinity for the enzyme's cofactors (ThDP, Mg2+, and flavin adenine dinucleotide [FAD]).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. Reconstitution titration of the purified AHAS large subunit with purified small subunits. Large subunits (4.2 µg/ml) were preincubated for 15 min at 55°C with varied amounts of purified small subunits of AHASBst (•) (upper abscissa; micrograms of N) in the standard reaction buffer. Note that the large and small subunits are calculated to be equimolar at 1.25 µg of small subunit. The reaction was initiated by the addition of pyruvate (20 mM), stopped after 20 min, and analyzed. In a parallel reaction, the large subunits were incubated at 40°C with purified small subunits of E. coli AHAS III ({circ}) (lower abscissa, micrograms of H).

The feedback regulation of AHASBst by valine is dependent on the presence of the small subunits (Table 3). The inhibition at saturation with valine is incomplete (Table 3), as has been shown for other AHASs (19, 31), and depends on the substrate concentration; at 1.0 mM pyruvate, for instance, the inhibition was 24% with a valine concentration for half of this inhibition (K0.5) of 4 µM, while at 10 mM pyruvate, there was no inhibition. We suggest that at physiological levels of pyruvate (0.1 to 0.5 mM), feedback inhibition by valine may play a significant role in modulating branched-chain amino acid biosynthesis. Leucine and isoleucine have only very small effects on the enzyme (data not shown).

It is interesting that the purified small subunits of E. coli AHAS III can also activate the B. stearothermophilus large subunits, if the reaction is carried out at a temperature at which the AHAS III small subunits are stable (40°C). The concentration that is required for half activation (Fig. 4) is about four to five times higher than that required for the activation of the homologous subunit. The activity of this heterologous large- and small-subunit combination is sensitive to valine inhibition. In this case, at a pyruvate concentration of 0.3 mM, valine leads to 48% inhibition of activity at saturation, with an apparent K0.5 of about 150 µM (data not shown). In contrast, there is no heterologous activation or conferral of valine sensitivity when regulatory and catalytic subunits from different E. coli isozymes (23, 27, 28) or from E. coli AHAS III and Saccharomyces cerevisiae (20; R. Duggleby, personal communication; M. Vyazmensky, unpublished results) are combined.

In conclusion, AHASBst is quite similar to isozyme III from E. coli (2, 11, 19, 23) (Table 3) and to AHASs from other gram-positive bacteria with a single AHAS (8, 15, 31). The evolutionary and functional connections between the single AHASs of gram-positive bacteria and isozyme III of E. coli can be seen in the sequences of the regulatory subunits, the tendencies of the regulatory subunits to dissociate, and the heterologous complementation described above. Another hint of such a relationship is the regulation of the expression of E. coli ilvIH by leucine and the encoding of a typical gram-positive AHAS by an ilvBNC-leu operon.


arrow
Nucleotide sequence accession number.
 
The sequence data reported here have been deposited in the NCBI database under accession no. AY083837.


arrow
ACKNOWLEDGMENTS
 
This research was supported in part by grant 93-00233 from the U.S.-Israel Binational Science Foundation and by seed grants from the Vice President for Research and Development of Ben-Gurion University.

I.P. thanks the students and technical staff who assisted her during the period she spent at Georgia State University, particularly Debby Walthall and Hosam Ewis.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Life Sciences, Ben-Gurion University of the Negev, P.O. Box 653, Beer-Sheva, 84105 Israel. Phone: (972) 864 61713. Fax: (972) 864 79178. E-mail: barakz{at}bgumail.bgu.ac.il. Back

{dagger} Present address: Department of Microbiology, University of Georgia, Athens, GA 30602-2605. Back


arrow
REFERENCES
 
    1
  1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1993. Current protocols in molecular biology, vol. 1 to 3. John Wiley and Sons, New York, N.Y.
  2. 2
  3. Barak, Z., J. M. Calvo, and J. V. Schloss. 1988. Acetolactate synthase isozyme III from Escherichia coli. Methods Enzymol. 166:455-458.[Medline]
  4. 3
  5. Barak, Z., D. M. Chipman, and N. Gollop. 1987. Physiological implications of the specificity of acetohydroxy acid synthase isozymes of enteric bacteria. J. Bacteriol. 169:3750-3756.[Abstract/Free Full Text]
  6. 4
  7. Barak, Z., N. Kogan, N. Gollop, and D. M. Chipman. 1990. Importance of AHAS isozymes in branched chain amino acid biosynthesis, p. 91-107. In Z. Barak, D. M. Chipman, and J. V. Schloss (ed.), Biosynthesis of branched chain amino acids. VCH, Weinheim, Germany.
  8. 5
  9. Bolotin, A., P. Wincker, S. Mauger, O. Jaillon, K. Malarme, J. Weissenbach, S. D. Ehrlich, and A. Sorokin. 2001. The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res. 11:731-753.[Abstract/Free Full Text]
  10. 6
  11. Bradford, M. 1976. A rapid and sensitive method of quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.[CrossRef][Medline]
  12. 7
  13. Chipman, D., Z. Barak, and J. V. Schloss. 1998. Biosynthesis of 2-aceto-2-hydroxy acids: acetolactate synthases and acetohydroxyacid synthases. Biochim. Biophys. Acta 1385:401-419.[CrossRef][Medline]
  14. 8
  15. Cordes, C., B. Mockel, L. Eggeling, and H. Sahm. 1992. Cloning, organization and functional analysis of ilvA, ilvB and ilvC genes from Corynebacterium glutamicum. Gene 112:113-116.[CrossRef][Medline]
  16. 9
  17. De Rossi, E., R. Leva, L. Gusberti, P. Manachini, and G. Riccardi. 1995. Cloning, sequencing and expression of the ilvBNC gene cluster from Streptomyces avermitilis. Gene 166:127-132.[CrossRef][Medline]
  18. 10
  19. Eoyang, L., and P. M. Silverman. 1986. Role of small subunit (IlvN polypeptide) of acetohydroxyacid synthase I from Escherichia coli K-12 in sensitivity of the enzyme to valine inhibition. J. Bacteriol. 166:901-904.[Abstract/Free Full Text]
  20. 11
  21. Gollop, N., B. Damri, Z. Barak, and D. M. Chipman. 1989. Kinetics and mechanism of acetohydroxy acid synthase isozyme III from Escherichia coli. Biochemistry 28:6310-6317.[CrossRef][Medline]
  22. 12
  23. Grimminger, H., and H. E. Umbarger. 1979. Acetohydroxy acid synthase I of Escherichia coli: purification and properties. J. Bacteriol. 137:846-853.[Abstract/Free Full Text]
  24. 13
  25. Gusberti, L., R. Cantoni, E. De Rossi, M. Branzoni, and G. Riccardi. 1996. Cloning and sequencing of the ilvBNC gene cluster from Mycobacterium avium. Gene 177:83-85.[CrossRef][Medline]
  26. 14
  27. Henkin, T. M., B. L. Glass, and F. J. Grundy. 1992. Analysis of the Bacillus subtilis tyrS gene: conservation of a regulatory sequence in multiple tRNA synthetase genes. J. Bacteriol. 174:1299-1306.[Abstract/Free Full Text]
  28. 15
  29. Keilhauer, C., L. Eggeling, and H. Sahm. 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvC operon. J. Bacteriol. 175:5595-5603.[Abstract/Free Full Text]
  30. 16
  31. Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo, M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier, A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Connerton, A. Danchin, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256.[CrossRef][Medline]
  32. 17
  33. Kuroda, M., T. Ohta, I. Uchiyama, T. Baba, H. Yuzawa, I. Kobayashi, L. Cui, A. Oguchi, K. Aoki, Y. Nagai, J. Lian, T. Ito, M. Kanamori, H. Matsumaru, A. Maruyama, H. Murakami, A. Hosoyama, Y. Mizutani-Ui, N. K. Takahashi, T. Sawano, R. Inoue, C. Kaito, K. Sekimizu, H. Hirakawa, S. Kuhara, S. Goto, J. Yabuzaki, M. Kanehisa, A. Yamashita, K. Oshima, K. Furuya, C. Yoshino, T. Shiba, M. Hattori, N. Ogasawara, H. Hayashi, and K. Hiramatsu. 2001. Whole genome sequencing of meticillin-resistant Staphylococcus aureus. Lancet 357:1225-1240.[CrossRef][Medline]
  34. 18
  35. Lago, C. T., G. Sannia, G. Marino, C. H. Squires, J. M. Calvo, and M. DeFelice. 1985. The ilvIH operon of Escherichia coli K-12. Identification of the gene products and recognition of the translational start by polypeptide microsequencing. Biochim. Biophys. Acta 824:74-79.[Medline]
  36. 19
  37. Mendel, S., T. Elkayam, C. Sella, M. Vyazmensky, D. M. Chipman, and Z. Barak. 2001. Acetohydroxyacid synthase: a proposed structure for regulatory subunits supported by evidence from mutagenesis. J. Mol. Biol. 307:465-477.[CrossRef][Medline]
  38. 20
  39. Pang, S. S., and R. G. Duggleby. 1999. Expression, purification, characterization, and reconstitution of the large and small subunits of yeast acetohydroxyacid synthase. Biochemistry 38:5222-5231.[CrossRef][Medline]
  40. 21
  41. Porat, I. 2000. Cloning and characterization of acetohydroxy acid synthase from two thermophilic bacteria. Ph.D. thesis. Ben-Gurion University, Beer-Sheva, Israel.
  42. 22
  43. Schloss, J. V., L. M. Ciskanik, and D. E. Van Dyk. 1988. Origin of the herbicide binding site of acetolactate synthase. Nature 331:360-362.[CrossRef]
  44. 23
  45. Sella, C., O. Weinstock, Z. Barak, and D. M. Chipman. 1993. Subunit association in acetohydroxy acid synthase isozyme III. J. Bacteriol. 175:5339-5343.[Abstract/Free Full Text]
  46. 24
  47. Singh, B. K., K. E. Nerwhouse, M. A. Stidham, and D. L. Shaner. 1990. Imidazolinones and acetohydroxyacid synthase from plants, p. 357-371. In Z. Barak, D. M. Chipman, and J. V. Schloss (ed.), Biosynthesis of branched chain amino acids. VCH, Weinheim, Germany.
  48. 25
  49. Takami, H., K. Nakasone, Y. Takaki, G. Maeno, R. Sasaki, N. Masui, F. Fuji, C. Hirama, Y. Nakamura, N. Ogasawara, S. Kuhara, and K. Horikoshi. 2000. Complete genome sequence of the alkaliphilic bacterium Bacillus halodurans and genomic sequence comparison with Bacillus subtilis. Nucleic Acids Res. 28:4317-4331.[Abstract/Free Full Text]
  50. 26
  51. Umbarger, H. E. 1987. Biosynthesis of the branched-chain amino acids, p. 352-367. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, vol. 1. American Society for Microbiology, Washington, D.C.
  52. 27
  53. Vyazmensky, M., C. Sella, Z. Barak, and D. M. Chipman. 1996. Isolation and characterization of subunits of acetohydroxy acid synthase isozyme III and reconstitution of the holoenzyme. Biochemistry 35:10339-10346.[CrossRef][Medline]
  54. 28
  55. Weinstock, O., C. Sella, D. M. Chipman, and Z. Barak. 1992. Properties of subcloned subunits of bacterial acetohydroxy acid synthases. J. Bacteriol. 174:5560-5566.[Abstract/Free Full Text]
  56. 29
  57. Yadav, N., R. E. McDevitt, S. Benard, and S. C. Falco. 1986. Single amino acid substitutions in the enzyme acetolactate synthase confer resistance to the herbicide sulfometuron methyl. Proc. Natl. Acad. Sci. USA 83:4418-4422.[Abstract/Free Full Text]
  58. 30
  59. Zahler, S. A., N. Najimudin, D. S. Kessler, and M. A. Vaneyar. 1990. {alpha}-Acetolactate synthesis by Bacillus subtilis, p. 25-32. In Z. Barak, D. M. Chipman, and J. V. Schloss (ed.), Biosynthesis of branched chain amino acids. VCH, Weinheim, Germany.
  60. 31
  61. Zohar, Y., M. Einav, D. M. Chipman, and Z. Barak. 2003. Acetohydroxyacid synthase from Mycobacterium avium and its inhibition by sulfonylureas and imidazolinones. Biochim. Biophys. Acta 1649:97-105.[Medline]


Journal of Bacteriology, January 2004, p. 570-574, Vol. 186, No. 2
0021-9193/04/$08.00+0     DOI: 10.1128/JB.186.2.570-574.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Porat, I.
Right arrow Articles by Barak, Z.'e.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Porat, I.
Right arrow Articles by Barak, Z.'e.