Previous Article | Next Article ![]()
Journal of Bacteriology, January 2004, p. 570-574, Vol. 186, No. 2
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.2.570-574.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Michael Vinogradov,1 Maria Vyazmensky,1 Chung-Dar Lu,2 David M. Chipman,1 Ahmed T. Abdelal,3 and Ze'ev Barak1*
Department of Life Sciences, Ben-Gurion University of the Negev, Beer-Sheva, 84105 Israel,1 Biology Department, Northeastern University, Boston, Massachusetts 02115-5000,3 Department of Biology, Georgia State University, Atlanta, Georgia 303032
Received 20 June 2003/ Accepted 3 October 2003
|
|
|---|
|
|
|---|
Many bacteria and archaea apparently contain a single AHAS enzyme. In most gram-positive bacteria, the genes for the first two enzymes in the pathway are located in the same operon (ilvBNC) (5, 9, 13, 15, 30), often together with the leu genes (ilvBNC-leuACBD) (17, 25, 30). The enterobacteria contain three isozymes of AHAS, encoded by distinct and differently regulated operons (3, 4).
To investigate the AHAS of Bacillus stearothermophilus (AHASBst), we cloned the genes for this holoenzyme (ilvBN) and its large (ilvB) and small (ilvN) subunits to allow sequencing and overexpression. The screening for these genes was conducted with a genomic cosmid library for B. stearothermophilus ATCC 7954, created by H. Ewis (unpublished data), with a digitonin-labeled 1,100-bp probe that is highly conserved (50 to 75% amino acid identity) among AHASs (7) and only slightly conserved in other thiamine diphosphate (ThDP)-dependent enzymes, such as pyruvate oxidase (30%) and catabolic acetolactate synthase (25%) of Bacillus subtilis. This probe was amplified from the B. stearothermophilus ATCC 12980 genome by using two degenerate oligonucleotide primers: 5'(C/T/A)GGNACNGA(T/C)GCNTT(T/C)CA(A/G)GA and 5'T(C/G)(C/T)TGCCA(C/T)(T/G)NACCAT.
The gene order in the insert of the AHAS-positive cosmid, as determined by coding analysis of its sequence (Fig. 1), seems similar to that of the B. subtilis ilv-leu operon (16, 30). The 5' end of ilvB was absent in the cosmid-cloned fragment. This region was added to the clone, as shown in Fig. 1, from a PCR-amplified fragment obtained from the genome of B. stearothermophilus ATCC 7954 by using primers that were identical to the T-box element of the ilv-leu operon from B. subtilis (14) (GGGTGGTACCGCGG) and to a sequenced 3' region of ilvB from B. stearothermophilus (GGCGGATTTGCCAATGGTTCGGC).
![]() View larger version (26K): [in a new window] |
FIG. 1. Restriction map and schematic representation of the insert of the AHAS-positive cosmid (upper-left diagram) and construction of plasmids. Plasmid pT7-6-ilvB-beg was constructed by ligating the DNA fragment of the beginning of ilvB (see text) (which was initially introduced into the pGEM-T Easy plasmid, creating pGEM-T Easy-beg-ilvB-777) into the SalI site of the pT7-6 expression vector. Plasmid pT7-6-ilvBNC-leuAdel was constructed by inserting the 4.0-kb EcoRI fragment, obtained from the cosmid containing the putative 3' end of the ilvB gene, into the EcoRI site of pT7-6-ilvB-beg. The pT7-6-ilvBN plasmid was constructed by deleting a 1,771-bp Ecl136II-Bst1107I DNA fragment from the pT7-6-ilvBNC-leuAdel plasmid and by a self-ligation of the rest of the plasmid. The pT7-6-ilvB plasmid was constructed by deleting a 2,561-bp Ecl136 II-SmaI fragment from pT7-6-ilvBNC-leuAdel and by a self-ligation of the remaining plasmid. The pT7-6-ilvN plasmid was constructed by deleting a 1,190-bp HindIII fragment from pT7-6-ilvBN and by a self-ligation of the rest of the plasmid. Genes and their directions of transcription are marked by black arrows. Overlapping genes are shown below the line for clarity. The order of the last two EcoRI fragments in the cosmid insert was not determined.
|
The purification of AHAS for biochemical characterization required the subcloning of its genes into the expression vector pT7-6 (Table 1), as illustrated in Fig. 1. In the purification of the holoenzyme [from E. coli HMS174(DE3)/pT7-6-ilvBN] and its separately expressed subunits [from HMS174(DE3)/pT7-6-ilvB or HMS174(DE3)/pT7-6-ilvN], we took advantage of the thermophilic properties of the enzyme and precipitated most of the mesophilic proteins of the host by heat denaturation in the first step of this process (Fig. 2; Table 2). After two further steps, we achieved more than 90% purity for the polypeptides (Fig. 2). The inferred molecular masses of the polypeptides encoded by the ilvB gene (63.3 kDa) and by ilvN (18.7 kDa) were confirmed. The N-terminal amino acid sequence of the putative large subunit (AKMNVEEQTKTKMSGSMM) also agrees with that deduced from the ilvB gene, when initiated from the fourth in-frame AUG triplet, after cleavage of the initial N-formylmethionine. The ilvN product showed no AHAS activity, as expected for the regulatory subunit, but was capable of activating the large subunit.
|
View this table: [in a new window] |
TABLE 1. Bacterial strains and plasmids used in this work
|
![]() View larger version (86K): [in a new window] |
FIG. 2. SDS-PAGE of AHASBst and its subunits. (A) Results for the steps of purification of the holoenzyme (lanes 1 to 4) as summarized in Table 2. Forty micrograms of protein was loaded in each lane. (B) Purified large subunit (lane 2) and small subunit (lane 3), 10 µg each. Protein size markers are in lane 1.
|
|
View this table: [in a new window] |
TABLE 2. Purification of holoenzyme and large subunit of AHAS
|
|
View this table: [in a new window] |
TABLE 3. Comparison of catalytic activity of AHASBst (holoenzyme, isolated large subunit, and reconstituted enzyme) to that of AHAS III from E. colia
|
![]() View larger version (13K): [in a new window] |
FIG. 3. Pyruvate dependence of AHAS holoenzyme. The reaction was carried out at 60°C in 0.1 M Tricine, pH 8.0, with 5 mg of purified enzyme ml-1 in the presence of 0.1 mM ThDP, 10 mM Mg2+, and 0.025 mM FAD. Data were fitted to the empirical equation V = (vmax[Pyr])/(Km + [Pyr] + [Pyr]2/K2), where v is the measured reaction velocity, Vmax is the maximum velocity at substrate saturation, and Pyr is pyruvate.
|
![]() View larger version (15K): [in a new window] |
FIG. 4. Reconstitution titration of the purified AHAS large subunit with purified small subunits. Large subunits (4.2 µg/ml) were preincubated for 15 min at 55°C with varied amounts of purified small subunits of AHASBst () (upper abscissa; micrograms of N) in the standard reaction buffer. Note that the large and small subunits are calculated to be equimolar at 1.25 µg of small subunit. The reaction was initiated by the addition of pyruvate (20 mM), stopped after 20 min, and analyzed. In a parallel reaction, the large subunits were incubated at 40°C with purified small subunits of E. coli AHAS III ( ) (lower abscissa, micrograms of H).
|
It is interesting that the purified small subunits of E. coli AHAS III can also activate the B. stearothermophilus large subunits, if the reaction is carried out at a temperature at which the AHAS III small subunits are stable (40°C). The concentration that is required for half activation (Fig. 4) is about four to five times higher than that required for the activation of the homologous subunit. The activity of this heterologous large- and small-subunit combination is sensitive to valine inhibition. In this case, at a pyruvate concentration of 0.3 mM, valine leads to 48% inhibition of activity at saturation, with an apparent K0.5 of about 150 µM (data not shown). In contrast, there is no heterologous activation or conferral of valine sensitivity when regulatory and catalytic subunits from different E. coli isozymes (23, 27, 28) or from E. coli AHAS III and Saccharomyces cerevisiae (20; R. Duggleby, personal communication; M. Vyazmensky, unpublished results) are combined.
In conclusion, AHASBst is quite similar to isozyme III from E. coli (2, 11, 19, 23) (Table 3) and to AHASs from other gram-positive bacteria with a single AHAS (8, 15, 31). The evolutionary and functional connections between the single AHASs of gram-positive bacteria and isozyme III of E. coli can be seen in the sequences of the regulatory subunits, the tendencies of the regulatory subunits to dissociate, and the heterologous complementation described above. Another hint of such a relationship is the regulation of the expression of E. coli ilvIH by leucine and the encoding of a typical gram-positive AHAS by an ilvBNC-leu operon.
|
|
|---|
I.P. thanks the students and technical staff who assisted her during the period she spent at Georgia State University, particularly Debby Walthall and Hosam Ewis.
Present address: Department of Microbiology, University of Georgia, Athens, GA 30602-2605. ![]()
|
|
|---|
-Acetolactate synthesis by Bacillus subtilis, p. 25-32. In Z. Barak, D. M. Chipman, and J. V. Schloss (ed.), Biosynthesis of branched chain amino acids. VCH, Weinheim, Germany.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»