Previous Article | Next Article ![]()
Journal of Bacteriology, October 2004, p. 6845-6854, Vol. 186, No. 20
0021-9193/04/$08.00+0 DOI: 10.1128/JB.186.20.6845-6854.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Department of Bioscience and Biotechnology, Faculty of Engineering, Okayama University, Tsushima-naka, Okayama, Japan
Received 1 May 2004/ Accepted 13 July 2004
|
|
|---|
|
|
|---|
Adenosylcobalamin (AdoCbl)-dependent enzymes are known to catalyze reactions including carbon skeleton rearrangements, heteroatom eliminations, and intramolecular amino group migrations by radical mechanisms (5, 13). An adenosyl radical formed by homolytic cleavage of the Co-C bond of enzyme-bound AdoCbl is directly involved in catalysis. The holoenzymes of diol dehydratase and glycerol dehydratase undergo suicide inactivation by glycerol during catalysis (3, 29, 30, 44) or O2 inactivation in the absence of substrate (25, 30, 38, 47). This phenomenon is of special interest because glycerol is a physiological substrate for these enzymes (1, 17, 18, 41, 42). This apparent inconsistency was solved by previous findings that the glycerol-inactivated enzymes in permeabilized cells (in situ) of Klebsiella oxytoca and Klebsiella pneumoniae undergo rapid reactivation in the presence of ATP, Mg2+ (or Mn2+), and AdoCbl (20, 46). The genes encoding the proteins (reactivating factors) involved in the reactivation of diol dehydratase (27) and glycerol dehydratase (39) were identified in previous studies and named ddrAB (pduGH) and gdrAB (dhaB4/dhaF and orf2b/dhaG), respectively. The gene products have been characterized, and the mechanism of reactivation of inactivated holoenzymes by the corresponding reactivating factors has also been proposed (21, 28, 36, 43). The ADP-bound form of reactivating factor induces conformational change of the enzyme through tight complex formation with it, resulting in release of the enzyme-bound modified coenzyme. Finally, the complex dissociates in the presence of ATP, forming apoenzyme that can be reconstituted into active holoenzyme with intact AdoCbl. We proposed that these reactivating factors are a new type of molecular chaperones that are involved in the reactivation of already-folded, inactivated enzymes (21, 28, 43).
The next question is whether such reactivating factors are general for AdoCbl-dependent enzymes. To answer this question, a reactivating factor for ethanolamine ammonia lyase (EC 4.3.1.7) (EAL) has been sought. EAL catalyzes AdoCbl-dependent conversion of ethanolamine to acetaldehyde (11). The enzyme was first discovered by Bradbeer in a choline-fermenting Clostridium sp. (10) and then shown to be present in many bacteria in which exogenous vitamin B12 is required for growth on ethanolamine. They include Escherichia (35), Klebsiella (35), Salmonella (12), and Bacillus (48). It was shown with Escherichia coli that the enzyme is induced when the bacterium is grown in the presence of both ethanolamine and vitamin B12 (7, 8). The enzyme is involved in anaerobic fermentation (10) or catabolism (12, 35) of this substrate or the utilization of this substrate as a nitrogen source in aerobic growth (12, 35). The holoenzyme of EAL (holoEAL) undergoes suicidal inactivation by ethanolamine during catalysis and inactivation in the absence of substrate (22). In either case, the irreversible cleavage of the Co-C bond of enzyme-bound AdoCbl takes place, and the modified coenzyme is kept tightly bound, resulting in the irreversible inactivation of the enzyme. Such suicide inactivation seemed enigmatic, because ethanolamine is an essential substrate for the growth of these bacteria when it is used as the sole source of carbon, energy, or nitrogen. The inactivation might be reversed if the reactivating factor for EAL was present and removed the damaged cofactor from the enzyme like diol dehydratase-reactivating factor (DdrAB) and glycerol dehydratase-reactivating factor (GdrAB).
It had been reported that the eut operon of Salmonella enterica serovar Typhimurium encodes proteins essential for the cobalamin-dependent utilization of ethanolamine (31). The eut operon consists of 17 genes (23), including the genes encoding large and small subunits of EAL (eutB and eutC, respectively) (15). Although the functions of several gene products have been postulated based on genetic analyses and homology searches for deduced amino acid sequences (23, 32, 33, 37), these functions have not been wholly established. Furthermore, the functions of several other gene products remained unclear. From genetic evidence that eutA mutants are sensitive to inhibition by cyanocobalamin (CN-Cbl) (32), it was suggested that one possible function for the product of eutA was as a reactivating factor of EAL (23). Fragmentary similarity between EutA and DarA or GarA also suggests this possibility (40).
In this paper, we report the ATP-dependent reactivation of the inactivated holoEAL of E. coli and identification of an EAL-reactivating factor. Gene organization of the E. coli eut operon (Fig. 1) is very similar to that of S. enterica serovar Typhimurium LT2 (23, 49). We identified eutA, the gene adjacent to the 5' terminal of the EAL genes (eutBC) in the E. coli eut operon, as the gene encoding an EAL-reactivating factor by coexpression, followed by the in situ assay of reactivating activity. Direct evidence is also presented here which shows that purified EutA alone functions in vitro as a reactivating factor for EAL.
![]() View larger version (14K): [in a new window] |
FIG. 1. Gene organization of the E. coli eut operon and insert DNA of plasmids used in this study. The map is drawn to scale. Genes are indicated by boxes. The DNA regions carried by mutant plasmids are shown with thick bars below the map. Dotted lines indicate deletions. The eutB and eutC genes encode the - and ß-subunits of EAL, respectively. The restriction enzymes used for the construction of deletion mutants are HindIII/BsmI for pUCEA3d1, SmaI for pUCEA3d2, AatII/NheI for pUCEA3d3, SalI/EcoRV for pUCEA3d4, RsrII/ScaI for pUCEA3d5, DraI/SacII for pUCEA3d6, and AatII/PstI for pUCEA3d7.
|
|
|
|---|
Bacterial strains, phage, plasmids, and culture conditions. For expression of the chromosomal eut operon, E. coli JM109 was aerobically grown at 30°C in a synthetic medium containing glycerol, ethanolamine, and CN-Cbl, as described by Scarlett and Turner (35). Cells were harvested at a late logarithmic phase.
The genes in the eut operon were isolated from
phage DNA of clone 421 (clone name 4E10) of the Kohara E. coli genomic
phage library (24) (kindly provided by Hirotada Mori, Research and Education Center for Genetic Information, Nara Institute of Science and Technology, Nara, Japan). This clone contains a 17.9-kb chromosomal DNA insert covering all of the genes of the eut operon. pUC119, pSTV28, and pSTV29 were used as vectors. E. coli JM109 and SCS110 (Stratagene) were used as hosts for the preparation of plasmids. Transformation of E. coli was carried out by the electroporation method of Dower et al. (14). Recombinant strains carrying plasmids were grown aerobically at 30°C in Luria-Bertani medium containing 50 µg of ampicillin/ml (for strains carrying plasmids derived from pUC119) or 50 µg of chloramphenicol/ml (for strains carrying plasmids derived from pSTV28 and pSTV29). For inducible expression of cloned genes, isopropyl-1-thio-ß-D-galactopyranoside was added to a concentration of 1 mM when the culture reached an optical density at 600 nm of approximately 1.0. Cells were harvested at about 2 h after the induction was initiated.
Preparation of permeabilized cells. Permeabilized cells were prepared by treatment with 1% (vol/vol) toluene as described previously (20), except that the treatment was performed on a small scale with 1.5-ml microtubes.
Preparation of homogenates and cell extracts. Cells were suspended in 50 mM potassium phosphate buffer (pH 8.0) containing 10 mM ethanolamine (for cell extracts) or containing both 10 mM ethanolamine and 1% Brij 35 (for homogenates) and disrupted by sonication for 3 min at 240 W with a Kaijo (Tokyo, Japan) TA-5287 ultrasonicator. The resulting homogenate was centrifuged for 30 min at 20,600 x g, and the supernatant was used as cell extract.
EAL and protein assays.
The recombinant apoenzyme of EAL (apoEAL) of E. coli purified to homogeneity from E. coli JM109 harboring the expression plasmid pUSI2ENd (EAL) (K. Akita and T. Toraya, unpublished data) was used throughout this study. All the enzyme assays were carried out in darkness to avoid photolysis of AdoCbl. The amount of acetaldehyde formed from ethanolamine by the EAL reaction was determined by the 3-methyl-2-benzothiazolinone hydrazone method, as described previously for the assay of diol dehydratase (45). One unit of EAL is defined as the amount of enzyme activity that catalyzes the formation of 1 µmol of acetaldehyde per min at 37°C. The protein concentration of purified EutA was determined by measuring the absorbance at 280 nm. The molar absorption coefficient at 280 nm (
M,280) calculated by the method of Gill and von Hippel (19) for EutA from its deduced amino acid composition was 27,910 M1 cm1. Based on the predicted molecular weight,
1%,280 was calculated to be 5.63 for EutA.
Assay of EAL-reactivating factor. The reactivating factor assay was also carried out in darkness. In situ reactivation of the inactivated holoenzyme and in situ activation of the enzyme-CN-Cbl complex were assayed with toluene-treated (permeabilized) cells (20) by incubation at 37°C for appropriate time periods in the presence of 10 mM ethanolamine, 15 µM AdoCbl, 3 mM ATP, and 3 mM MgCl2 in 30 mM potassium phosphate buffer (pH 8.0). The reaction was terminated by the addition of potassium citrate buffer (pH 3.6) to a final concentration of 50 mM, and the amount of acetaldehyde formed was determined as described above.
In vitro reactivation of inactivated holoEAL and in vitro activation of the EAL-CN-Cbl complex were assayed by incubation with an appropriate amount of EutA, 20 mM ATP, 20 mM MgCl2, 10 µM AdoCbl, and 25 mM potassium phosphate buffer (pH 8.0), in a total volume of 50 µl. After the reaction mixtures were incubated at 37°C for appropriate time periods, potassium citrate buffer (pH 3.6) was added to a final concentration of 50 mM to terminate the reaction. The amount of acetaldehyde formed was determined after appropriate dilution.
DNA manipulations. Standard recombinant DNA techniques were performed as described by Sambrook et al. (34). Restriction endonucleases and the enzymes for construction of plasmids were used according to the manufacturer's instructions. Cloning of PCR products into pCR2.1 was carried out with the Original TA cloning kit (Invitrogen).
Constructions of plasmids.
The gene organization of the E. coli K-12 eut operon is illustrated in Fig. 1 (23, 49). The 9.2-kb DraI and the 7.4-kb DraI-SmaI fragments from
phage DNA prepared from clone 421 of the Kohara E. coli genomic
phage library (24) were ligated to an SmaI digest of pUC119 to construct pUCEA1 and pUCEA2, respectively. The 14.7-kb HindIII-PstI fragment from the same phage DNA was inserted between the HindIII-PstI sites of pUC119 to construct pUCEA3. In these plasmids, cloned genes were under the control of the lac promoter. A series of deletion mutants of pUCEA3 (pUCEA3d1 to pUCEA3d7) were constructed by ligation of several DNA fragments from pUCEA1 and pUCEA3 formed by digestion with the appropriate restriction endonucleases listed in the legend to Fig. 1. The 3'-terminal region of eutC with the NdeI and BanIII sites was amplified by PCR with Taq DNA polymerase, 5' primer (TCCATATGTGAGTCATCGATACGCCGTTTACTCGCCGCGTATGG), and 3' primer (ACAGATCTTATCGGGTCATGTTGATGCCGGATG) (restriction sites added are indicated by underlining, and the sequence complementary to the termination codon is indicated by italics) and cloned into pCR2.1 to construct pCR(eutCc). The DNA fragment containing the 5' terminus of eutA was prepared by hybridization of two synthetic oligo-DNAs (TATGAACACTCGCCAGCTATTGAGCGTCGGTAT, where the initiation codon is shown in italics, and CGATACCGACGCTCAATAGCTGGCGAGTGTTCA) and ligated to the 4.1-kb NdeI-BanIII fragment from pCR(eutCc) to produce pCR(eutAn/Cc). Plasmid pSTV28 was subjected to BanIII digestion and Klenow fragment treatment and then digested by SacI. The resulting 2.8-kb fragment and the 430-bp SacI-PvuII fragment from pCR(eutAn/Cc) were ligated to construct pSTV(eutAn/Cc). The 3.5-kb BanIII-PvuI fragment from pUCEA3d2 was ligated to the 3.2-kb BanIII-PvuI fragment from pSTV(eutAn/Cc) to construct pSTV(eutABC). The 3.7-kb NdeI-BglII fragment from pSTV(eutABC) and the 4.4-kb NdeI-BglII fragment from pCXV(DD) (27) were ligated to construct pCXV(eutABC). To produce pCXV(eutBC), the 610-bp NdeI-AflII fragment from pUSI2ENd(EAL) (the expression plasmid for E. coli EAL genes; Akita and Toraya, unpublished), the 1.7-kb AflII-BglII fragment from pSTV(eutABC), and the 4.4-kb NdeI-BglII fragment from pCXV(DD) were ligated. The 3.7-kb and 2.3-kb BamHI-BglII fragments from pCXV(eutABC) and pCXV(eutBC) were inserted into the BamHI site of pSTV29 to produce pSTV(eutABC)2 and pSTV(eutBC)2, respectively. To eliminate in-frame gene fusions between the vector's lacZ
and the 5' ends of cloned genes in these plasmids, pSTV(eutABC)2 and pSTV(eutBC)2 were digested with BamHI, followed by Klenow fragment treatment and self ligation. The resulting plasmids were designated pSTV(eutABC)3 and pSTV(eutBC)3, respectively. The 1.2-kb NdeI-SacII fragment from pCXV(eutABC) and the 0.3-kb SacII-BsrDI fragment from pUCEA2R (containing the same region of the eut operon as pUCEA2, but in the opposite direction) were cloned between the NdeI and EcoRI sites of pUSI2ENd(EAL) (the cohesive ends formed by BsrDI and EcoRI digestion had been blunted by treating with T4 DNA polymerase and Klenow fragment, respectively, prior to ligation) to construct pUSI2ENd(eutA).
Purification of recombinant EutA protein. Recombinant EutA protein was purified to homogeneity from extracts of E. coli JM109 harboring expression plasmid pUSI2ENd(eutA) that was aerobically grown at 37°C in Luria-Bertani medium containing ampicillin (50 µg/ml). Isopropyl-1-thio-ß-D-galactopyranoside was added to a concentration of 1 mM for induction, and cells were harvested in the late logarithmic phase. Purification was carried out at 0 to 4°C. Throughout the purification steps, purity of the protein in each fraction was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
Wet cells (16.5 g) were suspended in 40 ml of 50 mM potassium phosphate buffer (pH 8.0) containing 2 mM EDTA and 2 mM phenylmethanesulfonyl fluoride and disrupted by sonication for 10 min at 240 W. After centrifugation at 23,700 x g for 30 min, the supernatant was collected. The precipitate was washed with 40 ml of the same buffer, and the washing buffer was combined with the supernatant (cell extract). Ninety-percent-saturated ammonium sulfate solution in 50 mM potassium phosphate buffer (pH 8.0) containing 2 mM EDTA was added to the cell extract to 35% saturation. After centrifugation, the precipitate was dissolved in 60 ml of 50 mM potassium phosphate buffer (pH 8.0) containing 2 mM EDTA and 2 mM phenylmethanesulfonyl fluoride and dialyzed for 1 day against 4 liters of 10 mM potassium phosphate buffer (pH 8.0) containing 0.5 mM EDTA and then for additional 1 day against 2 liters of 5 mM potassium phosphate buffer (pH 8.0) containing 0.5 mM EDTA.
The dialysate was applied to a DEAE-cellulose column (bed volume, 200 ml) that had been equilibrated with 10 mM potassium phosphate buffer (pH 8.0) containing 0.5 mM EDTA. The column was washed successively with 1 liter of the same buffer and 1 liter of 10 mM potassium phosphate buffer (pH 8.0) containing 0.5 mM EDTA and 100 mM KCl and then developed with 1 liter of 10 mM potassium phosphate buffer (pH 8.0) containing 0.5 mM EDTA and 150 mM KCl. The EutA-containing fractions were pooled and concentrated to 100 ml by ultrafiltration through a Diaflo PM-10 membrane (Millipore). The concentrate was dialyzed for 1 day against 4 liters of 7 mM potassium phosphate buffer (pH 8.0) and concentrated again to 25 ml. The concentrate obtained was dialyzed for 1 day against 2 liters of 7 mM potassium phosphate buffer (pH 8.0).
The dialysate was applied to a hydroxyapatite column (bed volume, 100 ml) which had been equilibrated with 7 mM potassium phosphate buffer (pH 8.0). The column was developed with 340 ml of the same buffer. The EutA-containing fractions were pooled and concentrated to about 3.5 ml by ultrafiltration through a Diaflo PM-10 membrane and Centriplus YM-10 (Millipore). EutA was finally purified by gel filtration on a Sephadex G-200 column (bed volume, 180 ml) in 10 mM potassium phosphate buffer (pH 8.0), concentrated by ultrafiltration, and stored at 80°C until use.
|
|
|---|
In situ reactivation of inactivated holoEAL of E. coli. To examine whether the inactivated holoEAL is reactivated, the time course of the EAL reaction was determined with toluene-treated (permeabilized) cells of induced E. coli JM109 (the so-called in situ system) (20). As shown in Fig. 2A, the deamination of ethanolamine by permeabilized E. coli JM109 cells with added AdoCbl was accompanied by concomitant inactivation and ceased almost completely within 20 min. However, when ATP and Mg2+ were supplemented in the reaction mixture in addition to AdoCbl, deamination of ethanolamine proceeded apparently without significant inactivation, even 60 min after the reaction was initiated. Meanwhile, enzyme activity with added AdoCbl in permeabilized E. coli cells grown in the presence of 2 µg of CN-Cbl/ml was about 40% of that in cells grown in the presence of 40 ng of CN-Cbl/ml (Fig. 2B). However, almost the same level of enzyme activity was attained upon the addition of ATP and Mg2+ together with AdoCbl as was observed with cells grown on 40 ng of CN-Cbl/ml. These results suggested that about 60% of the enzyme in the cells grown in 2 µg of CN-Cbl/ml had been converted to the inactive enzyme-CN-Cbl complex or the inactivated holoenzyme under the growth conditions and that the inactive enzyme-cobalamin complexes underwent ATP-dependent reactivation or activation. It was amazing that the presence of a 50-fold excess of CN-Cbl in a growing culture resulted in only 60% reduction of enzyme activity. This fact suggests in vivo lowering of EAL affinity for CN-Cbl by a reactivating factor in the presence of ATP and Mg2+, as in the case of diol and glycerol dehydratases (28, 43). Despite the presence of the inactivated holoenzyme or inactive enzyme-CN-Cbl complex, enzyme activity was not increased at all in the presence of ATP and Mg2+ without AdoCbl, indicating that free AdoCbl is also absolutely required for the (re)activation. The absolute requirement of free AdoCbl and lack of requirement of a reducing agent for (re)activation eliminated the involvement of an adenosylating enzyme [ATP:cob(I)alamin adenosyltransferase; BtuR] and suggested the exchange of modified coenzyme or CN-Cbl for AdoCbl in the (re)activation process. The presence of a similar reactivation system was observed in the permeabilized cells of K. oxytoca ATCC 8724 and K. pneumoniae ATCC 25955 when cultivated under the conditions identical to those for E. coli (data not shown).
![]() View larger version (14K): [in a new window] |
FIG. 2. Time courses of in situ deamination of ethanolamine by permeabilized E. coli cells that were grown in medium containing ethanolamine and CN-Cbl. Toluene-treated cells of E. coli JM109 (7.2 x 106 cells) grown in the medium containing CN-Cbl at concentrations of 40 ng/ml (A) and 2 µg/ml (B) were incubated at 37°C for the indicated times in the following mixtures: 30 mM potassium phosphate buffer (pH 8.0), 50 mM KCl, 10 mM ethanolamine, with (circles) or without (triangles) 15 µM AdoCbl, in the presence (solid symbols) or absence (open symbols) of 3 mM ATP plus 3 mM MgCl2, in a total volume of 1.0 ml. The amount of acetaldehyde formed was determined as described in the text.
|
![]() View larger version (12K): [in a new window] |
FIG. 3. Time courses of ethanolamine deamination by homogenates of E. coli cells that were grown in the medium containing ethanolamine and CN-Cbl. Homogenates of E. coli JM109 grown in the medium containing 40 ng of CN-Cbl/ml were incubated at 37°C for the indicated time in the following mixtures: 30 mM potassium phosphate buffer (pH 8.0), 50 mM KCl, 10 mM ethanolamine, 15 µM AdoCbl, in the presence (solid circles) or absence (open circles) of ATP plus MgCl2 (3 mM each), in a total volume of 0.5 ml. The amount of acetaldehyde formed was determined as described in the text.
|
5.8 kb) of the eut operon and lacks the region encoding the N-terminal 63 amino acid residues of EutA. We examined the permeabilized cells of recombinant E. coli carrying pUCEA2 and pUCEA3 for reactivating factor activity. One of the typical results is shown in Fig. 4. The deamination of ethanolamine by permeabilized cells of both recombinant E. coli strains with added AdoCbl was accompanied by concomitant inactivation and ceased almost completely within 20 min in the absence of ATP and Mg2+. However, when ATP and Mg2+ were supplemented in the reaction mixture in addition to AdoCbl, an initial, rapid phase of ethanolamine deamination was followed by a slower but almost constant rate of the deamination reaction in the permeabilized cells of E. coli carrying pUCEA3 (Fig. 4A) but not in the permeabilized cells of E. coli carrying plasmid pUCEA2 (Fig. 4B). Therefore, it is strongly suggested that a certain protein factor(s) encoded by the gene(s) in the upstream region of eut operon that is lacking in pUCEA2 is essential for the reactivation of inactivated holoEAL.
![]() View larger version (13K): [in a new window] |
FIG. 4. Time courses of in situ deamination of ethanolamine by recombinant E. coli. Permeabilized cells of E. coli carrying pUCEA3 (6.6 x 106 cells) (A) or pUCEA2 (1.1 x 106 cells) (B) were incubated at 37°C for the indicated times in the following mixtures: 30 mM potassium phosphate buffer (pH 8.0), 50 mM KCl, 10 mM ethanolamine, 15 µM AdoCbl, in the presence (solid circles) or absence (open circles) of ATP plus MgCl2 (3 mM each), in a total volume of 1.0 ml. The amount of acetaldehyde formed was determined as described in the text.
|
![]() View larger version (19K): [in a new window] |
FIG. 5. Identification of the gene(s) encoding the protein(s) essential for reactivation. Permeabilized cells of recombinant E. coli strains harboring various plasmids (1.4 x 107 to 4.7 x 107 cells) were incubated at 37°C for 30 and 60 min in the following mixtures: 30 mM potassium phosphate buffer (pH 8.0), 50 mM KCl, 10 mM ethanolamine, 15 µM AdoCbl, in the presence (grey bars) or absence (open bars) of ATP plus MgCl2 (3 mM each), in a total volume of 1.0 ml. The amount of acetaldehyde formed was determined as described in the text. Error bars, average ± SD for the results of three experiments.
|
In situ activation of the enzyme-CN-Cbl complex in recombinant E. coli. Inactivation of holoEAL during catalysis involves the irreversible cleavage of the Co-C bond of enzyme-bound AdoCbl and is brought about by tight binding of the modified coenzyme. Therefore, the inactive enzyme-CN-Cbl complex can be considered a model of the inactivated holoenzyme. We examined whether the permeabilized cells of E. coli carrying pSTV(eutABC)3 and pSTV(eutBC)3 are capable of activation of the enzyme-CN-Cbl complex. In situ formation of inactive complex with CN-Cbl was almost completed within a few minutes of preincubation in both strains (data not shown). When ATP and Mg2+ were supplemented together with AdoCbl in the preincubated reaction mixture containing the enzyme-CN-Cbl complex, about 75% of the activity was restored in the permeabilized E. coli cells carrying pSTV(eutABC)3 (Fig. 6A), but not at all in the permeabilized E. coli cells carrying pSTV(eutBC)3 (Fig. 6B). Such activation did not occur at all in the absence of ATP and Mg2+ or even in the presence of ATP and Mg2+ without added AdoCbl. Prolonged preincubation with CN-Cbl led to a sudden decrease in capability of activation, probably due to the lability of the EAL-reactivating factor (data not shown). Activation of the enzyme-CN-Cbl complex by ATP, Mg2+, and AdoCbl was observed in the cell extracts of induced E. coli JM109 and recombinant E. coli carrying pUCEA3 or pSTV(eutABC)3 as well (data not shown).
![]() View larger version (14K): [in a new window] |
FIG. 6. Time courses of in situ activation of the enzyme-CN-Cbl complex in recombinant E. coli. Permeabilized cells of E. coli carrying pSTV(eutABC)3 (A) or pSTV(eutBC)3 (B) (each, 1.6 x 108 cells) were incubated at 37°C for 1 min with (triangles and inverted triangles) or without (circles) 7.5 µM CN-Cbl in 40 mM potassium phosphate buffer (pH 8.0) containing 50 mM KCl and 5 mM ethanolamine in a total volume of 6.0 ml. The 0.2-ml aliquots were drawn from the mixtures and added to the following mixtures: 30 mM potassium phosphate buffer (pH 8.0), 60 mM KCl, 10 mM ethanolamine, and 15 µM AdoCbl, in the presence (solid symbols) or absence (open symbols) of ATP plus MgCl2 (3 mM each), to a final volume of 1.0 ml. In one control experiment, ATP and MgCl2 were added but AdoCbl was not added (solid inverted triangles). The reaction mixtures were incubated at 37°C for the indicated times, and the acetaldehyde formed was determined as described in the text.
|
In vitro reactivation of the ethanolamine-inactivated holoEAL by purified EutA. The purified recombinant EutA was examined in vitro for activity as a reactivating factor for EAL. When the holoEAL suicidally inactivated during deamination of ethanolamine was incubated with EutA in the presence of AdoCbl, ATP, and Mg2+, rapid reactivation of EAL took place (Fig. 7A). No restoration of EAL activity was observed without EutA or with EutA but in the absence of ATP and Mg2+. By comparing the activity of reactivated enzyme with that of the noninactivated control, it is evident that 46% of original EAL activity was restored under the conditions. HoloEAL inactivated by O2 in the absence of substrate also underwent rapid reactivation by the factor in the presence of AdoCbl, ATP, and Mg2+ (data not shown). Thus, it can be concluded that EutA alone actually functions as a reactivating factor for both the suicidally inactivated and O2-inactivated holoEAL in vitro.
![]() View larger version (12K): [in a new window] |
FIG. 7. Time courses of in vitro reactivation of suicidally inactivated holoEAL (A) and in vitro activation of the EAL-CN-Cbl complex (B) by purified EutA. Suicidally inactivated holoEAL was formed by incubation of purified apoEAL (0.11 U; 5.9 µg) at 37°C for 45 min with 20 µM AdoCbl in 40 mM potassium phosphate buffer (pH 8.0) containing 0.4 M ethanolamine and 0.4% Brij 35 in a total volume of 25 µl. The EAL-CN-Cbl complex was formed by incubation of apoEAL (0.11 U; 5.9 µg) at 37°C for 15 min with 4 µM CN-Cbl in 40 mM potassium phosphate buffer (pH 8.0) containing 0.4 M ethanolamine and 0.4% Brij 35 in a total volume of 25 µl. In vitro reactivation and activation were assayed as described in the text with (circles) or without (triangles) 33 µg of EutA in the presence (solid symbols) and absence (open symbols) of ATP plus MgCl2 (20 mM each). AdoCbl was added to a final concentration of 10 µM. Noninactivated EAL was treated similarly to controls to estimate the extent of (re)activation. Error bars, average ± SD for the results of three experiments.
|
|
|
|---|
![]() View larger version (35K): [in a new window] |
FIG. 8. Deduced amino acid sequence of E. coli EutA (A) and fragmentary sequence homology between reactivating factors and Hsp70 family molecular chaperones (B). Positions that show fragmentary homology in panel B are underlined in panel A. Identical and similar amino acid residues are indicated by asterisks and dots, respectively, in panel B. Eco, E. coli; Kox, K. oxytoca; Kpn, K. pneumoniae; Cco, Clostridium cochlearium; hum, human.
|
All the data presented here strongly suggest that the reactivation of inactivated holoEAL occurs similarly, although the detailed mechanism of the EAL-reactivating factor has not yet been elucidated. Baker et al. (4) reported that AdoCbl-dependent ß-lysine mutase undergoes concomitant inactivation during catalysis that accompanies irreversible cleavage of the Co-C bond of AdoCbl. They noted that this inactivation is prevented by the addition of ATP and a sulfhydryl protein named E2. However, it might be possible that this phenomenon is not due to the prevention of inactivation but to the reactivation of the inactivated holoenzyme and that E2 is a kind of reactivating factor for this enzyme. It was reported that there is a glmL (mutL) gene between the glmS (mutS) and glmE (mutE) genes for clostridial glutamate mutase (50). The function of its product is not known at present. Since the deduced amino acid sequence of GlmL (MutL) shows fragmentary similarity to DdrA, GdrA, and EutA (Fig. 8B), it might be a reactivating factor for glutamate mutase or its major component. Therefore, such reactivating factors are not special but rather general for the AdoCbl-dependent enzymes. This seems reasonable, because AdoCbl-dependent enzymes catalyze reactions by radical mechanism and tend to undergo suicide inactivation during catalysis or inactivation by oxygen in the absence of substrate (40).
We thank Hirotada Mori for providing clone 421 of the Kohara E. coli genomic
phage library. We also thank Kumiko Ito, Ruriko Ogawa, and Yukiko Kurimoto for assistance in manuscript preparation.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»